ID: 934924551

View in Genome Browser
Species Human (GRCh38)
Location 2:98372917-98372939
Sequence CTGTCAATTTACCATGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934924551_934924553 -3 Left 934924551 2:98372917-98372939 CCCTTCACATGGTAAATTGACAG 0: 1
1: 0
2: 2
3: 11
4: 151
Right 934924553 2:98372937-98372959 CAGATTAATACAGTATCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934924551 Original CRISPR CTGTCAATTTACCATGTGAA GGG (reversed) Intronic
900772635 1:4557965-4557987 ATATCCATTTACCATGTTAAAGG - Intergenic
903698151 1:25225026-25225048 CTGTCAATTTCCTCTGTGGAAGG + Exonic
903842624 1:26254966-26254988 TTGTTAGTTTACCTTGTGAATGG + Intronic
908240016 1:62181141-62181163 CTTTGATTTTACCATGTCAAGGG - Intergenic
910752414 1:90647259-90647281 ATGGAAATTTACCATTTGAAAGG - Intergenic
911142503 1:94521221-94521243 CAGTCAATTTACCAAGTGACTGG + Intergenic
915750903 1:158209644-158209666 CTGACAAATTCCCATATGAAAGG - Intergenic
917829798 1:178869260-178869282 CTGTGAGTTTACCATCTGAAAGG - Intronic
918105411 1:181412066-181412088 CTGAGAACTTACCATGTGCAAGG - Intergenic
919992528 1:202718429-202718451 CTGTCTATGTACCAGCTGAATGG + Intergenic
920221281 1:204403647-204403669 GTGTCAATGTAGCATGTAAAAGG - Exonic
921219956 1:212966413-212966435 CTGAGAATTTACAATGTTAAAGG - Intronic
924661415 1:246021796-246021818 CTTTCCATTTTCCATTTGAATGG - Intronic
1063805766 10:9638495-9638517 TTCTCAATATACCATATGAATGG + Intergenic
1064734380 10:18365907-18365929 CTGTCAATTTGGCCTGTGGAGGG + Intronic
1068095856 10:52490095-52490117 CTGGCTATTTACCATGGGATAGG - Intergenic
1071977995 10:90974811-90974833 ATGTCCATTTACCATCTTAATGG + Intergenic
1075405931 10:122195806-122195828 CTGTGAATCTTCCATGTGAGAGG - Intronic
1085976746 11:81664499-81664521 CTGTCAACTTACGATGTTTATGG - Intergenic
1086783740 11:90939149-90939171 TTGTCAATTTAGCTTTTGAAGGG - Intergenic
1087985066 11:104668605-104668627 CTGAGCATTTACCATGTGTAAGG + Intergenic
1088354577 11:108929122-108929144 CTGCTAGTTTACCATGTGACTGG + Intronic
1089596267 11:119582779-119582801 ATGTAAATTTCCCATATGAAAGG + Intergenic
1093866789 12:24237117-24237139 CTCTGAATTTACCATGTTAGTGG + Intergenic
1095171508 12:39041826-39041848 CTGTAGATTTCCCATGTGCACGG - Intergenic
1099728605 12:86467867-86467889 TTGTCAATCTACCATGTAACTGG - Intronic
1099897202 12:88663415-88663437 CTGTACTTTTATCATGTGAATGG + Intergenic
1100128767 12:91463620-91463642 GTGTATATTTACCATGAGAAAGG - Intergenic
1101257917 12:102997962-102997984 CTGTCACTTTTCCAGGTGCATGG + Intergenic
1101422828 12:104563652-104563674 CTGCCAATTTATCATGGAAAAGG - Intronic
1101679252 12:106948828-106948850 ATGTACATTTACCATGAGAAGGG - Intergenic
1104263220 12:127204604-127204626 CTGACTTTATACCATGTGAACGG + Intergenic
1106165327 13:27240388-27240410 CTGTCAATCTACCAGGACAAAGG + Intergenic
1106625364 13:31415550-31415572 CTGTCAAGTTACCTTGTTGATGG - Intergenic
1108502741 13:51083469-51083491 TTGTCAATTGCCTATGTGAAGGG + Intergenic
1110522773 13:76500145-76500167 CTGGCAAAGTACCAGGTGAAAGG + Intergenic
1111809487 13:93081168-93081190 CTGGCATTTTACATTGTGAAAGG - Intergenic
1112361229 13:98720619-98720641 TTGTGAATTTCCCATGTGGAAGG - Intronic
1117078854 14:52130896-52130918 CTTTTAATTTACTATGTGTAGGG + Intergenic
1117892070 14:60435129-60435151 CTGTCAAAATGCCATGTGCAAGG + Intronic
1124169804 15:27362635-27362657 CTGTGATTTCACCATATGAAAGG + Intronic
1126648058 15:50894763-50894785 CTGTGAATTTTCCAGGTGCACGG - Intergenic
1130375431 15:83324845-83324867 CTGTGAATTTTCTCTGTGAAGGG - Intergenic
1131370580 15:91877903-91877925 CTCTCCATTTACCAGGTGATGGG + Intronic
1132293251 15:100717823-100717845 CTGTCAAGTTATCTTGTAAAAGG + Intergenic
1133506825 16:6420708-6420730 CTGTCAATTGTACAAGTGAATGG - Intronic
1139292249 16:65869547-65869569 CTCCCAATTTCCCATCTGAATGG - Intergenic
1139768429 16:69252531-69252553 TTGGCAATTTTCCATGTAAAAGG + Intronic
1140740219 16:77934945-77934967 CTGTCATTTTACCTTGAAAAGGG + Intronic
1140842654 16:78855135-78855157 CTGTTAATTTACAATTTGAAAGG + Intronic
1140937577 16:79688684-79688706 ATGTCAATTTACCATCTGTGGGG - Intergenic
1145389973 17:22447961-22447983 CTTTCCATTTACCACGTCAAAGG - Intergenic
1149156718 17:53639644-53639666 ATGTCTATTTACCACATGAAAGG - Intergenic
1149304369 17:55334187-55334209 CTATCAATTTACCTTGGGGACGG - Intergenic
1156744668 18:40374632-40374654 TTGTCAATTTAACAACTGAATGG - Intergenic
1157088502 18:44607304-44607326 CTGTGAGTTTATGATGTGAAGGG + Intergenic
1157422735 18:47559900-47559922 CTGTCTATCTGCCATGTGCAGGG - Intergenic
1162182692 19:8881255-8881277 CTGTCGATCTACCATGTACAAGG + Intronic
926489691 2:13508866-13508888 TTGGCAATTTACCAAGAGAATGG + Intergenic
926544229 2:14219257-14219279 CCTGCAATTTATCATGTGAAAGG + Intergenic
929018805 2:37529581-37529603 GTGTCACTGTAGCATGTGAAAGG + Intergenic
929637517 2:43539642-43539664 ATGTGAGGTTACCATGTGAATGG + Intronic
930370379 2:50493802-50493824 TTGTGAATTTCCCATGTGAAGGG - Intronic
931495206 2:62798633-62798655 ATGACAATTTACCATGTGTCTGG - Intronic
934654624 2:96110741-96110763 CTGGCAATTCACCAGGTGGACGG - Intergenic
934924551 2:98372917-98372939 CTGTCAATTTACCATGTGAAGGG - Intronic
937703462 2:124890926-124890948 CTGTGTATTTACCATGTGCCAGG + Intronic
938189488 2:129262945-129262967 CTTTGAATTCACCTTGTGAAGGG - Intergenic
940037076 2:149322356-149322378 CTTTGATTTTACCATGTCAAGGG + Intergenic
940178075 2:150901339-150901361 CTATTTATTTACCATGTGTAGGG + Intergenic
941779496 2:169428603-169428625 TGGTCAATTCACCATGAGAAAGG + Intergenic
942264532 2:174208569-174208591 ATATCAATTTACCATGTGATGGG + Intronic
942595903 2:177591678-177591700 CTGACCATTTATCATTTGAAAGG - Intergenic
942848978 2:180460416-180460438 CTGTCAATTTCACATGTACAGGG + Intergenic
942926941 2:181445283-181445305 CTGTCAATTTACCAAAGTAAAGG + Intergenic
945274576 2:207975472-207975494 CATTAAATTTACCATGAGAATGG - Intronic
945911881 2:215659317-215659339 TTGTACATTTTCCATGTGAAAGG - Intergenic
946067006 2:216996566-216996588 CTGTCATTTTCCCGTGTGAAAGG + Intergenic
946969242 2:225073577-225073599 CTGTCACTTGACCTTGTGAAGGG - Intergenic
947010615 2:225562171-225562193 CAGTGAATTTACCATTTAAAGGG - Intronic
1170251132 20:14284059-14284081 CTTTAAAATTGCCATGTGAAAGG + Intronic
1170917504 20:20641954-20641976 CTGTGAATTTACCCCGTTAATGG - Intronic
1178018868 21:28385879-28385901 CTGTGAATCTACAATGTAAAAGG + Intergenic
1178563387 21:33660045-33660067 CTGTCAATTCAGCCTCTGAAAGG + Intronic
1182491774 22:30677238-30677260 CTTTGATTTTACCATGTCAAGGG - Intergenic
953702385 3:45206808-45206830 CTGTCCACTTACCAGGTGCAAGG + Intergenic
955546488 3:60036316-60036338 CTGTATATTAACCATATGAACGG - Intronic
956351341 3:68340400-68340422 ATGTCAATATGTCATGTGAATGG + Intronic
956469948 3:69555908-69555930 CTCTCAACTTACCAAATGAATGG + Intergenic
958176999 3:90008644-90008666 CAGGAAATTTACCATGTGAAAGG - Intergenic
958513083 3:95074320-95074342 CTGTCATCTTATAATGTGAATGG + Intergenic
959216930 3:103462928-103462950 ATGTCTATTTAACAAGTGAATGG + Intergenic
965676196 3:171199485-171199507 CTGAGAATTTACCATGTGCCAGG + Intronic
966619864 3:181952310-181952332 CTGACATCTTACCATGTGATTGG + Intergenic
966815925 3:183889820-183889842 CTGTGAATTTACCATTTCAGAGG + Intergenic
967843624 3:194027373-194027395 CTGTCAGTTTACCATTTCCATGG - Intergenic
969928169 4:10604716-10604738 CTCTCAAGTTCCTATGTGAAGGG - Intronic
969970126 4:11038273-11038295 CTATCAATTTACAGAGTGAATGG + Intergenic
973866154 4:55115683-55115705 TTGTCAATAAACCTTGTGAAAGG - Intronic
974867172 4:67595489-67595511 GTGTCAATGCACAATGTGAAAGG + Intronic
978085122 4:104642465-104642487 CTGTGAATATACAATGTAAAGGG + Intergenic
978747988 4:112216121-112216143 CTGTCATTTGACCATGCTAAAGG + Intergenic
978878753 4:113674637-113674659 CTGTTAATTTCCCATGGGAGAGG - Intronic
979097817 4:116573459-116573481 CTGTCTATTTTCCAGGTGCATGG + Intergenic
980249847 4:130300978-130301000 CTCTCCATTTACTATGTGGATGG + Intergenic
980629195 4:135411242-135411264 CAGTCAATTTGACATGTGATTGG + Intergenic
981862946 4:149379333-149379355 CTGTGGATTTTCCATGTGCAGGG - Intergenic
982390874 4:154862706-154862728 CTGTGGCTTTTCCATGTGAAGGG + Intergenic
982485685 4:155962794-155962816 CAGTCAAGTGACAATGTGAAAGG + Intergenic
983222651 4:165057482-165057504 TTGTCAAATTACAATGTCAAAGG + Intergenic
987528516 5:19083594-19083616 CTGACAATTTACAAAGTAAAAGG + Intergenic
987858375 5:23451176-23451198 CTATTAATTTATCCTGTGAAAGG - Intergenic
987923212 5:24309874-24309896 CTTTGATTTTACCATGTCAAGGG - Intergenic
990002627 5:50912225-50912247 CTGTCACTTTAACATTTGAGTGG + Intergenic
990597811 5:57328965-57328987 CTGTAAATTTACGATCTGAGAGG - Intergenic
991104880 5:62832691-62832713 CTGTGACTTTTCCAGGTGAATGG + Intergenic
992083258 5:73255033-73255055 CTGTCACTTTAAAATGTAAAAGG - Intergenic
992612760 5:78521672-78521694 CTGTCAATTTAGGATGTGCGTGG - Intronic
993004937 5:82419681-82419703 CCGTGAATCTAACATGTGAAAGG + Intergenic
994225334 5:97245496-97245518 CTGTCAGTTTAGCATATGTAAGG + Intergenic
994619238 5:102143365-102143387 CTGTCCATTAATCATGTGCAGGG + Intergenic
997552774 5:134768056-134768078 CTATCAAATTACCATGTGTATGG - Intronic
997792093 5:136770330-136770352 GTGTCTATTTACCATGTTGAAGG - Intergenic
1004565124 6:16789038-16789060 CTGTGACTTTTCCAGGTGAAGGG + Intergenic
1005080881 6:21955259-21955281 ATATCAATTTACAGTGTGAATGG + Intergenic
1005186433 6:23167448-23167470 CAGTCAATTTAACACGTGATTGG + Intergenic
1008483722 6:52013026-52013048 CTGGCAATGAACCATGAGAAGGG - Intronic
1009496708 6:64358239-64358261 CTGTCAAAATAGCATCTGAAAGG + Intronic
1013388055 6:109652521-109652543 CTGTCAATGTAACATTTTAATGG + Intronic
1013715312 6:112954024-112954046 CTGTCTATTTTCAATGTGAATGG + Intergenic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1017540915 6:155401667-155401689 GTGTCAACTTACCATATGATTGG - Intronic
1018558093 6:165070904-165070926 CTTTCAATTTATCTTATGAAGGG + Intergenic
1019137250 6:169918008-169918030 CTGTGAAATTACCTTGTAAATGG - Intergenic
1021530621 7:21640861-21640883 CTGTCCATTTATCATGAGGAGGG + Intronic
1022567343 7:31416466-31416488 CTGTCCATTTACCAGGAGAAAGG - Intergenic
1028826913 7:95284097-95284119 CTGTCATTAAACCATGAGAAAGG - Exonic
1029008204 7:97232013-97232035 CTGTCAATGTTCAATGTCAAAGG - Intergenic
1029676436 7:102072572-102072594 CTTTCAATTTCCCATCTGCAGGG + Intronic
1031156874 7:118120599-118120621 CAGTCAATTTAACACGTGATTGG + Intergenic
1032887584 7:136158155-136158177 ATGTCCATTCACCAAGTGAATGG - Intergenic
1035793032 8:2325463-2325485 CTGTGAAGTTACCATGTGAAAGG + Intergenic
1035799772 8:2396242-2396264 CTGTGAAGTTACCATGTGAAAGG - Intergenic
1036020872 8:4844371-4844393 CTGTTAATTTCCTATGGGAAGGG - Intronic
1037792370 8:21956884-21956906 CTGTCTATCTTCCATGTTAAAGG + Intronic
1041402626 8:57461293-57461315 CAGTCAATTTGACATGTGATTGG + Intergenic
1042239619 8:66649617-66649639 TTTTCATATTACCATGTGAATGG - Intronic
1045918129 8:107497985-107498007 CTGTCAAGTCATCTTGTGAAAGG - Exonic
1046427982 8:114080720-114080742 TTTTTAATTGACCATGTGAAAGG + Intergenic
1049449494 8:142652742-142652764 CTGTAAATTGATTATGTGAAAGG - Intergenic
1051773654 9:20609813-20609835 CTGTCCATTCACCATAAGAAAGG + Intronic
1052742625 9:32408168-32408190 TTGTCAAGCCACCATGTGAATGG + Intronic
1052848198 9:33356628-33356650 CTGTAGATTTAAAATGTGAAAGG - Intronic
1186616867 X:11197881-11197903 CTGTCAACTTAGCATGTGGGAGG + Intronic
1186972994 X:14869737-14869759 CTGTGAATTGAACATATGAATGG + Intronic
1187487621 X:19719628-19719650 ATGTGAATTAGCCATGTGAAAGG + Intronic
1191719945 X:64221134-64221156 CTGTCAAGTTAGCAGCTGAATGG + Intergenic
1193707114 X:84834740-84834762 GTGAAAATTAACCATGTGAAAGG + Intergenic
1195060221 X:101187176-101187198 CTTTGATTTTACCATGTCAAGGG - Intergenic
1195092026 X:101469851-101469873 ATGTCAATTTACCATGGCCATGG + Intronic
1196413904 X:115450186-115450208 TTGTTAATTTACCAGTTGAAGGG - Intergenic
1197704509 X:129624037-129624059 CTGGCAATAATCCATGTGAAAGG + Intergenic
1199611179 X:149615992-149616014 CTCTCTTTTCACCATGTGAAGGG - Intronic
1200888261 Y:8294622-8294644 TTGTCAAATTAGCATATGAAAGG + Intergenic
1202053504 Y:20805170-20805192 CAGTCAATTTAACCTGTGATTGG + Intergenic