ID: 934922939

View in Genome Browser
Species Human (GRCh38)
Location 2:98360185-98360207
Sequence CATTTGTAAGAGAGGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 488}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934922929_934922939 23 Left 934922929 2:98360139-98360161 CCTTCAGCAGCAACCTTAAGGAA 0: 1
1: 0
2: 1
3: 14
4: 161
Right 934922939 2:98360185-98360207 CATTTGTAAGAGAGGGAGGGGGG 0: 1
1: 0
2: 4
3: 45
4: 488
934922930_934922939 10 Left 934922930 2:98360152-98360174 CCTTAAGGAAATGACTCACCTGT 0: 1
1: 0
2: 1
3: 14
4: 189
Right 934922939 2:98360185-98360207 CATTTGTAAGAGAGGGAGGGGGG 0: 1
1: 0
2: 4
3: 45
4: 488
934922931_934922939 -8 Left 934922931 2:98360170-98360192 CCTGTCCAGTTTCTTCATTTGTA 0: 1
1: 0
2: 10
3: 61
4: 517
Right 934922939 2:98360185-98360207 CATTTGTAAGAGAGGGAGGGGGG 0: 1
1: 0
2: 4
3: 45
4: 488
934922927_934922939 27 Left 934922927 2:98360135-98360157 CCGGCCTTCAGCAGCAACCTTAA 0: 1
1: 0
2: 0
3: 14
4: 210
Right 934922939 2:98360185-98360207 CATTTGTAAGAGAGGGAGGGGGG 0: 1
1: 0
2: 4
3: 45
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934922939 Original CRISPR CATTTGTAAGAGAGGGAGGG GGG Intronic
901888923 1:12245009-12245031 CATCTGTAAAAGAGAGAGGTTGG + Intronic
901922836 1:12548651-12548673 CATTGGAGAGGGAGGGAGGGAGG + Intergenic
902170064 1:14602915-14602937 CATTTGTTAGAAGGGGATGGAGG + Intronic
902257047 1:15196425-15196447 CATGTGAAAGAGAGAGGGGGAGG + Intronic
902317478 1:15633328-15633350 CATCTGTAAGAGATGCAGAGAGG - Intronic
902882404 1:19381290-19381312 CATCTGTGTGAGAGGGAGGAGGG - Intronic
903077808 1:20786195-20786217 CGTTTGTAAGAGATGGAGGCAGG - Intronic
903702486 1:25260712-25260734 CATCTGCAAGACAGGGAGAGAGG - Intronic
903711724 1:25330866-25330888 CATCTGCAAGACAGGGAGAGAGG - Intronic
903765475 1:25731634-25731656 CCTGTGTTAGAGAGGGAGGAAGG - Intronic
904035283 1:27555713-27555735 CCTCAGTAAGGGAGGGAGGGAGG - Intronic
904948741 1:34218666-34218688 AACCTGGAAGAGAGGGAGGGTGG - Exonic
905289379 1:36911113-36911135 CACTGGGGAGAGAGGGAGGGAGG + Intronic
905481994 1:38268046-38268068 TATTTGAAGGAGAGAGAGGGAGG - Intergenic
908230537 1:62100416-62100438 CATGAGGCAGAGAGGGAGGGGGG + Intronic
908513847 1:64872332-64872354 CAATTCTAAGAGAGGGGTGGGGG - Intronic
908518033 1:64913614-64913636 CATTTGGGAGGGAGGGAGGGAGG + Intronic
908699018 1:66878004-66878026 AATATGTAAAAGAGAGAGGGGGG - Intronic
908859881 1:68472017-68472039 CATTTGTAAGAAAGTGATGGAGG - Intergenic
908999759 1:70204717-70204739 TGTGTGTAAGAGAGAGAGGGAGG - Intronic
909138845 1:71836880-71836902 CATTTCTAAGAAAGGAAGGAAGG + Intronic
909399688 1:75213129-75213151 CATTGGTAAGAAAGTGAGGAGGG - Intronic
910681621 1:89871446-89871468 TATTTTTAGGAGAGGGAAGGGGG - Intronic
910766172 1:90784624-90784646 CATTAGCATTAGAGGGAGGGAGG + Intergenic
911361980 1:96888005-96888027 CATTAGGAAGTGAGTGAGGGAGG - Intergenic
912680515 1:111726199-111726221 CATTTGAAAGTGAGCGAGGCAGG - Exonic
912857615 1:113184757-113184779 GATTGGGGAGAGAGGGAGGGAGG + Intergenic
913278762 1:117164871-117164893 CATTTGAAAGAGAGGTTGAGGGG - Intronic
913665547 1:121045041-121045063 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914160840 1:145132687-145132709 CATTTTTAGTAGAGGCAGGGTGG - Intergenic
914245606 1:145883712-145883734 CATTTGTCAGAGAAGTAGTGTGG - Intronic
914515101 1:148367688-148367710 TATTTCAAAGAGAGGGAGTGTGG + Intergenic
914655554 1:149736853-149736875 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914767054 1:150647567-150647589 AATTTGTAAGGAAGGAAGGGGGG - Exonic
915154612 1:153864643-153864665 GAGATGAAAGAGAGGGAGGGAGG + Intronic
915626678 1:157118168-157118190 CATCTGTCAGACAGGGATGGTGG + Intergenic
916045714 1:160998669-160998691 CAGTGGTAGGAAAGGGAGGGAGG + Exonic
916813135 1:168323792-168323814 CATCTGTAGGAGAGGCTGGGAGG - Intergenic
916947544 1:169743848-169743870 CACTTGTAGGAGAGGCAGTGTGG - Intronic
917012597 1:170490953-170490975 CAAGTGTAAGACAGGGAGGGAGG + Intergenic
917294838 1:173507746-173507768 CATTTATAAGCCAAGGAGGGAGG + Intronic
917630364 1:176885511-176885533 TACTTGTAAGGGAGGGAGGCTGG - Intronic
917660102 1:177170005-177170027 GAATTGAAAGAGAGGGAGGGAGG - Intergenic
917745954 1:178007365-178007387 CGTTTGACAGAGATGGAGGGTGG + Intergenic
918039146 1:180901655-180901677 CAGCTGTAAGAGAAGGAGGCAGG + Intergenic
918513448 1:185336573-185336595 GATTGGGAAGAGAGGGAGGCTGG + Intergenic
918516125 1:185365726-185365748 CCTCTGTAGGAGAGAGAGGGAGG + Intergenic
918789564 1:188808905-188808927 CTTTTGGAAGAGAGGTAAGGAGG + Intergenic
918809769 1:189100985-189101007 GATTAGGCAGAGAGGGAGGGAGG + Intergenic
919122483 1:193358499-193358521 CAATTGCAAGGGAGGAAGGGAGG - Intergenic
919137157 1:193524444-193524466 CTATTGTATGTGAGGGAGGGAGG + Intergenic
919795767 1:201320568-201320590 CACTTCTAAGTGAGGGAGAGTGG - Intronic
919812905 1:201420206-201420228 CATTTGTCAGTGAGGCAGGCTGG - Intronic
919929252 1:202210473-202210495 TATTTGAGAGAGAGGGAGGGAGG + Intronic
920558971 1:206925419-206925441 CATCTGTAACATAGGGAGGATGG - Intergenic
920981018 1:210835549-210835571 AATGTGGGAGAGAGGGAGGGAGG + Intronic
922769966 1:228176404-228176426 CATTTGGGGGAGAGGGAGGTGGG + Exonic
923411187 1:233710949-233710971 CATTCATAAGAAAGGGGGGGGGG + Intergenic
924599452 1:245475533-245475555 TATTTGTAAGAGATGGAGTCTGG - Intronic
1064197314 10:13255450-13255472 CACATGTGAGAGAGGGAAGGGGG + Intergenic
1064949222 10:20828683-20828705 CATGTGAGAGGGAGGGAGGGAGG + Intronic
1065120069 10:22520707-22520729 CATGAGAGAGAGAGGGAGGGAGG - Intergenic
1065472179 10:26093759-26093781 CAGTTTTAAGAGAGGGGGAGAGG - Intronic
1067129131 10:43545783-43545805 GATTTGGAAGGGAGGGTGGGTGG - Intergenic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067781735 10:49212652-49212674 CCATTGAAAGAAAGGGAGGGAGG + Intergenic
1068022322 10:51600915-51600937 CATTTTTGAGAGAGAGAGAGAGG + Intronic
1068405182 10:56578792-56578814 CATTAGTCAGAGAGTGAGGGTGG + Intergenic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1070558415 10:77547436-77547458 CTTTAGGAAGACAGGGAGGGAGG + Intronic
1071258582 10:83897787-83897809 TGTGTGTAAGAGAGAGAGGGAGG + Intergenic
1071721368 10:88149813-88149835 CCTTTGGAAGAGAGGGAGCGTGG + Intergenic
1072245816 10:93542936-93542958 GATTTGCAGGAGAGGGAAGGAGG + Intergenic
1072921959 10:99584051-99584073 AAATTGGGAGAGAGGGAGGGAGG - Intergenic
1073421739 10:103429515-103429537 CATCTGTAAGCCAGGGAGAGAGG - Intronic
1073537260 10:104289058-104289080 TATTTGTAAGATAGTGTGGGGGG - Intronic
1074383528 10:112999318-112999340 GATTTGTGGGAGAGGCAGGGAGG + Intronic
1074714902 10:116209407-116209429 CTTCTGTCAGTGAGGGAGGGAGG - Intronic
1075438987 10:122464434-122464456 TATTTGCAAAAGAAGGAGGGAGG - Intronic
1075742669 10:124705364-124705386 CATTTGTAAAACAAGGAGGCTGG + Intronic
1076102035 10:127790310-127790332 AAGTTGTATGAGAGGGAGGAGGG - Intergenic
1076509042 10:130999310-130999332 CATTTGGAAGGGAGGGAGAGAGG + Intergenic
1076611504 10:131728826-131728848 CCTTTGTCAGAGTGGGAGGTTGG + Intergenic
1077538241 11:3134605-3134627 CTTTTGGAAAGGAGGGAGGGAGG + Intronic
1077878374 11:6326708-6326730 GATTTGTCAGGGAGGGAGGAGGG + Intergenic
1078095865 11:8296809-8296831 CATCTGTAAGAGGGGGATGAAGG - Intergenic
1078233123 11:9460668-9460690 CATTTTGTAGCGAGGGAGGGAGG - Intronic
1078958858 11:16239312-16239334 CATTGGAGAGAGAGGGAGAGGGG - Intronic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1079264244 11:18914974-18914996 CAAGAGTAAGAGAGAGAGGGAGG + Intergenic
1080550969 11:33374001-33374023 CATCTGAAGGAGAGGGAGAGGGG - Intergenic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1081988834 11:47326718-47326740 AACCTGCAAGAGAGGGAGGGAGG - Exonic
1082060545 11:47856317-47856339 GATTAGCAAGAGAGGGAGGAGGG - Intergenic
1082791929 11:57351506-57351528 CATTTTGAAGAAAGGGAGAGAGG + Intronic
1084368608 11:68721269-68721291 CTGTGGCAAGAGAGGGAGGGTGG - Intronic
1085059976 11:73436753-73436775 CATTTTGAGGAGAGGCAGGGAGG - Intronic
1085539903 11:77257537-77257559 TGTGTGTAGGAGAGGGAGGGAGG - Intronic
1085785024 11:79440942-79440964 TGTGTGTAAGAGAGCGAGGGTGG - Intronic
1085916490 11:80894758-80894780 CATGTGTGAGAGAGAGAGAGAGG + Intergenic
1086251386 11:84819055-84819077 TATTTGTGAGTGAGGGAGTGTGG - Intronic
1086416261 11:86591514-86591536 CATCTGTAAGCGAAGGAGAGAGG + Intronic
1086545418 11:87962124-87962146 CTTTTCTGAGAGAGGAAGGGAGG - Intergenic
1086635229 11:89074721-89074743 GATATGGAAGAAAGGGAGGGAGG + Intergenic
1089003694 11:115073324-115073346 CATTTGCAAGACAAGAAGGGAGG - Intergenic
1089170572 11:116508653-116508675 GATGGGTAGGAGAGGGAGGGAGG - Intergenic
1089213610 11:116822389-116822411 CTCATGGAAGAGAGGGAGGGAGG - Intronic
1089327695 11:117668637-117668659 CATTGGTAGGAGAGTCAGGGAGG - Intronic
1089899893 11:121970054-121970076 CATTTCTTATAGAGGGAGAGGGG - Intergenic
1089982631 11:122785032-122785054 CCTTTCTAAGAGAAGGAAGGTGG + Intronic
1090011986 11:123053537-123053559 CTCTTGGAAGAGTGGGAGGGTGG - Intergenic
1090055657 11:123422145-123422167 CATTTGTAGGAGAGGGATGTGGG + Intergenic
1090332214 11:125941250-125941272 CTGTTGTAAGAGCGGGATGGTGG - Intergenic
1090391224 11:126389118-126389140 CAAGTGCAAGAGAGAGAGGGAGG - Intronic
1090824869 11:130377710-130377732 CATTAGAAAAAAAGGGAGGGTGG + Intergenic
1090930096 11:131289935-131289957 CATGTGTAAGAGATGGAGCAGGG - Intergenic
1091284779 11:134402521-134402543 CAGGTGTAACAGAGGGAGGTGGG - Intronic
1091721587 12:2817889-2817911 CAGCTGTAAGAGAGAAAGGGAGG - Exonic
1091734808 12:2911951-2911973 TTTTTTTAAGAGATGGAGGGTGG - Intronic
1091770474 12:3148085-3148107 CCTTTGAAAGAAAGGGAGGAAGG + Intronic
1091845372 12:3652083-3652105 GAATTGAAAAAGAGGGAGGGAGG - Intronic
1092482509 12:8873035-8873057 TATTTGTAAGAGAATGAGAGTGG + Intronic
1093490577 12:19700316-19700338 CATTGAGAAGAGATGGAGGGAGG + Intronic
1093516169 12:19989478-19989500 CATTTGTAAGAGAAGAATTGGGG + Intergenic
1094303155 12:28988862-28988884 ATTTTGTAGGAGAGTGAGGGAGG - Intergenic
1094462077 12:30707123-30707145 CATTTGTAAGAGATAGAGTAGGG - Intergenic
1098140969 12:67450089-67450111 CATCTGTAGGAGTGGGCGGGAGG + Intergenic
1098878189 12:75889041-75889063 TATTTGTCAGAGAGGGAAGGAGG - Intergenic
1099219202 12:79892284-79892306 CATGTTTAAGAAATGGAGGGTGG - Intronic
1099825186 12:87767265-87767287 CATTCACAAGAGAGAGAGGGAGG + Intergenic
1100002106 12:89849724-89849746 CATTCGTTTGACAGGGAGGGTGG - Intergenic
1101564603 12:105893899-105893921 AATGTGGAAGAAAGGGAGGGAGG + Intergenic
1102039990 12:109794483-109794505 CGGTTCTAAGAGAGGCAGGGTGG + Exonic
1102469250 12:113150297-113150319 CATCTGTAAAATGGGGAGGGGGG + Intronic
1102514227 12:113435575-113435597 CATTTGTAGGGGCTGGAGGGTGG + Intronic
1102746212 12:115251231-115251253 CAGTTATAAGGGAGAGAGGGAGG + Intergenic
1104549740 12:129745531-129745553 GATTAGTAAGAGATAGAGGGGGG - Intronic
1104900255 12:132186196-132186218 GATGTGTAAGAAAAGGAGGGAGG - Intergenic
1106684485 13:32043516-32043538 CATTTGTAAGTGATGGAGCTAGG + Intronic
1107134930 13:36933415-36933437 AATTTGGCAGAGAGGGAGAGTGG - Intergenic
1107455655 13:40552409-40552431 CATCTGTAAGATAGGGAGAGAGG - Intergenic
1107686989 13:42911210-42911232 TATCTGTGAGAGAGAGAGGGAGG + Intronic
1107901951 13:45025582-45025604 AATTTTTGAGGGAGGGAGGGAGG - Intronic
1108463689 13:50693532-50693554 CAGTTTACAGAGAGGGAGGGTGG - Intronic
1109237059 13:59835716-59835738 CAGTTGTAAGAGTGGGAAGTGGG - Intronic
1109610675 13:64761273-64761295 AAATTGTAAGTGAGGGAGGCAGG + Intergenic
1109880312 13:68464957-68464979 CATTTGTAAGTGAGGAAATGTGG + Intergenic
1110392215 13:74986963-74986985 CATTCCTCAGGGAGGGAGGGGGG + Intergenic
1110944048 13:81390664-81390686 AATTTTTAAGAGAGGAATGGGGG - Intergenic
1112690232 13:101884947-101884969 AATTAGTAAGTGAGGAAGGGTGG + Intronic
1112918652 13:104582189-104582211 GATTTGGAAGGGAAGGAGGGGGG - Intergenic
1113016934 13:105838283-105838305 CATTTTAAAAAGCGGGAGGGAGG + Intergenic
1115402496 14:32978260-32978282 CATTTGTAAGATTGGGAGTTGGG + Intronic
1116397598 14:44465134-44465156 CATTTTTAAGCAAGAGAGGGGGG - Intergenic
1116615084 14:47125610-47125632 AATAAGTGAGAGAGGGAGGGAGG + Intronic
1117617265 14:57546371-57546393 TTTCTGAAAGAGAGGGAGGGTGG + Intergenic
1117717347 14:58594653-58594675 TATATGTAAGTGAGGAAGGGCGG + Intergenic
1117956792 14:61129414-61129436 CCTTTGGAAGGGAGGGAGAGGGG + Intergenic
1119141147 14:72268507-72268529 GATTTGTAAAGGAGAGAGGGAGG - Intronic
1119971661 14:78977620-78977642 TATTTGTAAGAGTGAGAGGATGG - Intronic
1121078816 14:91090956-91090978 CCTCTGCAAGAGAGGGAGGAAGG + Intronic
1122007432 14:98717004-98717026 CACTTGGCAGAGAGGGAGGCGGG + Intronic
1122288269 14:100665679-100665701 CAAGAGGAAGAGAGGGAGGGCGG + Intergenic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1122642273 14:103166967-103166989 CATTTATAATAGAGACAGGGAGG + Intergenic
1123405846 15:20018971-20018993 CAACTGAGAGAGAGGGAGGGAGG + Intergenic
1124588567 15:31033717-31033739 CAGTTATAGGAGAGAGAGGGTGG - Intronic
1124613008 15:31221952-31221974 CATTTCTAAGAGAGGGTGAAGGG + Intergenic
1125074934 15:35602993-35603015 AATATGAAAGAGAGGGAGGTAGG - Intergenic
1125257763 15:37785668-37785690 TATTTATAAAAGAGGGATGGTGG - Intergenic
1125380505 15:39081643-39081665 CTATTGAAAGAGAGGGAGAGAGG - Intergenic
1125840165 15:42793094-42793116 CACTTGTAAGATAGGGTGGCTGG + Intronic
1126349487 15:47729725-47729747 GATGGGTAAGAGAGTGAGGGAGG - Intronic
1126798837 15:52282238-52282260 AATGTGTAAGGGAGGGAGTGTGG - Intronic
1127472582 15:59303710-59303732 CATTTGTGAGCCAGGGAGAGGGG - Intronic
1128445702 15:67758065-67758087 TATTTGTAGGGGAGGGAGGATGG + Intronic
1128512910 15:68324778-68324800 CATCTGTAAAGGAGGGAGGTGGG + Intronic
1131274212 15:90967230-90967252 CATGTGTAAGAGAGGCAGTATGG - Intronic
1133513707 16:6485332-6485354 GAGGGGTAAGAGAGGGAGGGAGG - Intronic
1134777784 16:16867922-16867944 CCTTTGTAAGAGAGAGAATGGGG - Intergenic
1135723195 16:24834257-24834279 CATTGATAAGGGAGGAAGGGAGG + Intergenic
1135815341 16:25627463-25627485 CAGGAGCAAGAGAGGGAGGGAGG + Intergenic
1135940931 16:26821158-26821180 CATTGGTCTGAGAGGGAGGTGGG + Intergenic
1136074819 16:27809788-27809810 CAGTGGAAAGACAGGGAGGGTGG - Intronic
1136255208 16:29034388-29034410 CATATGGAAGAGGGGAAGGGAGG + Intergenic
1136541745 16:30931158-30931180 CATTTCTAATAGAGGCTGGGGGG - Intronic
1136683304 16:31980231-31980253 CATATAGAAGTGAGGGAGGGGGG + Intergenic
1136783937 16:32923787-32923809 CATATAGAAGTGAGGGAGGGGGG + Intergenic
1136885846 16:33930019-33930041 CATATAGAAGTGAGGGAGGGGGG - Intergenic
1136932606 16:34432684-34432706 CAATGGGAAGAGAGGGCGGGAGG - Intergenic
1136971966 16:34979130-34979152 CAATGGGAAGAGAGGGCGGGAGG + Intergenic
1137315327 16:47314053-47314075 CATTTCTATAGGAGGGAGGGGGG + Intronic
1137763183 16:50957202-50957224 CATTGGCAAGACAGTGAGGGAGG - Intergenic
1138969259 16:62124976-62124998 CATTTGTAAGAGATTAAGGTGGG - Intergenic
1139183713 16:64777596-64777618 CATGGGCAAGAGAGAGAGGGAGG - Intergenic
1140034630 16:71363006-71363028 AATTTGTAGTAGGGGGAGGGGGG - Intronic
1140225745 16:73075314-73075336 AACTTGAAAGAGAGGAAGGGAGG + Intergenic
1140272443 16:73479136-73479158 CATTGGTAAGGAAGGGAGGGTGG - Intergenic
1140502289 16:75444140-75444162 GAAATGCAAGAGAGGGAGGGAGG - Intronic
1140592440 16:76369836-76369858 TGTTTCAAAGAGAGGGAGGGAGG + Intronic
1141137220 16:81474289-81474311 CAGTAGGGAGAGAGGGAGGGAGG - Intronic
1141356010 16:83347621-83347643 CATCTGTAAGATAGGGATAGTGG - Intronic
1141599323 16:85115619-85115641 CATTTATAGGAGAGAGGGGGTGG - Intergenic
1141635382 16:85311497-85311519 CATTGGGGAGGGAGGGAGGGAGG + Intergenic
1203086593 16_KI270728v1_random:1187789-1187811 CATATAGAAGTGAGGGAGGGGGG + Intergenic
1142599524 17:1046818-1046840 CATCTGTAAGATGGGGAGGAGGG + Intronic
1142942243 17:3390240-3390262 AATAAGAAAGAGAGGGAGGGAGG + Intergenic
1146467167 17:33095528-33095550 CATCTGTAAAACAAGGAGGGTGG - Intronic
1146988324 17:37243494-37243516 CAATTCTAGGAGAGGCAGGGAGG + Exonic
1147045765 17:37750958-37750980 CATTTCGAAGGAAGGGAGGGAGG - Intergenic
1147399447 17:40171257-40171279 CTTTTGTGAGAAAGGGATGGTGG + Exonic
1148542511 17:48492121-48492143 CATATGTCAAAGAGGAAGGGAGG + Intergenic
1149067492 17:52497559-52497581 CATGAGTAACAGAGAGAGGGAGG + Intergenic
1150282622 17:63938267-63938289 CACCTGGAAGAGAGGGAGTGTGG + Intergenic
1151468040 17:74300355-74300377 CAGACATAAGAGAGGGAGGGAGG - Intronic
1151678000 17:75609707-75609729 CATCAGGAAGGGAGGGAGGGAGG - Intergenic
1152013682 17:77735888-77735910 TATTTGTGAAAAAGGGAGGGAGG + Intergenic
1152138100 17:78517787-78517809 CAGTTGTAAGAGAGAGAAGCTGG - Intronic
1152555370 17:81050297-81050319 CATCTGCAAGAGAGGGGCGGCGG - Intronic
1152795630 17:82304712-82304734 CATGGGGAAGAGAGGAAGGGAGG - Intergenic
1152796614 17:82310745-82310767 CATCTGTAAATGAGGGAGGTGGG - Intergenic
1153841339 18:9010873-9010895 CATTTGGTGGGGAGGGAGGGAGG + Intergenic
1153850120 18:9086035-9086057 GATATGGGAGAGAGGGAGGGGGG - Intergenic
1154236188 18:12608460-12608482 TGTTTGTAAGAGAGGAAAGGTGG - Intronic
1156758376 18:40556647-40556669 AATTTGTAACAGAGGCAGGGCGG - Intergenic
1157392182 18:47312029-47312051 CATTGGAAAGTGAGGGAGGTTGG + Intergenic
1157558412 18:48628804-48628826 GATTTGAGAGAGAGAGAGGGAGG - Intronic
1160927314 19:1552981-1553003 TTTTTATAAGAGAGGGAGAGGGG - Intergenic
1160955705 19:1690855-1690877 GATGTGGAAGGGAGGGAGGGAGG + Intergenic
1161116406 19:2499302-2499324 CATCTGGAGCAGAGGGAGGGAGG - Intergenic
1162872618 19:13598004-13598026 CATTTGCAGGAGAGGAAGTGGGG - Intronic
1163284777 19:16339502-16339524 CATTAGTGAGAGAGGGAGACAGG + Intergenic
1163511781 19:17739727-17739749 CACTTTTAAGAGAGGGAGTCAGG - Intergenic
1164464535 19:28476224-28476246 CAGTAGTGAGTGAGGGAGGGGGG - Intergenic
1165661638 19:37585838-37585860 TATTTGTAAGTGATAGAGGGAGG + Intronic
1166410222 19:42551727-42551749 TATAAGTAAGAGAGGGAGGCAGG + Intronic
1167306165 19:48710987-48711009 CATGGGTCACAGAGGGAGGGAGG - Intergenic
1168477007 19:56683657-56683679 CATTTCTAAGTGAAGGAGGTGGG - Intergenic
925749978 2:7079339-7079361 AATTAGTAAGAAAGGGAGGCAGG - Intergenic
925975234 2:9137700-9137722 CATTTGACAGAGATGGAAGGGGG + Intergenic
926120091 2:10237121-10237143 CTTTTCTAAGAGTGGCAGGGAGG + Intergenic
926426893 2:12746381-12746403 CACATGGAAGAGAGAGAGGGGGG + Intergenic
926452626 2:13024126-13024148 CAATGGAAAGAGAGGGAGGGAGG + Intergenic
926841752 2:17088829-17088851 CATTTTTCAGTGAGGGTGGGAGG + Intergenic
927484581 2:23479749-23479771 CATGGCTAAGGGAGGGAGGGAGG - Intronic
928642344 2:33313568-33313590 CTTTTGTAAGAGATAAAGGGAGG + Intronic
928738343 2:34319233-34319255 CATGTGTGTGAGAGGAAGGGTGG + Intergenic
929904254 2:46032412-46032434 CCATTTTAAGAGAGGGATGGCGG - Intronic
930044003 2:47152972-47152994 CTTTTGAAAGAGAAGGATGGTGG - Exonic
930050792 2:47214925-47214947 AATTTGCAAGAGAGAGAGAGAGG + Intergenic
930083807 2:47477913-47477935 CCTTTGTGTGGGAGGGAGGGAGG - Intronic
930689399 2:54344714-54344736 CATTTATAAGAAGGGGACGGGGG - Intronic
930752925 2:54949592-54949614 CATGTGTCAGAGAGAGAGGGTGG - Intronic
930804160 2:55473271-55473293 TTTTTTTAAGAGATGGAGGGTGG - Intergenic
931117927 2:59184526-59184548 CCTTTGCATGAGGGGGAGGGAGG + Intergenic
931243612 2:60474978-60475000 CATTTGGAAGGGAGGGAGAGAGG + Intronic
931994630 2:67828126-67828148 CATTTGTAAGAGAGTAAGAACGG - Intergenic
932564815 2:72899598-72899620 AATTTGGAAGAGAGAGAGGAAGG + Intergenic
932972756 2:76565131-76565153 CATTTCAAAGAGAAGGAGTGGGG + Intergenic
934611410 2:95739657-95739679 CAGGTGCAAGAGAGGGAGTGTGG - Intergenic
934844817 2:97656037-97656059 CATATCTGAGAGAGGGAGGTGGG + Exonic
934885077 2:98017243-98017265 CAATTCTATGAGAGGGAGGTGGG + Intergenic
934922939 2:98360185-98360207 CATTTGTAAGAGAGGGAGGGGGG + Intronic
936036859 2:109120207-109120229 CATTTGTAAGAGGAGGGGGAGGG + Intergenic
937824505 2:126352768-126352790 CATTTGTAAGTGAGGATGTGTGG - Intergenic
937945140 2:127327326-127327348 CATTTGTTAGTGAGACAGGGAGG + Intronic
938638879 2:133259057-133259079 CACCTGGAAGAGAGGGTGGGAGG - Intronic
939119133 2:138095114-138095136 CATTCATTAGATAGGGAGGGAGG - Intergenic
939856577 2:147365920-147365942 ATTTTGCAAGAGAGGGAGGGAGG - Intergenic
940222486 2:151367401-151367423 AAAATGTAAGAGAGGGAGGGAGG - Intronic
940887222 2:159000377-159000399 CATTTGCTAGAGTAGGAGGGAGG + Intronic
941319633 2:164038985-164039007 CAGGAGCAAGAGAGGGAGGGTGG + Intergenic
942858017 2:180575204-180575226 CATGTGTAAGAGGGGAATGGGGG - Intergenic
943247015 2:185467621-185467643 CATTTTTTTGAGGGGGAGGGTGG + Intergenic
943541435 2:189219874-189219896 CACTTCTAAGAGTGGGGGGGGGG - Intergenic
944406729 2:199393118-199393140 CATTTGTAGCAGAGGGTGGGTGG - Intronic
945051072 2:205824953-205824975 CATCTCTACAAGAGGGAGGGAGG + Intergenic
945142579 2:206702697-206702719 CATTTGTAAAATAAGGTGGGTGG + Intronic
945887995 2:215397327-215397349 TATTTTTATGGGAGGGAGGGAGG - Intronic
945908574 2:215621033-215621055 CATTTGTATCTGAAGGAGGGAGG - Intergenic
946007665 2:216539348-216539370 CATCTATAAGGCAGGGAGGGAGG - Intronic
946435226 2:219647230-219647252 CAGGGGTAAGAGAGAGAGGGGGG - Intergenic
946878274 2:224151817-224151839 TATAAGTAAGAGAGGGAGGGAGG + Intergenic
947790798 2:232867714-232867736 CATATGGATGATAGGGAGGGAGG - Intronic
948114630 2:235485286-235485308 GCTTTGAAATAGAGGGAGGGAGG + Intergenic
948115179 2:235490159-235490181 CAGGTGTAAGAGAGAGAGAGAGG - Intergenic
948162011 2:235832842-235832864 CATGTGTGTGAGAGAGAGGGTGG + Intronic
948991027 2:241554086-241554108 CATTTGTCACCGTGGGAGGGAGG + Intergenic
1169005106 20:2200257-2200279 CATTTGTAAAAGAAAAAGGGAGG - Intergenic
1169189385 20:3648186-3648208 CCTTGGTCTGAGAGGGAGGGTGG - Exonic
1169782769 20:9327038-9327060 CATCTGTAAGGTAGGGATGGTGG + Intronic
1170357661 20:15509778-15509800 CATCTGTAAAATAGGGAGGGTGG + Intronic
1170569347 20:17624143-17624165 CCTTTCCAAGAGAGGGATGGGGG - Intronic
1170920632 20:20676080-20676102 AGTTTGTAAAAGTGGGAGGGTGG + Intronic
1171133755 20:22678355-22678377 GATTTGTCAGAGAAGGAGAGAGG + Intergenic
1172068865 20:32241620-32241642 CTTTTGGTAGAGATGGAGGGGGG - Intergenic
1172312461 20:33929182-33929204 CATTTGCAAGCCAAGGAGGGAGG - Intergenic
1173042276 20:39475572-39475594 CATCTGCAAGACAGGGAGAGAGG - Intergenic
1173256226 20:41395841-41395863 CATCTGAGAGAGAGGGAAGGAGG - Intergenic
1173367754 20:42402601-42402623 CATTTACAAGACAGAGAGGGAGG + Intronic
1173683198 20:44902090-44902112 CAATTTTAAAAGATGGAGGGAGG - Intronic
1174583076 20:51586480-51586502 AATTTGTAAGAGATGGAGCCAGG - Intergenic
1175624967 20:60482403-60482425 CATCTGTAAGAGGTGGACGGTGG - Intergenic
1175829198 20:61952820-61952842 CATATGTAAGAGGGAGATGGAGG - Intergenic
1175942413 20:62543585-62543607 CAGTTGGGAGAGAGGCAGGGTGG - Intergenic
1176015113 20:62926888-62926910 AATTTGTAAGAGGTGTAGGGGGG + Intronic
1178504996 21:33155026-33155048 CCATTGGAAGGGAGGGAGGGAGG + Intergenic
1179479782 21:41669833-41669855 CATTGATAAGCCAGGGAGGGAGG - Intergenic
1181083937 22:20430627-20430649 CCTTTGTTAGGGAGGCAGGGCGG + Intronic
1181417903 22:22773333-22773355 GATTTGGAAGAGAGTGAGGGAGG - Intronic
1181525954 22:23487468-23487490 GACTGCTAAGAGAGGGAGGGAGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182705965 22:32280562-32280584 CATAGGGAAGAGAGGGAGGGAGG - Intergenic
949319947 3:2798071-2798093 GAGTTGAAAGAGTGGGAGGGTGG - Intronic
949789238 3:7774695-7774717 CATGTTTAAGAGAGGGTGGATGG + Intergenic
949838756 3:8297637-8297659 CATGGCAAAGAGAGGGAGGGGGG + Intergenic
950052955 3:10005922-10005944 CATCAGTGAGAGAGGGAAGGTGG - Intronic
950243056 3:11388792-11388814 ACTTTGTAAGATAGGGAGGGAGG + Intronic
950730461 3:14952182-14952204 CATTTGTCAAACAGGGAGGTGGG + Intronic
950899765 3:16486989-16487011 CACATGGCAGAGAGGGAGGGAGG - Intronic
950931678 3:16795728-16795750 CATCTGCAAGACAGGGAGAGAGG - Intergenic
951762402 3:26161175-26161197 GATGTGTAGGAAAGGGAGGGGGG + Intergenic
952000858 3:28784399-28784421 CATTTGTCAAAAAGGGAGGGGGG - Intergenic
954224511 3:49173409-49173431 CATTTCTAAGAGATGGGGGTGGG + Intronic
954353182 3:50062573-50062595 CATTTGTAAAAGAGAGAGTTGGG - Intronic
954904955 3:54053423-54053445 CTTTTCCAAGAGAGGGAGGAGGG + Intergenic
955029953 3:55206298-55206320 CATGTGTAAGAAAGGGAGGAGGG - Intergenic
955037810 3:55285936-55285958 AATTGATAAGAAAGGGAGGGAGG + Intergenic
955098780 3:55826620-55826642 CTTTTGTAAAATGGGGAGGGTGG - Intronic
955344849 3:58153357-58153379 GATTTCTGAAAGAGGGAGGGAGG - Exonic
955942282 3:64157809-64157831 CTTTTATATGGGAGGGAGGGTGG + Intronic
955986353 3:64577478-64577500 CGTCTGGAAGACAGGGAGGGCGG + Intronic
956520705 3:70100503-70100525 CACTTGAAAGAGTGGGGGGGGGG + Intergenic
956732889 3:72213237-72213259 CAGGAGGAAGAGAGGGAGGGAGG + Intergenic
957207649 3:77218262-77218284 CATTAGTATGAGAAGGAGGTTGG - Intronic
957520938 3:81317392-81317414 CATTTGGCAGAGAGGGAGTTGGG + Intergenic
957644616 3:82904785-82904807 AATATAGAAGAGAGGGAGGGAGG - Intergenic
960050684 3:113236506-113236528 CACTTGGAAGGGTGGGAGGGTGG + Intronic
960497303 3:118390372-118390394 CATCTGTAAGCCAAGGAGGGAGG + Intergenic
960772070 3:121205330-121205352 GATGTGCAAGAGAGGGAAGGGGG + Intronic
961323874 3:126098331-126098353 CATCTGCAAGACAGGGAGAGAGG + Intronic
961440503 3:126949997-126950019 CACTTGTCAGGGAGGAAGGGAGG + Intronic
961473026 3:127129480-127129502 CATTTATAAGTGAGGGAGGGAGG + Intergenic
962121890 3:132570109-132570131 AACTTGTAAGAGAAGCAGGGAGG + Intronic
962221931 3:133571808-133571830 TAAATGAAAGAGAGGGAGGGAGG + Intergenic
962967788 3:140370466-140370488 TATATGTAGGAGAGGGAGGGAGG + Intronic
963229839 3:142898489-142898511 CTTGTGGAAGAAAGGGAGGGAGG - Intergenic
963526004 3:146414081-146414103 AATGTGTAAGAGAGAGGGGGAGG + Intronic
963596892 3:147339392-147339414 CATTTTTAGGAGAGAGAAGGGGG + Intergenic
964064851 3:152564783-152564805 CATTAGTAAGAGAGAGATGAAGG - Intergenic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
966077099 3:175950242-175950264 TATTTGTAATAGAGAGATGGAGG - Intergenic
966224915 3:177587873-177587895 CATGAGTAAGAGAGAGAGGTGGG + Intergenic
966570853 3:181441538-181441560 CATTTGTCAGAGATGGGGGACGG - Intergenic
966778651 3:183564652-183564674 AATTTCAGAGAGAGGGAGGGAGG - Intergenic
967145474 3:186602538-186602560 CATTTGCAGGAGAGTGGGGGTGG - Intergenic
967579016 3:191129871-191129893 CTGTTGGAAGAGAGGCAGGGAGG + Intergenic
968493051 4:900814-900836 CAGAAGGAAGAGAGGGAGGGAGG + Intronic
969266141 4:6065294-6065316 CATTTGCTAGAGAAGGAGGCTGG - Intronic
969397259 4:6930293-6930315 CATTTGAAAGTGTGGGAGTGAGG + Intronic
969921368 4:10543438-10543460 CATTTGTGAGACAAGGAGGTTGG + Intronic
970326718 4:14932829-14932851 TATTTGAAAGACAGGGAGAGGGG + Intergenic
970938381 4:21601699-21601721 GATTTGAAAGAGTGGGAGGATGG - Intronic
971176351 4:24286083-24286105 GATTGGTAAAAGAGGGAGAGAGG - Intergenic
971314201 4:25553624-25553646 CATTTGTAAGGGAGGAGAGGAGG + Intergenic
972001568 4:34042240-34042262 CATCTGTAAAAGAGGGAAGGAGG - Intergenic
973566784 4:52197017-52197039 CATTTCTAAGGAAGAGAGGGAGG - Intergenic
975383320 4:73727486-73727508 CAAATGTTAAAGAGGGAGGGAGG + Intergenic
975546730 4:75568060-75568082 CATCTGCAAGACAGGGAGAGAGG - Intergenic
976058864 4:81102657-81102679 TTTTAGTAAGAAAGGGAGGGAGG - Intronic
977216346 4:94288644-94288666 TATTTGTGAGAGAGGGGAGGAGG + Intronic
978371788 4:108036497-108036519 CACTTGTTCAAGAGGGAGGGTGG + Intergenic
978993229 4:115113878-115113900 GATGTGAGAGAGAGGGAGGGAGG - Intergenic
979907172 4:126309237-126309259 CACCTGTAAGAGAGGTTGGGAGG + Intergenic
980026251 4:127770876-127770898 CATTTATAAGACAAGGAGAGAGG - Intronic
980383729 4:132060254-132060276 CATTAGAAAGAGAGAGAGAGAGG - Intergenic
981611919 4:146602240-146602262 CTTTTGGAAGGGAAGGAGGGTGG - Intergenic
981908644 4:149953042-149953064 CATTTTTAAAAGAAGGAGAGAGG + Intergenic
982878452 4:160677291-160677313 TATTTGGAAGTGAGGGAAGGAGG + Intergenic
983571239 4:169210146-169210168 CATTAGTGAGAGAGGAAGGCAGG - Intronic
983580648 4:169306397-169306419 CATTTGGAAGAGGGGAAGGAGGG + Intergenic
984408877 4:179370301-179370323 CATGTGGAAGGTAGGGAGGGTGG - Intergenic
984766201 4:183402383-183402405 CACTGGGCAGAGAGGGAGGGTGG - Intergenic
984946312 4:184971348-184971370 CATTTTTACGAGTGGGAGTGAGG - Intergenic
985569366 5:636356-636378 CATTAGTGAGAGGGTGAGGGAGG - Intronic
985850255 5:2383432-2383454 CATCTGGAAGAGCGGCAGGGTGG - Intergenic
986497773 5:8363680-8363702 TGTTTGTAAGAGAGAGAGGAAGG + Intergenic
987165471 5:15193718-15193740 CATCTGCAAGACAGGGAGAGAGG + Intergenic
988786572 5:34570727-34570749 CAGTGGGAAGAGAGGAAGGGCGG + Intergenic
989715172 5:44454410-44454432 CAGTTTTAACAGAGAGAGGGAGG + Intergenic
990007182 5:50957305-50957327 AATTAGGAAGGGAGGGAGGGAGG - Intergenic
990013952 5:51035036-51035058 CATTCATAAGAAAGGGATGGGGG - Intergenic
990535317 5:56715928-56715950 CTGTTGTAAGAGAGGAAAGGAGG + Intergenic
990630949 5:57668152-57668174 CATATGTAGGACAGTGAGGGAGG + Intergenic
991069442 5:62460302-62460324 CATTTTTAAGGGGGAGAGGGAGG - Intronic
991480343 5:67071359-67071381 TATTTGGTAGGGAGGGAGGGAGG + Intronic
992609884 5:78498103-78498125 CACTTGTGAAAGAGGCAGGGTGG + Intronic
993820359 5:92607449-92607471 CAAATGTAGAAGAGGGAGGGAGG + Intergenic
994753056 5:103763131-103763153 CATTTGTAGGGAAGGGAAGGGGG + Intergenic
995025070 5:107410772-107410794 CAAATGTAAGAGAGGGAGTTAGG - Intronic
995582208 5:113613980-113614002 CATTTGGAAGAGAGACAGGTAGG + Intergenic
995582213 5:113614048-113614070 CATTTGGAAGAGAGACAGGTAGG + Intergenic
996026123 5:118647798-118647820 CGTTCTTAAGAGAGAGAGGGAGG - Intergenic
997249501 5:132377656-132377678 CATTTGTAAAACAGGGATTGGGG - Intronic
998765974 5:145487716-145487738 CATTTTTTAGAGATGGAGGAAGG + Intronic
998906757 5:146913319-146913341 CATGTTTAAGAAAGGCAGGGAGG + Intronic
999182407 5:149679449-149679471 CATTTGGAAGAGATGGGGTGCGG - Intergenic
999377722 5:151098318-151098340 CATCTGCAAGTGAGGGAGGGAGG + Intergenic
999652108 5:153777798-153777820 TACTTGTGAGAGTGGGAGGGAGG - Intronic
1000238839 5:159390155-159390177 CATTTGTGAGCCAAGGAGGGAGG + Intergenic
1000802042 5:165739915-165739937 CATTGGAAAGAGAGGGAGATTGG + Intergenic
1001489373 5:172144849-172144871 CATCTGTAAAAGGGGGTGGGGGG - Intronic
1001865844 5:175104760-175104782 GGTTTGCAAGAGAGGGTGGGTGG - Intergenic
1001958353 5:175863847-175863869 CATGTGCAGGAGAGGCAGGGAGG + Intronic
1002699031 5:181109678-181109700 CATCTTCAAGGGAGGGAGGGAGG + Intergenic
1002909755 6:1480721-1480743 CATCTGTAAGCCAAGGAGGGAGG - Intergenic
1003419398 6:5942210-5942232 CCTTCATAAGAGAGGGAAGGAGG + Intergenic
1003585061 6:7381348-7381370 CATCTGCAAGCCAGGGAGGGAGG + Intronic
1005105816 6:22223269-22223291 CATTTTCTTGAGAGGGAGGGAGG - Intergenic
1005727164 6:28660806-28660828 CTTTGGTAAGAGAGGAAGGCAGG + Intergenic
1006193318 6:32222573-32222595 CTTTTGGAACAGAAGGAGGGAGG + Exonic
1006364858 6:33609383-33609405 AATCTGTGAGAGGGGGAGGGGGG + Intergenic
1006373784 6:33660515-33660537 CAGATTTAAGGGAGGGAGGGAGG - Intronic
1006955615 6:37868401-37868423 CATTTGTGATAGAGGGAGGGAGG + Intronic
1007770273 6:44186480-44186502 CATCTCTTAGAGAGAGAGGGAGG - Intergenic
1007927124 6:45659024-45659046 CATATGTATGAGGGGGATGGGGG + Intronic
1008522318 6:52374034-52374056 CAGGAGTAAGAGAGGGAGTGGGG - Intronic
1008541387 6:52549271-52549293 CTTTTGGAAGGAAGGGAGGGAGG - Intronic
1008637282 6:53423570-53423592 TATTTGTAAGAGAAGGAGTAAGG + Intergenic
1010616337 6:78016647-78016669 CATTTGTAAGAGAGAAAGCAAGG - Intergenic
1011408471 6:87040674-87040696 ATTTTGGAAGAAAGGGAGGGAGG + Intergenic
1011447742 6:87460626-87460648 CAGTGGAAAGAGTGGGAGGGGGG + Intronic
1011781101 6:90790249-90790271 TCTTTGTCAGAGAGGGAAGGTGG + Intergenic
1012998847 6:106000537-106000559 CCTTGGTGAGGGAGGGAGGGAGG - Intergenic
1013350427 6:109300929-109300951 GTTTTGTATGAGAGGGAAGGAGG + Intergenic
1013582771 6:111552419-111552441 CATTTGTAAAAGTGGAAGGCAGG - Intergenic
1013659434 6:112279832-112279854 CATTTGTAAGGGAGACAGGGTGG + Intergenic
1014786236 6:125623220-125623242 CTTTTGTAAGAAAGGGAGTGAGG + Intergenic
1016673060 6:146730966-146730988 CATTTCTGAGAGAGAGAGAGAGG + Intronic
1016743995 6:147558701-147558723 CATTTGGAGGTGAGTGAGGGAGG - Intronic
1018444517 6:163842918-163842940 CAGCTCTAAGAGAGGGAGGGAGG - Intergenic
1018670429 6:166172522-166172544 CCTATGTAAGAGGGGGAGGAAGG - Intergenic
1019193260 6:170266626-170266648 CGTTTGTCAGTGAGGGAAGGTGG + Intergenic
1019503490 7:1377597-1377619 TCTTTGTCAGAGCGGGAGGGAGG - Intergenic
1019686824 7:2386583-2386605 CATCAGGAAGGGAGGGAGGGAGG + Intergenic
1020713736 7:11642217-11642239 CATTACTAAGAGTGGGAGGTAGG + Intronic
1021781896 7:24114481-24114503 TATTAGCAAGAGATGGAGGGTGG - Intergenic
1022086043 7:27068601-27068623 CATTTGTCACAGAGCAAGGGAGG + Intergenic
1022139080 7:27476497-27476519 CATTCAAAAGGGAGGGAGGGAGG + Intergenic
1022539420 7:31122046-31122068 AAATTGTGAGCGAGGGAGGGAGG - Intergenic
1022753022 7:33252109-33252131 CAGGAGCAAGAGAGGGAGGGGGG + Intronic
1022941776 7:35248900-35248922 AATTAGGAAGAGAGGAAGGGAGG + Intronic
1023152508 7:37215330-37215352 TATTGGTGGGAGAGGGAGGGGGG + Intronic
1023742756 7:43295227-43295249 CTTTTGTGAGAGAGGGAGGGAGG + Intronic
1024411337 7:49045859-49045881 GATTTGGAAGAGTTGGAGGGAGG + Intergenic
1024422007 7:49179211-49179233 AAATTGAGAGAGAGGGAGGGAGG - Intergenic
1025752698 7:64307240-64307262 CTTTAGAAAGAGAGGCAGGGCGG - Intergenic
1026018670 7:66692316-66692338 CATGGGTAAGAGAGGGAGGCAGG - Intronic
1026442704 7:70457985-70458007 CATTTCCAAGAGAGTGAGAGGGG + Intronic
1026881732 7:73910382-73910404 CATGGGTAAGAGAGGGAGGCAGG + Intergenic
1029866255 7:103633425-103633447 TATTTGTAAGAGAGAGGGGGCGG + Intronic
1029916648 7:104216519-104216541 TGTTTGTAAGAGATGGAGGGAGG + Intergenic
1030127574 7:106169055-106169077 GACTTGAAAGAGAGGGATGGCGG + Intergenic
1030168801 7:106581007-106581029 CATTTGTATGAGAGTCTGGGTGG + Intergenic
1030675268 7:112378426-112378448 CATTTATATAAAAGGGAGGGAGG - Intergenic
1031549926 7:123097095-123097117 AATTTGTAAGAGAGACAAGGTGG + Intergenic
1032174257 7:129611291-129611313 CATTTCAAAGAGAGAGAGTGAGG + Intergenic
1033269782 7:139920378-139920400 CATTTCTAAAAGAGGCAGGAAGG - Intronic
1033648801 7:143324364-143324386 CAGGTGGAAGAGAGGGAGGTGGG - Intronic
1033649412 7:143329497-143329519 CATTTGCACCAGGGGGAGGGTGG - Intronic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1035119975 7:156559006-156559028 CATTTCTAACAGAGGGGTGGGGG + Intergenic
1037496742 8:19447742-19447764 GACTTGTCAGAGAGGGAGTGTGG + Intronic
1038569529 8:28648625-28648647 CCTCTGGAAGGGAGGGAGGGAGG - Intronic
1038730053 8:30118927-30118949 GATTAGTAAAAGAGGAAGGGAGG - Intronic
1039578427 8:38644211-38644233 TACTTGTGAGAGAGGGAGGAAGG + Intergenic
1040091434 8:43402584-43402606 CAGTGGCAAGAGAGTGAGGGGGG + Intergenic
1042604322 8:70530473-70530495 CTTTTGTAAGAGATGCTGGGTGG + Intergenic
1043318998 8:78958169-78958191 CATTGGTGGGAGAGGGAGAGAGG + Intergenic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1044725605 8:95192088-95192110 CAATTGTAAGTGAGGGAGCCAGG + Intergenic
1045575434 8:103415191-103415213 CATTTGTGGGCGAGGCAGGGCGG - Exonic
1046101428 8:109618696-109618718 CATTTTTAAAGGAGGCAGGGTGG - Intronic
1046608656 8:116399533-116399555 CCTGTGGGAGAGAGGGAGGGAGG + Intergenic
1048163622 8:132042527-132042549 CACTAGTCAGGGAGGGAGGGAGG - Intronic
1049102295 8:140588553-140588575 CATTTGTGAGGGAAGGAGGGAGG + Intronic
1050128031 9:2379831-2379853 CAGAAGCAAGAGAGGGAGGGAGG - Intergenic
1050499076 9:6275949-6275971 CATCTGTAAGAAAGAAAGGGGGG + Intergenic
1050997369 9:12237291-12237313 TCTTTGTAAGAGAGGGAAGTTGG - Intergenic
1051624357 9:19084524-19084546 AATTTACAAAAGAGGGAGGGAGG + Intronic
1052786549 9:32833421-32833443 GGTTTGGAACAGAGGGAGGGAGG - Intergenic
1052965123 9:34334637-34334659 CATTTGTTTGAGTGGGAGGTGGG + Intronic
1055018247 9:71642446-71642468 CATAAGCAAGAGAGGGAGAGAGG + Intergenic
1055428832 9:76223123-76223145 GATTGGTAAGAGAGGATGGGAGG - Intronic
1056141371 9:83683645-83683667 CTTATGTAAGAGATGGAGGTAGG + Intronic
1056224338 9:84480686-84480708 GATTTGGAAAGGAGGGAGGGGGG - Intergenic
1056257901 9:84819113-84819135 CATTTCTAAAAGAGAGAGGGAGG - Intronic
1056508480 9:87280361-87280383 CATTTGTAAGAAGGGAATGGAGG - Intergenic
1057927896 9:99169311-99169333 CATTTCTGAGAGAGGCAGGCAGG + Intergenic
1058555225 9:106159701-106159723 GATTAGGAAGAGAGGGATGGTGG + Intergenic
1058751677 9:108045005-108045027 CTTTTGTAAGATAGAGTGGGAGG - Intergenic
1058847326 9:108974088-108974110 CACGTGTAAGAGAGGGAGGCAGG + Intronic
1059059715 9:111022448-111022470 CAGTTTTAAAAGAGGGTGGGGGG + Intronic
1059493679 9:114691520-114691542 CTTTTGGAAGAGAAGGAGGAAGG + Intergenic
1060145386 9:121248365-121248387 AAGATGAAAGAGAGGGAGGGAGG - Intronic
1060568924 9:124619705-124619727 TATCTGTAAAATAGGGAGGGGGG + Intronic
1060618457 9:125040928-125040950 CATTTTTAAAACAGGGAGGCCGG - Intronic
1062038206 9:134392114-134392136 CATTTTGCAGAGGGGGAGGGTGG + Intronic
1186081352 X:5937052-5937074 TATGTGTAAGAGAGAGAGAGAGG - Intronic
1186250450 X:7660331-7660353 CAGTGGTGGGAGAGGGAGGGTGG + Intergenic
1186673773 X:11794284-11794306 CACTAGTAAGAGAGAGAGGAGGG - Intergenic
1186735272 X:12456524-12456546 CCTTTGACAGAGAGGGAGGGAGG - Intronic
1187052719 X:15710387-15710409 CATTAATAAGAGAGGGAAGAAGG + Intronic
1188669125 X:32861700-32861722 CCTTGGTAAGAGAGGGAGAGAGG - Intronic
1190397305 X:49998159-49998181 CATCTGTAAAATGGGGAGGGCGG - Intronic
1190545811 X:51525137-51525159 TTTTAGTAAGAGAGAGAGGGAGG + Intergenic
1190633669 X:52413413-52413435 CTTTTTACAGAGAGGGAGGGAGG - Intergenic
1192534687 X:71917307-71917329 TTTTAGAAAGAGAGGGAGGGAGG - Intergenic
1193189617 X:78554113-78554135 CATTGGGAAGGGTGGGAGGGGGG + Intergenic
1193371045 X:80697550-80697572 CATTTGTAAGAGAGGGCGTGTGG + Intronic
1193864134 X:86708621-86708643 GATTTGGAAGGGTGGGAGGGTGG + Intronic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194674156 X:96773478-96773500 CATCTGTAAGCCAAGGAGGGAGG + Intronic
1195086496 X:101418512-101418534 CATTAGGAGGAGGGGGAGGGCGG + Intronic
1195247122 X:103004850-103004872 CATCTGTAAGACTGGCAGGGAGG + Intergenic
1196355838 X:114791443-114791465 CATTGGTATGAGGGAGAGGGAGG + Intronic
1196749338 X:119100725-119100747 GATTTGGAAGAGTGGGAGTGAGG - Intronic
1197289510 X:124638163-124638185 CATCTGGAAGAGAGAGAAGGAGG + Intronic
1197408697 X:126088740-126088762 CACTTGTAAGTGAGAGCGGGCGG - Intergenic
1197745304 X:129928774-129928796 CAATCCTAAGAGAGGGAAGGAGG + Intronic
1197795905 X:130298639-130298661 AAATTGAAAGAGAAGGAGGGAGG + Intergenic
1197923926 X:131626753-131626775 CATTAGAAAGGGAGGCAGGGAGG + Intergenic
1198030256 X:132747645-132747667 CATTTGTACAAGGGGGAGGGAGG + Intronic
1198216237 X:134557106-134557128 AGTGTGTGAGAGAGGGAGGGAGG - Intergenic
1199201885 X:145100404-145100426 CATTTGACAGAGAGAGAGGGAGG - Intergenic
1199507493 X:148580968-148580990 TATTTGTGAGAGAGGGAAGAAGG - Intronic
1201550494 Y:15212315-15212337 AAGTTGCAAGAGAGAGAGGGAGG + Intergenic