ID: 934925702

View in Genome Browser
Species Human (GRCh38)
Location 2:98380533-98380555
Sequence CGGAGTCCAAGAGGCCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934925697_934925702 13 Left 934925697 2:98380497-98380519 CCCTTGGGGGAGCACTACATGCT 0: 1
1: 0
2: 1
3: 6
4: 50
Right 934925702 2:98380533-98380555 CGGAGTCCAAGAGGCCTTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 119
934925698_934925702 12 Left 934925698 2:98380498-98380520 CCTTGGGGGAGCACTACATGCTC 0: 1
1: 0
2: 0
3: 8
4: 80
Right 934925702 2:98380533-98380555 CGGAGTCCAAGAGGCCTTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934925702 Original CRISPR CGGAGTCCAAGAGGCCTTGC AGG Intronic
900580595 1:3406784-3406806 CCGGGTCCAAGGGGCCTTGTGGG + Intronic
902220384 1:14960853-14960875 CAGAGCCAAAGAAGCCTTGCAGG + Exonic
902719364 1:18293822-18293844 AGGAGTCCTAGAGGCCTTGCTGG - Intronic
906706578 1:47899445-47899467 CAGTGTCCAAGTGGCCTTGCAGG - Intronic
907494409 1:54833709-54833731 CGGAGTAAAAAAGACCTTGCTGG - Intronic
916034827 1:160912574-160912596 TGGAGTCCAGGAAGCCTCGCAGG + Intergenic
916518767 1:165544501-165544523 AGGAGTCCTAGATGCATTGCTGG - Exonic
917599955 1:176563903-176563925 AGGACTCAAAAAGGCCTTGCAGG + Intronic
919979889 1:202636273-202636295 CAGAGTCCAAGTGGCCTCACTGG + Intronic
920441373 1:205983108-205983130 CGGGGTTCACGAGGCCTTGGTGG + Intronic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
923566413 1:235079795-235079817 AGGAAACCAAGAGGCCTTGGCGG + Intergenic
1065454537 10:25893149-25893171 CTGAATCCTAGAGTCCTTGCCGG - Intergenic
1067087281 10:43249646-43249668 CAGGGTCCAGGATGCCTTGCTGG - Intronic
1073463022 10:103677390-103677412 CTGAGTCCTGGAGGCCTTGAAGG + Intronic
1076672194 10:132129374-132129396 AGGACTCCCAGAGGCCTTGCAGG - Intronic
1077001994 11:328126-328148 CGGAGTCCTGGGGGACTTGCGGG - Intergenic
1077539337 11:3139263-3139285 CGGAGACCAGGAGGCTGTGCGGG + Intronic
1078276754 11:9855983-9856005 CGGATTCCGTTAGGCCTTGCAGG + Intronic
1078656247 11:13243155-13243177 TGGAGTCCAAGAGACCTGGCTGG + Intergenic
1080417607 11:32083432-32083454 AGGAGTCCATGAGGCCCTGAAGG + Intronic
1084272347 11:68036122-68036144 CGGAGTCCAGGAGGCCTTTGAGG + Intronic
1084360950 11:68668114-68668136 CGGTGGCCCAGAGGCCTTGATGG - Intergenic
1089364709 11:117914608-117914630 CAGAGTTCAAGAGGGATTGCAGG - Intronic
1089655891 11:119946698-119946720 AGGAGTCCAGGAGGACTTCCAGG + Intergenic
1094738275 12:33259834-33259856 CGCAGGCCAAGAGGCCTGGGAGG + Intergenic
1096555743 12:52402591-52402613 GGGAGTCCAGGAAGCCTTCCTGG - Intronic
1096582959 12:52600271-52600293 CAGAGGCCAAGAGACGTTGCAGG - Intronic
1103822994 12:123712973-123712995 AGGACTCCAAGAGGCCTTTGTGG - Intronic
1106393785 13:29360732-29360754 AGGAGCCCAAGAGGCCTGACTGG + Intronic
1106720127 13:32427923-32427945 CGGAGCCCGGGAGGCCTCGCAGG + Exonic
1112595176 13:100801312-100801334 GGGAGGCGAAGAGGCCTGGCCGG + Intergenic
1113095588 13:106660691-106660713 TGGAGACCATGAGCCCTTGCAGG + Intergenic
1113625107 13:111789255-111789277 CAGAGAGCCAGAGGCCTTGCAGG - Intergenic
1119084313 14:71725954-71725976 CAGAGTGCAAGAGGCATGGCGGG + Intronic
1119896369 14:78223226-78223248 AAGATTCCAAGAGGCCTTGTAGG - Intergenic
1120997522 14:90427876-90427898 TTGAATCCCAGAGGCCTTGCCGG + Intergenic
1122093703 14:99356218-99356240 CCCTGTCCAAGAGGCCTTCCTGG - Intergenic
1124495506 15:30184313-30184335 CAGAGTCCAAGTGGCCTCACTGG + Intergenic
1124748067 15:32354333-32354355 CAGAGTCCAAGTGGCCTCACTGG - Intergenic
1129348223 15:74937939-74937961 CGGAGTGCAGGAGGCCTCGAGGG + Exonic
1130115569 15:81001995-81002017 CGGCCTCCTAGAGGGCTTGCAGG - Exonic
1130540231 15:84817009-84817031 AGGGGTCCACGAGGCCTGGCCGG - Exonic
1132091896 15:98954024-98954046 CGGATTCCCAGAGGACCTGCGGG - Intronic
1133419568 16:5634662-5634684 CGGAGTCAAAGAAGAGTTGCAGG + Intergenic
1142156000 16:88533182-88533204 CGGAGGCCAGGGGGCCTTGCAGG - Exonic
1144632428 17:16881012-16881034 CGGGGTCCCAGTGGGCTTGCTGG + Intergenic
1144638141 17:16923902-16923924 CGGGGTCCCAGTGGGCTTGCTGG + Intergenic
1147581801 17:41631236-41631258 GGGAATCCAAGAGGGCTTTCTGG - Intergenic
1148044752 17:44736533-44736555 TGGAGTCCCAGAGGCCTGGTGGG - Intronic
1149259601 17:54864404-54864426 CTGAGACCAAGAGAACTTGCAGG - Intergenic
1149550639 17:57537002-57537024 TTGAGTCCAAGAGGTCTTGAGGG + Intronic
1152782235 17:82231513-82231535 CGGGGTCCAGGAGGCCTCGGAGG + Intronic
1154092910 18:11381494-11381516 CAGAGGCCCAGAGGCCTTGGAGG - Intergenic
1155651844 18:28152601-28152623 CGGAGTCCAAGAAGCAAGGCAGG + Intronic
1158301879 18:56061625-56061647 TGTATTTCAAGAGGCCTTGCAGG + Intergenic
1161207344 19:3047897-3047919 CTGAGTCCCAGAGGCCCAGCAGG - Intergenic
1161344206 19:3759910-3759932 CGCAGTGCAAGAGGCCCAGCAGG + Exonic
1163298733 19:16429804-16429826 AGGACTCCAACAGGCCTTTCTGG + Intronic
1164886228 19:31780721-31780743 CAGAGCCCACGAGGACTTGCTGG - Intergenic
1165751558 19:38263748-38263770 GGGAGTCAAAGAGGGCTTCCTGG - Intronic
1165956236 19:39503626-39503648 GGGAGTCCTAGGGGCCTTGGTGG - Intronic
1166217195 19:41343504-41343526 GGGAGTCTAGGAGGGCTTGCTGG - Intronic
1166980659 19:46630201-46630223 GGGTGACCAAGAGGCCTTGAAGG - Intergenic
1167286021 19:48599366-48599388 CGGGGTCTCAGAGGCCTGGCCGG - Exonic
925054047 2:842375-842397 CGGAGTCCACTGCGCCTTGCAGG - Intergenic
926082533 2:9999559-9999581 CAGAGTTCAAGAGGCTTTTCGGG + Intronic
927444590 2:23147787-23147809 CGGACTCCAAGAGCCCTTTGTGG + Intergenic
931277541 2:60756682-60756704 CGGAGTCCCCGAGTCCGTGCAGG - Intronic
934925702 2:98380533-98380555 CGGAGTCCAAGAGGCCTTGCAGG + Intronic
942792851 2:179780349-179780371 AGGAGTCCCAGAGGGCTGGCAGG + Intronic
1169130396 20:3163856-3163878 CTGAGTCCAAGAGATCTTGTTGG + Exonic
1174172032 20:48623770-48623792 CTGGATCCAACAGGCCTTGCAGG + Intergenic
1174174572 20:48636691-48636713 CAGAGGGCAGGAGGCCTTGCTGG + Intronic
1175344330 20:58261127-58261149 TGGAGGCCAAGGGGCCTTGGGGG - Intergenic
1176222300 20:63975414-63975436 CAGGGTCCAAGAGGCGCTGCGGG + Exonic
1179888970 21:44326366-44326388 GGGGGCCCAGGAGGCCTTGCGGG - Intronic
1180844828 22:18975335-18975357 CAGAGCCCAAGATGCCCTGCGGG - Intergenic
1180932922 22:19605777-19605799 CGGAGTGGAAGAGGCTGTGCTGG + Intergenic
1181603249 22:23964822-23964844 CGGAGGCCAAGAGGCCAAGGTGG - Intergenic
1181605265 22:23976485-23976507 CGGAGGCCAAGAGGCCAAGGTGG + Intronic
1182991897 22:34776233-34776255 GGGATTCCAAGAGGACTTCCTGG + Intergenic
1184627124 22:45744007-45744029 GGGAGTCTAAGGGGCCTGGCTGG - Intronic
1184673080 22:46025864-46025886 AGGAGTCCAGGAAGCCTTCCTGG - Intergenic
950263249 3:11557022-11557044 CAGAGTCCACAAAGCCTTGCAGG + Exonic
969645863 4:8428454-8428476 CGGAGGCCGAGAGGCGTGGCGGG - Intronic
972578907 4:40377768-40377790 CAGAGGCCAGGAGGCCCTGCGGG - Intergenic
983796482 4:171870088-171870110 CGGAGACCAAGAGATCATGCAGG + Intronic
986256555 5:6105725-6105747 CTGAATCCAGGACGCCTTGCAGG - Intergenic
999040294 5:148402106-148402128 AGGAGTCCTAGAAGCTTTGCAGG + Exonic
1001315939 5:170641392-170641414 CCCAGTCCCAGAGGCCATGCTGG + Intronic
1002529789 5:179837520-179837542 CTGGGTCTGAGAGGCCTTGCGGG - Exonic
1002900477 6:1406338-1406360 GGGAGTCCTGGAGGCCATGCAGG - Intergenic
1003129191 6:3380881-3380903 CGGCATCCAGGAGGCCTAGCAGG + Intronic
1005228553 6:23671898-23671920 CAGAGTCCCAGAGGCCTAGGAGG - Intergenic
1005994914 6:30925312-30925334 CCGGGTCCAAGAGGTCGTGCAGG + Exonic
1007430971 6:41776869-41776891 CTGAGCCCAAGAGGCCATGTTGG + Intronic
1016225005 6:141724040-141724062 ATGGGTCCAACAGGCCTTGCTGG - Intergenic
1019217861 6:170455127-170455149 GGCTGTCCGAGAGGCCTTGCTGG - Intergenic
1019475670 7:1242949-1242971 CAGCGTCCCAGAGGCCTTACTGG + Intergenic
1024142921 7:46480483-46480505 AGGAGGCCAAGACCCCTTGCCGG - Intergenic
1025937755 7:66050847-66050869 TGGAGTCCATGGGGCCTTGTAGG + Intergenic
1026512135 7:71036182-71036204 CAGAGTCCAAGAAGTCTTGTAGG - Intergenic
1029945640 7:104529833-104529855 CAGAGTCAAAGAGGCCAGGCTGG + Intronic
1031024058 7:116661549-116661571 GGCAGTCCAAGAGCCCTAGCAGG + Intergenic
1032947546 7:136870253-136870275 CGGACTCCAAGGGACATTGCGGG - Intronic
1034252698 7:149705078-149705100 CAAAGTCCCAGAGCCCTTGCTGG - Intergenic
1034567924 7:151930190-151930212 AGGAGGACAAGAGGCCCTGCAGG + Intergenic
1035023030 7:155809873-155809895 CGGAGGCCTAGAGGCCAGGCAGG + Intronic
1035081997 7:156224122-156224144 TGGAGCCCCAGAGGCCTCGCAGG + Intergenic
1035557481 8:577808-577830 CAGTGTCCCAGAGGACTTGCGGG - Intergenic
1035649524 8:1254313-1254335 AGGAGACCACGAGGCCTTGATGG - Intergenic
1041960710 8:63612260-63612282 AGGAGTCAAAGAAGCCTTCCTGG + Intergenic
1043731297 8:83686851-83686873 GGAAGTCTAAGAGGCCTTCCTGG - Intergenic
1049453480 8:142675263-142675285 TGGAGGCCAAGGGGCCTGGCTGG + Intronic
1053286798 9:36854986-36855008 CGGTGGCCAAGTGGCCTTTCTGG + Intronic
1058040611 9:100297672-100297694 TAGAGTTCAAGAAGCCTTGCTGG + Intronic
1059910071 9:119033296-119033318 AGGAGTCCAAGAGGATGTGCAGG - Intergenic
1061438943 9:130586262-130586284 CTGAGTCCAAGGCCCCTTGCTGG + Intronic
1061756244 9:132814458-132814480 CAGACACCAAGAGGCCTTACCGG + Intronic
1203780839 EBV:100018-100040 CGTAGTCCAGGAGGCCGTGAAGG + Intergenic
1189969514 X:46403781-46403803 TGGATTTCAAGAGGCATTGCTGG - Intergenic
1190737417 X:53264715-53264737 TGGTGTCCAGGAGGGCTTGCTGG - Intronic
1192205866 X:69095549-69095571 CAGGGTCCCAGAGGCCTGGCAGG + Intergenic
1193109588 X:77714329-77714351 CGGAGTCCGGTGGGCCTTGCTGG - Intronic
1202195899 Y:22298014-22298036 CGGAGTCCAGGAGCCCGTCCCGG - Intergenic