ID: 934924969

View in Genome Browser
Species Human (GRCh38)
Location 2:98375841-98375863
Sequence GGAATCTCGGCTGTACCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934924969 Original CRISPR GGAATCTCGGCTGTACCACC TGG Intronic
903328276 1:22583786-22583808 AGAAGCTCGGGTGTAGCACCTGG - Intronic
904595290 1:31640667-31640689 GGAATCTCTGCAGAACCACCTGG + Intronic
905003301 1:34690379-34690401 GAAATCTCTGCTGCACCATCTGG - Intergenic
906935775 1:50212877-50212899 GGAGTCTGGACTGTATCACCTGG - Intergenic
913955943 1:143293318-143293340 GGAATCCCCTCTGTACCTCCAGG - Intergenic
913981491 1:143522122-143522144 GGAATCCCCTCTGTACCTCCAGG + Intergenic
914075862 1:144348778-144348800 GGAATCCCCTCTGTACCTCCAGG + Intergenic
914103316 1:144617718-144617740 GGAATCCCCTCTGTACCTCCAGG - Intergenic
915959924 1:160257803-160257825 GCAATCTCAGCTCTACCTCCTGG + Intronic
920539749 1:206769411-206769433 GGAGTCTGGGCTGAACCCCCAGG + Intronic
923794692 1:237142511-237142533 GTAATCTGGGGTGTACCACAGGG + Intronic
1066952667 10:42136738-42136760 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1068963287 10:62886768-62886790 GGCATCTTGCCTGGACCACCTGG + Intronic
1072945543 10:99806944-99806966 TGAATCTCAGCTCTACCACTGGG + Intronic
1073455507 10:103634483-103634505 GGACTCTAGGCTTTACAACCAGG + Intronic
1076010188 10:126981384-126981406 GGAAGCTAGGGTGTACCCCCAGG + Intronic
1081426837 11:42934620-42934642 GGAATCACGGCAGTCCCACAGGG + Intergenic
1083078174 11:60063234-60063256 GGACTCTCTGCTGTACCACAAGG - Intronic
1105232524 13:18511189-18511211 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1107054243 13:36086285-36086307 GGAGTCTGCTCTGTACCACCAGG + Intronic
1120424622 14:84331282-84331304 GCAATCTCGGCTCTACTTCCCGG - Intergenic
1129267487 15:74401732-74401754 GGCATCTCAGCAGGACCACCAGG + Intergenic
1133967656 16:10543295-10543317 GGAAACTCGGCTGTGCCAAGAGG + Intronic
1136700843 16:32139464-32139486 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1136766812 16:32787995-32788017 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1136770521 16:32835691-32835713 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1136801283 16:33082383-33082405 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1136936637 16:34473572-34473594 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1136945098 16:34640363-34640385 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1136948037 16:34679511-34679533 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1136955427 16:34779389-34779411 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1136959152 16:34825895-34825917 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1136963182 16:34874998-34875020 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1137083092 16:36090303-36090325 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1137087889 16:36151314-36151336 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1137092333 16:36209471-36209493 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1137221498 16:46456132-46456154 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1140198484 16:72875405-72875427 GGCATCTGGGCTGTGCCTCCTGG - Intronic
1141441933 16:84034718-84034740 GGCATCTCGGCTCTCCCACGTGG - Intronic
1203069207 16_KI270728v1_random:1050247-1050269 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1203072941 16_KI270728v1_random:1097795-1097817 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1145691351 17:26743458-26743480 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1146308529 17:31749543-31749565 AGAATCTCGGCTGTTCTCCCTGG + Intergenic
1146493858 17:33303119-33303141 GGAATCCTGGCTCTGCCACCTGG - Intronic
1148332193 17:46819531-46819553 GGATTCTCGGTTGGACCATCAGG + Intronic
1154520790 18:15227496-15227518 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1158515778 18:58129114-58129136 GCAATCTGGGCTGGACCAGCAGG - Intronic
1161279469 19:3437751-3437773 GCAATCTCGGCTCCACCTCCTGG + Intronic
1165185645 19:34018729-34018751 GGAATGTCGGCTGTGTCACCAGG + Intergenic
1166730216 19:45055045-45055067 GGAACCCTGGCTCTACCACCAGG - Intronic
1167103146 19:47416488-47416510 AGACTCTAGGCTGTACCACACGG + Intronic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
925909679 2:8565661-8565683 GGAAGCTCTGCTGCAGCACCTGG - Intergenic
934250426 2:90348715-90348737 GGAATCCCCTCTGTACCTCCAGG - Intergenic
934259139 2:91454701-91454723 GGAATCCCCTCTGTACCTCCAGG + Intergenic
934302446 2:91786595-91786617 GGAATCCCCTCTGTACCTCCAGG + Intergenic
934924969 2:98375841-98375863 GGAATCTCGGCTGTACCACCTGG + Intronic
938520142 2:132061265-132061287 GGAATCCCCTCTGTACCTCCAGG - Intergenic
948759563 2:240182365-240182387 GGAATTCCGCCTGTACCTCCAGG - Intergenic
1169343418 20:4812795-4812817 TGCATGTCGGCTGTGCCACCTGG - Intronic
1173900849 20:46587996-46588018 GGATTCTGGGCTGGGCCACCTGG - Intronic
1174768279 20:53273908-53273930 CGAATCTCCCCTGGACCACCCGG + Intronic
1176584862 21:8572293-8572315 GGAATCACCTCTGTACCTCCAGG + Intergenic
1180524506 22:16242783-16242805 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1180722656 22:17920859-17920881 GGAATCTCGGGGCTTCCACCAGG - Intronic
1203323906 22_KI270737v1_random:98257-98279 GGAATCCCCTCTGTACCTCCAGG - Intergenic
951839791 3:27022270-27022292 GGAATCTCAGCTGTACTACAGGG - Intergenic
956342935 3:68246792-68246814 CAAATCTCGGCTGTACTGCCAGG + Intronic
970380347 4:15501141-15501163 GGTGTCTGGGCTGTACCTCCAGG + Intronic
971655156 4:29334875-29334897 GAAACCTGGGCTGTACAACCTGG + Intergenic
973335838 4:48955525-48955547 TCAATCTTGGCTCTACCACCTGG + Intergenic
1011629359 6:89309423-89309445 GGATTCTAGGCTCTCCCACCTGG + Intronic
1016962159 6:149684208-149684230 CGAATCTCTCCTGTCCCACCTGG - Exonic
1019550672 7:1600914-1600936 GGAATCTTGGCTGGTCCACCAGG - Intergenic
1021267370 7:18541319-18541341 GGAATCTTGGCTGGCACACCGGG - Intronic
1021932967 7:25599731-25599753 GGAATCTGTGCTGTTCCTCCAGG - Intergenic
1025473660 7:60892053-60892075 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1025479809 7:60968216-60968238 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1025489107 7:61089623-61089645 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1025513345 7:61597813-61597835 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1025537695 7:62026652-62026674 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1025552152 7:62264119-62264141 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1025557958 7:62333247-62333269 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1025886159 7:65595284-65595306 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1033260355 7:139838811-139838833 GGGATCAGGGCTGCACCACCAGG + Intronic
1040590421 8:48787828-48787850 GGAATCCCTGCTGTACTCCCAGG - Intergenic
1053699429 9:40674102-40674124 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1053945424 9:43304246-43304268 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1054310718 9:63473503-63473525 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1054409508 9:64797654-64797676 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1054442668 9:65281465-65281487 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1054487611 9:65740036-65740058 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1057206993 9:93179424-93179446 GGAGTCTCCGCAGGACCACCTGG + Intergenic
1203580727 Un_KI270746v1:808-830 GGAATCCCCTCTGTACCTCCAGG + Intergenic
1203588559 Un_KI270747v1:32824-32846 GGAATCCCCTCTGTACCTCCAGG - Intergenic
1203614770 Un_KI270749v1:49812-49834 GGAATCACCTCTGTACCTCCAGG + Intergenic
1192371218 X:70514567-70514589 GGAGTCTCGGCTCTGACACCAGG - Intergenic
1198001493 X:132443284-132443306 GGAGTCATGGCTCTACCACCAGG - Intronic
1199367728 X:147006815-147006837 GGAATCTTGGCTGTGTCTCCTGG - Intergenic