ID: 934926219

View in Genome Browser
Species Human (GRCh38)
Location 2:98383412-98383434
Sequence CACTAACACCAGCAACAACA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 415}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934926208_934926219 29 Left 934926208 2:98383360-98383382 CCTTGATGTTCTCTCTACCTTCC 0: 1
1: 0
2: 1
3: 37
4: 420
Right 934926219 2:98383412-98383434 CACTAACACCAGCAACAACACGG 0: 1
1: 0
2: 2
3: 33
4: 415
934926212_934926219 8 Left 934926212 2:98383381-98383403 CCCGCAGCGCCTGGCCCCTGGCC 0: 1
1: 0
2: 7
3: 102
4: 655
Right 934926219 2:98383412-98383434 CACTAACACCAGCAACAACACGG 0: 1
1: 0
2: 2
3: 33
4: 415
934926210_934926219 12 Left 934926210 2:98383377-98383399 CCTTCCCGCAGCGCCTGGCCCCT 0: 1
1: 0
2: 1
3: 43
4: 468
Right 934926219 2:98383412-98383434 CACTAACACCAGCAACAACACGG 0: 1
1: 0
2: 2
3: 33
4: 415
934926216_934926219 -7 Left 934926216 2:98383396-98383418 CCCTGGCCAAATGCAACACTAAC 0: 1
1: 1
2: 0
3: 7
4: 102
Right 934926219 2:98383412-98383434 CACTAACACCAGCAACAACACGG 0: 1
1: 0
2: 2
3: 33
4: 415
934926207_934926219 30 Left 934926207 2:98383359-98383381 CCCTTGATGTTCTCTCTACCTTC 0: 1
1: 0
2: 5
3: 37
4: 370
Right 934926219 2:98383412-98383434 CACTAACACCAGCAACAACACGG 0: 1
1: 0
2: 2
3: 33
4: 415
934926214_934926219 -1 Left 934926214 2:98383390-98383412 CCTGGCCCCTGGCCAAATGCAAC 0: 1
1: 0
2: 0
3: 24
4: 191
Right 934926219 2:98383412-98383434 CACTAACACCAGCAACAACACGG 0: 1
1: 0
2: 2
3: 33
4: 415
934926215_934926219 -6 Left 934926215 2:98383395-98383417 CCCCTGGCCAAATGCAACACTAA 0: 1
1: 0
2: 2
3: 9
4: 137
Right 934926219 2:98383412-98383434 CACTAACACCAGCAACAACACGG 0: 1
1: 0
2: 2
3: 33
4: 415
934926213_934926219 7 Left 934926213 2:98383382-98383404 CCGCAGCGCCTGGCCCCTGGCCA 0: 1
1: 2
2: 16
3: 180
4: 1379
Right 934926219 2:98383412-98383434 CACTAACACCAGCAACAACACGG 0: 1
1: 0
2: 2
3: 33
4: 415
934926217_934926219 -8 Left 934926217 2:98383397-98383419 CCTGGCCAAATGCAACACTAACA 0: 1
1: 0
2: 2
3: 11
4: 131
Right 934926219 2:98383412-98383434 CACTAACACCAGCAACAACACGG 0: 1
1: 0
2: 2
3: 33
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934926219 Original CRISPR CACTAACACCAGCAACAACA CGG Exonic
901289140 1:8108987-8109009 CAATCACAACAGCAACATCAAGG - Intergenic
902266384 1:15269628-15269650 CACTTAACCCAACAACAACAAGG - Intronic
903512807 1:23889094-23889116 CCCTAACACCAGCCCCACCATGG - Intronic
903790260 1:25887984-25888006 CAACAACAACAACAACAACAAGG - Intronic
904203822 1:28839614-28839636 CAGTAACAACAACAGCAACAAGG - Intronic
904780740 1:32945517-32945539 CACTAACTGCAGCAATAACTGGG + Exonic
904880624 1:33694070-33694092 CAACAACAACAACAACAACAAGG + Intronic
905744469 1:40402783-40402805 CACTAACATTTGCAGCAACATGG + Intronic
906386267 1:45371440-45371462 TACTATCACATGCAACAACATGG + Intronic
906703681 1:47878459-47878481 CACCAACACAGGCAACATCAGGG + Intronic
907261061 1:53219047-53219069 CCCTAACACCTGCCCCAACAAGG + Intronic
909403408 1:75258973-75258995 CAGTATCAACAGCAACAAAAAGG + Intronic
910499777 1:87876747-87876769 CACACACAACAACAACAACATGG - Intergenic
915959133 1:160249826-160249848 TACTGATACAAGCAACAACATGG + Intronic
917442679 1:175080909-175080931 CACTAAGACCTGCATCAATAAGG + Intronic
917654427 1:177112262-177112284 CACTGTCAGCAGCAAAAACATGG - Intronic
917681330 1:177371136-177371158 CATTCACAACAGCAAAAACACGG + Intergenic
918034992 1:180860535-180860557 CACTGATACATGCAACAACATGG + Intronic
919929470 1:202211976-202211998 TATGACCACCAGCAACAACATGG - Intronic
920127528 1:203705387-203705409 AACAAACAACAACAACAACAAGG - Intronic
920324253 1:205149591-205149613 CACTAACACCAGCTTAATCATGG + Intronic
920737798 1:208550556-208550578 CACTAAAACCATCTCCAACACGG - Intergenic
921926505 1:220714257-220714279 CACTAATACATGCTACAACATGG - Intergenic
922156664 1:223045599-223045621 CAATAACAGCAGCAACAATAAGG + Intergenic
922754600 1:228088686-228088708 CACTGACACCACCAACCTCAAGG - Intronic
923100819 1:230815310-230815332 TTGTAACACCAGCAAGAACAGGG - Intergenic
923863235 1:237913603-237913625 CCCTACCACCATCACCAACAAGG - Intergenic
924402748 1:243704714-243704736 CAATAACACAAGCAAAAGCAAGG + Intronic
1063501048 10:6554863-6554885 CATTAACAACAGCAAAGACATGG + Intronic
1063723541 10:8610898-8610920 CTTTAACACATGCAACAACATGG + Intergenic
1064012826 10:11748889-11748911 CAACAACAACAGCAACAAAAGGG + Intronic
1064528938 10:16287099-16287121 TACTAACACATGCAACACCATGG + Intergenic
1064723316 10:18251833-18251855 CACTATCACAAGAAACAGCAAGG + Intronic
1065089350 10:22214970-22214992 CACTATCTCAAGCTACAACATGG + Intergenic
1067005942 10:42662626-42662648 CAACAACAACAACAACAACAAGG - Intergenic
1068815597 10:61307363-61307385 CACTAACATCAGAAACAATAGGG - Intergenic
1069135384 10:64757230-64757252 CCCTAACAGCAACAACAAAAAGG - Intergenic
1070038938 10:72755750-72755772 CAAAAACAACAACAACAACAAGG - Intronic
1070270087 10:74945203-74945225 TACTCACACATGCAACAACATGG + Intronic
1070443274 10:76467397-76467419 CATTAAAATCAGTAACAACATGG - Intronic
1072158648 10:92746453-92746475 CTCTAACAACAACAACAAAATGG - Intergenic
1072937590 10:99728293-99728315 CACTAACACCATCATCACAACGG + Intronic
1074196440 10:111190151-111190173 TACTAACACATGCAACAACACGG - Intergenic
1075879509 10:125838585-125838607 AACTAACTTCAGCAACAGCAGGG + Intronic
1076536518 10:131181307-131181329 CAGCACCACCAGCAACACCAGGG + Intronic
1076576098 10:131469661-131469683 CAGCAACACCAGCAATAACCTGG - Intergenic
1076759119 10:132591624-132591646 CACAGACACCAACAACAACCAGG - Intronic
1078366077 11:10707622-10707644 CAAGAACACCAGAAACAGCATGG + Intergenic
1078655577 11:13235716-13235738 CACTAACACCAGAAAAGAAAGGG + Intergenic
1078865364 11:15292404-15292426 AACTAATACCAGTAACAAAAAGG + Intergenic
1078900874 11:15641451-15641473 CACTTACACAAGCAGCAACAGGG - Intergenic
1079220176 11:18553691-18553713 CACTGACACGTGCCACAACATGG + Intronic
1079481307 11:20883245-20883267 CACTATCACCAGCTAAAGCAGGG - Intronic
1079671151 11:23172830-23172852 TACTAACACATGCTACAACATGG + Intergenic
1079740643 11:24055533-24055555 GACTGCCACCACCAACAACAGGG + Intergenic
1080372149 11:31662443-31662465 CAACAACAACAACAACAACATGG - Intronic
1080627071 11:34040135-34040157 CACTGCTACTAGCAACAACATGG - Intergenic
1081192758 11:40124490-40124512 AACTATCACTTGCAACAACATGG + Intronic
1082799629 11:57405118-57405140 TACTGACACCTGCTACAACACGG - Intronic
1084251743 11:67904727-67904749 TACTAACACGTGCTACAACACGG - Intergenic
1084532526 11:69736625-69736647 CACTAACACTAACACCAGCATGG - Intergenic
1084821097 11:71691300-71691322 TACTAACACGTGCTACAACATGG + Intergenic
1085007965 11:73112633-73112655 CACCACCACCAACAACAAAAAGG - Intronic
1085008744 11:73120093-73120115 CACTACCACCAAGAACAGCACGG + Intronic
1085272260 11:75277385-75277407 CACCAACAACACCAACAAGACGG - Exonic
1087170475 11:95044834-95044856 CTTTAAAACCAGCAACAAAAAGG + Intergenic
1087828427 11:102792811-102792833 CACTAGTGCCAGCAACAAGAAGG - Intronic
1088288860 11:108214287-108214309 TACTAATACCTGCTACAACATGG + Intronic
1088761675 11:112935095-112935117 CACTCATACATGCAACAACATGG + Intergenic
1089615295 11:119691633-119691655 CATTAGCACCAGGAAAAACAAGG - Intronic
1089897754 11:121948940-121948962 CACAAACACCAGAATCAATATGG - Intergenic
1089912964 11:122121832-122121854 TACTTACACATGCAACAACATGG + Intergenic
1090099299 11:123777094-123777116 CAGTAGCAGCAGCAAAAACAAGG + Intergenic
1090980441 11:131715810-131715832 TACTAATACATGCAACAACATGG - Intronic
1091541390 12:1465802-1465824 GAGTAACAGCAGCAACAGCAAGG - Intronic
1091637583 12:2209060-2209082 CACAAACACCACCATCAGCATGG - Intronic
1091952400 12:4605184-4605206 CAACAACAACAACAACAACAAGG - Intronic
1091952556 12:4607079-4607101 CACAAACATCAGCACCAACTAGG - Intronic
1092186430 12:6482965-6482987 TACTAACATATGCAACAACATGG + Intergenic
1092422011 12:8339518-8339540 TACTAACACGTGCTACAACACGG - Intergenic
1093541998 12:20298656-20298678 CACTCACACCAGCAGCAGCAGGG + Intergenic
1094442954 12:30499765-30499787 CCCTAACAGCAGTAACAACCAGG - Intergenic
1095404197 12:41849632-41849654 CAACAACAACAACAACAACATGG - Intergenic
1096703123 12:53400322-53400344 TACTAACACATGCTACAACATGG - Intronic
1097548955 12:61042642-61042664 CACCACCACCAACAACAAAATGG - Intergenic
1099275778 12:80574699-80574721 CAATAACAGCAGAAACTACAGGG - Intronic
1101194892 12:102371791-102371813 TTCTAACACCAGCAAGGACAGGG - Intergenic
1101473809 12:105024716-105024738 CACTAGCATCAGCATCATCAGGG - Intronic
1101831973 12:108264948-108264970 CGCTCACACATGCAACAACATGG - Intergenic
1102826248 12:115950084-115950106 CACTAACACCAGTAATAGCTTGG + Intergenic
1103837500 12:123834830-123834852 CACTGACACATGCTACAACATGG - Intronic
1103877851 12:124142541-124142563 CACTGACACAGGCTACAACATGG - Intronic
1104103543 12:125637691-125637713 CACTGACACAAGTAACAATAAGG + Intronic
1104398614 12:128456964-128456986 TACTCACACATGCAACAACATGG - Intronic
1104578960 12:129995183-129995205 CAACAACAACAACAACAACAGGG - Intergenic
1104594886 12:130114223-130114245 CACCAACACAAGCAACAGCCTGG + Intergenic
1105516203 13:21092957-21092979 CAACAACAACAACAACAACACGG + Intergenic
1108534190 13:51356465-51356487 CAAAATCACCAGCAACAACAGGG - Intronic
1108594356 13:51937199-51937221 CACTAACCCCAGCAGGAACCTGG + Intronic
1108756696 13:53511601-53511623 TACTCACAACAGCAAAAACATGG - Intergenic
1109944258 13:69411515-69411537 TATTCACAACAGCAACAACATGG - Intergenic
1110253687 13:73408821-73408843 AAAAAAAACCAGCAACAACAAGG + Intergenic
1110493291 13:76135044-76135066 CACTAAGTTCAGCATCAACACGG + Intergenic
1111001917 13:82195765-82195787 CAGTAGCAGCAGCAAGAACAGGG - Intergenic
1111311974 13:86501321-86501343 CATTAACACCAGCAAGTAAATGG - Intergenic
1111726347 13:92014387-92014409 CATAAACACCAACAACAACGTGG - Intronic
1113190184 13:107736390-107736412 TACTGACAGCAGCAGCAACAGGG - Intronic
1113937903 13:114004841-114004863 CACTCACAACAGCAAAGACACGG + Intronic
1115466178 14:33716780-33716802 CAGAAACAACAGCAACAAAAAGG - Intronic
1115937980 14:38576597-38576619 CAATAAAAACAACAACAACAAGG - Intergenic
1115993634 14:39174076-39174098 CACAGACACCACTAACAACAGGG + Intergenic
1117128939 14:52664963-52664985 CACTAAAAATAACAACAACAGGG + Intronic
1118150244 14:63181261-63181283 CACCAACATCAGCATCATCAGGG + Intergenic
1118887612 14:69879713-69879735 CACCAACACCAGCAGCAAGTGGG - Exonic
1119476535 14:74933603-74933625 CACTACCACCATCACCACCAAGG - Intergenic
1121213385 14:92227092-92227114 TTCTAACACAAGCTACAACATGG - Intergenic
1122858841 14:104573155-104573177 CACAAAAACCAGCAGCATCATGG - Intronic
1124463774 15:29918135-29918157 CTCTAACACATGCTACAACATGG - Intronic
1125180127 15:36872975-36872997 CACCAACACCAAAAACTACAGGG - Intergenic
1126161742 15:45620166-45620188 CACTCACACCTCCAACACCATGG + Intronic
1126712594 15:51476492-51476514 CACTAAATCCAGCAACAAGCAGG + Intronic
1126958271 15:53959507-53959529 CACCAACACGAGCATGAACAAGG - Intergenic
1127276741 15:57452680-57452702 CACAAACACCAGCACCATCGAGG - Intronic
1128028250 15:64457855-64457877 CACAGGCACCAGCAGCAACAAGG + Intergenic
1128513838 15:68329753-68329775 CACCACCACCACCACCAACAAGG + Intronic
1129086147 15:73094372-73094394 TACTAATACAAGCTACAACATGG - Intronic
1129369149 15:75077328-75077350 CAATAATAACAACAACAACACGG - Intronic
1129948084 15:79559659-79559681 CATCAACACCAGCAAGAAGACGG - Intergenic
1131254981 15:90856096-90856118 CACTAACTTCAGCATCAATATGG - Intergenic
1132086019 15:98908865-98908887 CATAAACACCAGGAACAACGGGG + Exonic
1132590251 16:723413-723435 CAGTGACTCCAGCATCAACAGGG + Intronic
1133376279 16:5290056-5290078 TACTAACACGTGCTACAACACGG + Intergenic
1134113050 16:11527890-11527912 AACAAACAACAACAACAACAAGG + Intergenic
1138182755 16:54953470-54953492 CAACAACAACAGCAACAAAATGG + Intergenic
1139289309 16:65843107-65843129 TACTGACACATGCAACAACATGG + Intergenic
1140171371 16:72608326-72608348 TACTAACACGTGCTACAACATGG + Intergenic
1140464361 16:75167891-75167913 CAATACCAGCACCAACAACATGG + Intronic
1140634627 16:76897571-76897593 TACTAACACATGCAACCACATGG + Intergenic
1140845965 16:78888390-78888412 GAGTAACACCTGGAACAACAGGG - Intronic
1141190385 16:81820473-81820495 TACTGACACTAGCAACAACATGG - Intronic
1141871226 16:86788110-86788132 CAGTAACAACAACAACAAAAAGG - Intergenic
1142293514 16:89203968-89203990 CAATAACAACAACAACAAAAAGG - Intergenic
1142500340 17:328819-328841 TGCTAATACCAGCTACAACATGG + Intronic
1144461048 17:15458827-15458849 CACCAGCAGCAGCAACACCAGGG + Intronic
1145239133 17:21229494-21229516 CACTAAGTTCAGCACCAACATGG - Intergenic
1146784500 17:35707133-35707155 CAACAACAACAACAACAACAAGG - Intronic
1148032715 17:44632779-44632801 CATTAACAACAACAAAAACAAGG + Intergenic
1149261425 17:54884286-54884308 CTCAAACACCAGCTACAACCAGG + Intergenic
1149632239 17:58135938-58135960 CACTTACGCCAGCAAGAAGAGGG + Intergenic
1152404819 17:80091223-80091245 CAATAACACCAACAACAAATTGG - Intronic
1152869147 17:82742527-82742549 TTCTAACACCTGCTACAACATGG - Intronic
1153296066 18:3547928-3547950 TACTAACACATGCTACAACATGG + Intronic
1153948623 18:10038469-10038491 CACTAGCACCAGCACCAGCAGGG - Intergenic
1154357097 18:13630075-13630097 CACTAACCCCAGCACCAAGCTGG + Intronic
1156442427 18:37204961-37204983 CAACAACAACAACAACAACAAGG - Intronic
1157484742 18:48078855-48078877 CACTAATACATGCTACAACATGG - Intronic
1157766791 18:50303610-50303632 TACTGATACAAGCAACAACATGG - Intergenic
1158149099 18:54346735-54346757 TACTGACACAAGCTACAACATGG + Intronic
1158425084 18:57332208-57332230 TACTAATACATGCAACAACATGG + Intergenic
1158713063 18:59854321-59854343 CTCAAACACCAGAATCAACAGGG + Intergenic
1158754175 18:60302279-60302301 CACCAAACCCAGCAACAATAAGG + Intergenic
1159020642 18:63140481-63140503 CATTGACACATGCAACAACATGG + Intronic
1160670940 19:362892-362914 CTCTAGCACCAGCTACAGCATGG + Intronic
1161025972 19:2037383-2037405 CAGCATCACCAGCAACAACGTGG + Intergenic
1161831650 19:6609647-6609669 CAAAAACAACAGCAACAAAATGG + Intergenic
1162071228 19:8153471-8153493 CACTGGCATCAGCAACAACCGGG + Intronic
1162120065 19:8459307-8459329 CCCTAACACCAGAGACCACACGG - Intronic
1162363388 19:10232783-10232805 CAACAACAACAGCAACAAAAAGG + Intergenic
1162755279 19:12854514-12854536 CAGTGACACAAGCTACAACATGG - Intronic
1163694543 19:18757322-18757344 CACTAACACCAGCCAAGACATGG - Intronic
1163759533 19:19127957-19127979 TTCTAACACCTGCTACAACATGG + Intronic
1164889221 19:31808757-31808779 AACTAACAACAACAACAAAAAGG - Intergenic
1165670206 19:37671922-37671944 CACAAATACCAGGAACAAAAAGG + Intronic
1166982852 19:46641636-46641658 TACTAATACCTGCTACAACATGG + Intergenic
1167181772 19:47909441-47909463 CAACAACAACAGCAACAAAAGGG + Intergenic
1167182422 19:47914831-47914853 CAACAACAACAGCAACAAAAGGG + Intergenic
1167183089 19:47920183-47920205 CAACAACAACAGCAACAAAAGGG + Intergenic
1167183757 19:47925533-47925555 CAACAACAACAGCAACAAAAGGG + Intergenic
1167184387 19:47930583-47930605 CAACAACAACAGCAACAAAAGGG + Intergenic
1167185059 19:47935934-47935956 CAACAACAACAGCAACAAAAGGG + Intergenic
1167185711 19:47941323-47941345 CAACAACAACAGCAACAAAAGGG + Intergenic
1167186378 19:47946678-47946700 CAACAACAACAGCAACAAAAGGG + Intergenic
1167187029 19:47952069-47952091 CAACAACAACAGCAACAAAAGGG + Intergenic
1167187679 19:47957452-47957474 CAACAACAACAGCAACAAAAGGG + Intergenic
1167216462 19:48169048-48169070 CACTGATACAAGCAACAACTTGG + Intronic
1167542162 19:50096180-50096202 CAACAACAACAGCAACAAAAGGG - Intergenic
1167542597 19:50099245-50099267 CAACAACAACAGCAACAAAAGGG - Intergenic
1167543034 19:50102310-50102332 CAACAACAACAGCAACAAAAGGG - Intergenic
1167543470 19:50105373-50105395 CAACAACAACAGCAACAAAAGGG - Intergenic
1167544143 19:50110717-50110739 CAACAACAACAGCAACAAAAGGG - Intergenic
1167544818 19:50116070-50116092 CAACAACAACAGCAACAAAAGGG - Intergenic
1167545493 19:50121422-50121444 CAACAACAACAGCAACAAAAGGG - Intergenic
1167546170 19:50126777-50126799 CAACAACAACAGCAACAAAAGGG - Intergenic
1167546847 19:50132112-50132134 CAACAACAACAGCAACAAAAGGG - Intergenic
1167547505 19:50137485-50137507 CAACAACAACAGCAACAAAAGGG - Intergenic
1168284533 19:55324152-55324174 CACTAATACATGCCACAACATGG - Intronic
925786407 2:7435399-7435421 CAACAACAACAGCAACAACAAGG - Intergenic
927292364 2:21417238-21417260 CCTTACCACCACCAACAACAAGG - Intergenic
928916985 2:36482865-36482887 CAGTAACAACAGCCACAATAAGG - Intronic
929801426 2:45107517-45107539 TACTAACACATGCTACAACATGG + Intergenic
930173957 2:48282069-48282091 CACTAACCCCATCAAGAACATGG - Intergenic
930994668 2:57701880-57701902 CATTACCAACAGCAAAAACAGGG - Intergenic
931459461 2:62437582-62437604 CAACAACAACAACAACAACAGGG + Intergenic
931585035 2:63816808-63816830 TACTGACACCCTCAACAACATGG + Intronic
931640416 2:64376196-64376218 CACCATCACCAGCACAAACATGG + Intergenic
932031974 2:68197340-68197362 AACTGACACATGCAACAACATGG - Intronic
932339629 2:70954379-70954401 CAATAACAACAGCAAAAAAATGG - Intronic
933454565 2:82504488-82504510 CACTGACACATGCAATAACAAGG + Intergenic
933849454 2:86353983-86354005 CACTGATACATGCAACAACATGG + Intergenic
934702842 2:96455658-96455680 CAATAACAACATCAACAAAAAGG + Intergenic
934817628 2:97342999-97343021 CACTGTCACCATCAACACCATGG + Intergenic
934820068 2:97365485-97365507 CACTGTCACCATCAACACCATGG - Intergenic
934926219 2:98383412-98383434 CACTAACACCAGCAACAACACGG + Exonic
935322665 2:101904100-101904122 CAATAAGACCACCAACATCATGG + Intergenic
935385663 2:102497518-102497540 CACTAACACCTGCAACAACTTGG + Intronic
936488596 2:112949242-112949264 TATTAACATAAGCAACAACATGG - Intergenic
937390180 2:121479067-121479089 CACACACACCATCAACAACATGG + Intronic
938069252 2:128299901-128299923 CACAAACACCAGCGCCAGCAAGG + Intronic
938213094 2:129485170-129485192 CATCAACACCATCAACAGCAGGG - Intergenic
938839020 2:135140058-135140080 CACTGAAGCCTGCAACAACAAGG - Intronic
938898335 2:135775471-135775493 AACTGATACCTGCAACAACATGG + Intronic
939441185 2:142252203-142252225 CACTAACACATACAACAACATGG + Intergenic
939611298 2:144314224-144314246 CACTAATACATGCAACAACATGG + Intronic
940405422 2:153295703-153295725 CACTAGCACCAGCATCACCTGGG + Intergenic
940603741 2:155893850-155893872 CACTAACACTAGCAAAAGCTTGG + Intergenic
941263228 2:163323467-163323489 CAATAACACCAGCTTCACCAGGG - Intergenic
941529183 2:166644064-166644086 CCCTAACATCAGGAAAAACAAGG - Intergenic
942216329 2:173722858-173722880 TACTGACACATGCAACAACATGG + Intergenic
942485431 2:176434687-176434709 CACTAATACACACAACAACATGG - Intergenic
943115172 2:183660235-183660257 CACAAGCACATGCAACAACATGG + Intergenic
943220652 2:185100371-185100393 CACTAATACATGCTACAACATGG + Intergenic
943225023 2:185161861-185161883 CACTACCACCACCAACTATAGGG + Intergenic
943556032 2:189404814-189404836 CACTCATACATGCAACAACATGG - Intergenic
943744801 2:191450791-191450813 AACTAATACATGCAACAACATGG - Intergenic
944301236 2:198127080-198127102 TACTAACATCAGAAATAACATGG - Intronic
944456584 2:199901242-199901264 CACTAACTTCAGCATCAATATGG - Intergenic
944680029 2:202068928-202068950 CATTAACAAGAGCAACACCAAGG + Intergenic
945907851 2:215614905-215614927 CACTAGCACCTGCTACATCAGGG - Intergenic
946095402 2:217270238-217270260 CAGTAACAGCAGCCACAACCTGG + Intergenic
946262800 2:218509979-218510001 CACCAACAGCAGCAACTGCAGGG - Exonic
946541842 2:220693357-220693379 CATTCACAACAGCAAAAACACGG - Intergenic
946865033 2:224035096-224035118 AAGTCACACCAGCAATAACATGG + Intronic
947610189 2:231520359-231520381 CACTAAGACGCACAACAACAGGG - Intergenic
947735901 2:232455326-232455348 CCCTGACACCTGCTACAACATGG - Intergenic
1169583468 20:7053251-7053273 CACCAACATCAGAAACAAAAAGG - Intergenic
1169930045 20:10822807-10822829 CATAAACACCAGCAATAACTTGG - Intergenic
1170751526 20:19152051-19152073 CACTTACATTAGCAACAAAAAGG + Intergenic
1171071697 20:22075206-22075228 CACTGATATAAGCAACAACATGG - Intergenic
1172388660 20:34551262-34551284 TACTGATACCTGCAACAACATGG + Intronic
1172877494 20:38174575-38174597 CGCTGATACCTGCAACAACAGGG - Intergenic
1173438320 20:43053077-43053099 TACTAACACAGGCTACAACACGG + Intronic
1174347561 20:49941778-49941800 CTCTAACTTCAGCAACAACATGG - Intronic
1174647060 20:52095420-52095442 CACTCACACCTGGAACATCATGG + Intronic
1177655892 21:24016676-24016698 CAACAACAACAGCAACAAAAGGG + Intergenic
1177766825 21:25467892-25467914 TACTAATACCTGCTACAACATGG + Intergenic
1178620903 21:34173757-34173779 CAACAACAACAACAACAACACGG + Intergenic
1180925022 22:19547795-19547817 CAACAACAACAACAACAACAAGG - Intergenic
1182715395 22:32353555-32353577 CACTGACACCACCAGCACCAGGG + Intergenic
1182822809 22:33233260-33233282 CACTAACACCACCACCACCTAGG - Intronic
1182894798 22:33850212-33850234 CACCAGCAGCAGCAATAACACGG + Intronic
1183939223 22:41283543-41283565 CATTAACAACAACAACAAAAAGG + Intronic
1185397187 22:50598932-50598954 GACAAACACCAGAAACGACATGG - Intronic
949869513 3:8575969-8575991 TACAAACAACAGCAACAACAAGG - Intergenic
950639326 3:14338434-14338456 TACTGACACAAGCCACAACATGG + Intergenic
950680068 3:14579130-14579152 CACTGACACGTGCAACTACATGG + Intergenic
951261252 3:20512192-20512214 CACAAGCACCAGCACCAAGAAGG + Intergenic
951950512 3:28195282-28195304 CCCTAGGACTAGCAACAACAGGG - Intergenic
952248403 3:31623753-31623775 CAATAGCATCAGCATCAACATGG - Exonic
952489862 3:33858166-33858188 CACTTACAGTAGCAACAAAAAGG + Intronic
952497860 3:33931806-33931828 CAGTGACACATGCAACAACATGG - Intergenic
953065232 3:39463387-39463409 TAATAAAACCAGCAACAAAAAGG + Intergenic
956260409 3:67333718-67333740 TACTGACACATGCAACAACATGG + Intergenic
956599291 3:71002006-71002028 CAATAACAACAACAACAACAGGG + Intronic
956801531 3:72764028-72764050 CACTAAAAATAGCAACAGCAAGG + Intronic
957065814 3:75521135-75521157 TACTAACACGTGCTACAACACGG - Intergenic
957241991 3:77671611-77671633 CACTAAAACAAGTAACCACATGG - Intergenic
957432584 3:80131009-80131031 CACTGATACAAGCAGCAACATGG - Intergenic
959229501 3:103630669-103630691 CACCTTCATCAGCAACAACACGG + Intergenic
959332002 3:105018480-105018502 GACTAACAACAGCATCAAAAAGG + Intergenic
959562807 3:107801757-107801779 CACCAACACCATCACCAATAAGG - Intronic
959828405 3:110830360-110830382 TATTAACACCTGCAACAACTTGG - Intergenic
961287334 3:125816926-125816948 TACTAACACGTGCTACAACAAGG + Intergenic
962342867 3:134599954-134599976 AAACAACACCAGCAACAACATGG + Intronic
965253646 3:166375852-166375874 CAATAATAAAAGCAACAACAGGG - Intergenic
965419137 3:168435513-168435535 CAGTAACAGCAGCAGCAGCAGGG + Intergenic
966230019 3:177641477-177641499 TACTAACTCCAGCATCACCAAGG - Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
967468737 3:189838207-189838229 CACTCACAGCAACAACAAAAAGG - Intronic
968237480 3:197043321-197043343 CAAGAACAACAGTAACAACACGG + Exonic
968932120 4:3586692-3586714 CAGTGCCAACAGCAACAACAAGG + Intronic
969010417 4:4057197-4057219 TACTAACACGTGCCACAACACGG - Intergenic
969108421 4:4825805-4825827 AACTAACAGCACAAACAACAAGG - Intergenic
969191901 4:5527975-5527997 CACCATCAACAGCAATAACAAGG - Intergenic
969743640 4:9052698-9052720 TACTAACACGTGCTACAACACGG + Intergenic
969803042 4:9584795-9584817 TACTAACACGTGCTACAACACGG + Intergenic
970365683 4:15355725-15355747 CCCAAAGACCAGCAACCACAGGG - Intronic
971282423 4:25251804-25251826 CAACAACAACAACAACAACATGG - Intronic
972503243 4:39697362-39697384 CACCAACAGCAGCAGCAACTGGG + Intergenic
972824911 4:42746749-42746771 CTCTAACACTAGGAAAAACATGG - Intergenic
973960113 4:56101254-56101276 CAGCAACAACAACAACAACAAGG - Intergenic
974207846 4:58729832-58729854 GACAAGCACCAGCAACAATAAGG + Intergenic
974227511 4:59065885-59065907 CAACAACAACAACAACAACAAGG - Intergenic
976033470 4:80787295-80787317 CATTAACAACAACAACAAAAGGG - Intronic
976079724 4:81342262-81342284 AAACAACAACAGCAACAACAAGG - Intergenic
976138839 4:81968224-81968246 CACTAAGACCAACATCAAGAAGG - Intronic
978360101 4:107922341-107922363 CATTCCCACCAGCAACAATAAGG - Intergenic
980458840 4:133078383-133078405 CAATATCAACAGCAACAACACGG - Intergenic
981745178 4:148045800-148045822 CAAGAACACCAGCAACAGCAAGG - Intronic
982162080 4:152580329-152580351 CAATAACACCACACACAACAAGG + Intergenic
985637046 5:1041021-1041043 CACTCACACAAGAAAGAACAAGG - Intergenic
986890579 5:12299725-12299747 CACTGCCACCAGCAACCACCAGG - Intergenic
987262116 5:16214338-16214360 CAACAACAACAACAACAACAAGG - Intergenic
988990332 5:36664123-36664145 CAACAACAACAGCAACAAAAAGG - Intronic
989444889 5:41515911-41515933 TTCTAACACCTGCCACAACATGG + Intergenic
991186117 5:63810014-63810036 CATTACCACCATCAACCACAGGG + Intergenic
991451945 5:66760698-66760720 TACTAACACACGCAACAACATGG - Intronic
991955667 5:71993936-71993958 CACTGAAACCTGCAACAAAATGG + Intergenic
993022335 5:82606070-82606092 CACTGCCACCACCAACAGCATGG + Intergenic
994427858 5:99617037-99617059 AACTAACATCATCAACAAGATGG - Intergenic
996302845 5:122008386-122008408 CAGTAAAACCAGCACCAAGAAGG - Intronic
997674021 5:135699354-135699376 TACTAACACCTGCAACAATATGG + Intergenic
998155353 5:139783455-139783477 CACTGACACCTGCTACAATATGG - Intergenic
998631471 5:143903645-143903667 CACCAACACCACCTACAATATGG - Intergenic
998704168 5:144739684-144739706 CACTTACAACAGCAAAAACATGG + Intergenic
999000614 5:147918711-147918733 CACTACCACCACCATCAACAAGG - Intergenic
999109477 5:149105892-149105914 TACTAATACAACCAACAACATGG + Intergenic
999145432 5:149390194-149390216 CACTAATACCAGTAATAGCAGGG - Intronic
999313309 5:150567696-150567718 TATTAACACAAGCTACAACATGG - Intergenic
1000505238 5:162108681-162108703 CAATATCACCAGTATCAACAGGG + Intronic
1000915701 5:167078505-167078527 CAACAACAACAACAACAACAAGG + Intergenic
1001615289 5:173038338-173038360 CACAAACAACAACAACAAAATGG + Intergenic
1004309249 6:14529651-14529673 GACTAACTCCAGGAAAAACAAGG + Intergenic
1004878565 6:19982342-19982364 GAATAAAACCAGCAACAACAAGG - Intergenic
1005286830 6:24336809-24336831 TTGTAACATCAGCAACAACATGG + Intronic
1005519736 6:26588914-26588936 CAACAACAACAACAACAACAGGG - Intergenic
1007091729 6:39189062-39189084 CAGGACAACCAGCAACAACATGG + Exonic
1007389457 6:41542218-41542240 CATTGCCACGAGCAACAACATGG - Intergenic
1007502386 6:42308301-42308323 CACTAATACATGCAACAACATGG + Intronic
1009648866 6:66447255-66447277 CAACAACAACAACAACAACAAGG + Intergenic
1010124270 6:72414066-72414088 CAGTAGCACCAGCAACAGCTGGG + Intergenic
1011197081 6:84792690-84792712 CACACACACCAGCAGGAACATGG + Intergenic
1012338991 6:98095050-98095072 GACTGACACATGCAACAACATGG + Intergenic
1014609922 6:123529520-123529542 TAAAAACAACAGCAACAACATGG + Intronic
1015769761 6:136756445-136756467 CAACAACAACAGCAACAAAAAGG - Intronic
1016377381 6:143436467-143436489 CACTTTCATCAGTAACAACACGG + Intronic
1018590442 6:165414473-165414495 CACTAAGACATGCAACAACATGG - Intronic
1018879401 6:167861679-167861701 CATTAACATCAGCAACACAAAGG - Intronic
1019009286 6:168828842-168828864 CCCTAAGTCCATCAACAACAGGG - Intergenic
1019405559 7:882096-882118 CACTCACAACAGCACCGACATGG - Intronic
1020948578 7:14647341-14647363 CAACAACAACAACAACAACAAGG + Intronic
1021544209 7:21795018-21795040 GACTATCACCAGCAACATCCTGG - Intronic
1021863301 7:24928822-24928844 CACTGATATTAGCAACAACATGG - Intronic
1024731207 7:52255749-52255771 CACCAGAACAAGCAACAACAGGG + Intergenic
1025634709 7:63312531-63312553 CACTACCACCAGCGCCACCAGGG - Intergenic
1025647987 7:63435639-63435661 CACTACCACCAGCGCCACCAGGG + Intergenic
1026811984 7:73475406-73475428 TACTAACACATGCTACAACATGG + Intronic
1028453226 7:91009175-91009197 AACTGACACTAGCAACAACATGG - Intronic
1028611403 7:92716163-92716185 CAATGACACAAGCAGCAACATGG + Intronic
1029069700 7:97885198-97885220 TACTAACACGTGCTACAACACGG - Intergenic
1030025262 7:105317762-105317784 CAACAACAACAGCAACAAAAAGG - Intronic
1030437267 7:109538890-109538912 TCCTGACACAAGCAACAACATGG - Intergenic
1031347509 7:120687086-120687108 CACTACCATATGCAACAACATGG + Intronic
1032276644 7:130462431-130462453 TACTAATACCTACAACAACATGG - Intergenic
1032529434 7:132608175-132608197 CACTATCACCATCACCACCATGG + Intronic
1032926714 7:136614476-136614498 CAACAACAACAACAACAACAAGG - Intergenic
1033415433 7:141157520-141157542 CAACAACAACAACAACAACACGG + Intronic
1033618855 7:143043962-143043984 TACTAACACCAGCTACTGCATGG - Intergenic
1034302947 7:150032064-150032086 CACTTAAACCAGCTCCAACAAGG - Intergenic
1034803100 7:154065204-154065226 CACTTAAACCAGCTCCAACAAGG + Intronic
1035183200 7:157105772-157105794 CAACAACAACAACAACAACAAGG - Intergenic
1035614153 8:990152-990174 CACTAATACAAACAACACCATGG - Intergenic
1036251948 8:7169866-7169888 TACTAACACGTGCTACAACACGG - Intergenic
1036365543 8:8117595-8117617 TACTAACACGTGCTACAACACGG + Intergenic
1036728211 8:11239262-11239284 CATTAACACCAGCAAATGCAAGG - Intergenic
1036885403 8:12548512-12548534 TACTAACACGTGCTACAACACGG - Intergenic
1037351411 8:17961806-17961828 CAGAAACAACAGAAACAACAGGG - Intronic
1038077314 8:24090987-24091009 AACAAACAACAACAACAACATGG + Intergenic
1038323513 8:26551559-26551581 AACTAACACCATCAACTAAATGG + Intronic
1038598980 8:28918501-28918523 CACTACCAAAAGAAACAACATGG - Intronic
1038823135 8:30971554-30971576 CAACAACAACAACAACAACATGG + Intergenic
1039356312 8:36820484-36820506 CACTGTCACCAGCAATAATATGG + Intronic
1041186779 8:55308983-55309005 CTTTAAAACCAGCAAAAACAGGG - Intronic
1041590650 8:59578470-59578492 AACTAACACATGCAACAACATGG + Intergenic
1041624207 8:60006556-60006578 CAACAACAAAAGCAACAACATGG + Intergenic
1042262088 8:66870238-66870260 CACTAATACATGCTACAACATGG - Intergenic
1042721243 8:71828891-71828913 CACTGACACGTGCTACAACATGG - Intronic
1043476871 8:80613700-80613722 CACTAAGTTCAGCAACAATAGGG - Intergenic
1044694196 8:94906358-94906380 CACAAACAACAGCTACCACATGG - Intronic
1045001796 8:97884779-97884801 CAACAACAACAACAACAACACGG + Intronic
1045182080 8:99795238-99795260 CACTATCACCTGCAGTAACATGG - Intronic
1046209232 8:111045392-111045414 CACTAACACCAGAATCTAAATGG + Intergenic
1046373178 8:113338560-113338582 CACTGATACTTGCAACAACATGG + Intronic
1047595624 8:126374987-126375009 CAATGACCCCAGCATCAACAGGG + Intergenic
1048720204 8:137314944-137314966 TACTGACACAAGCAACAATATGG - Intergenic
1049387474 8:142350673-142350695 CACAAACACCACCATCTACAGGG + Intronic
1051458999 9:17292956-17292978 CAATAACAGCATCAACAAAAAGG - Intronic
1052309734 9:27052854-27052876 CAACAACAACAACAACAACATGG - Intronic
1054458015 9:65445236-65445258 CACTGCCAACAGCAACAACAAGG - Intergenic
1055444492 9:76369134-76369156 CACTACCACCTGCACGAACATGG + Intergenic
1056298011 9:85212584-85212606 CAATAACACCATTAACAATACGG + Intergenic
1056568447 9:87795546-87795568 CACAAAAAGCAGAAACAACAGGG - Intergenic
1056596914 9:88015221-88015243 CACTAACACCAGTAACACCAGGG + Intergenic
1056672632 9:88643894-88643916 CTCTGACACATGCAACAACATGG - Intergenic
1056903843 9:90627361-90627383 CTCTAACACATGCTACAACACGG + Intronic
1057372766 9:94489016-94489038 CATCAACACCCTCAACAACAGGG - Intergenic
1057897012 9:98917176-98917198 CACTGTCACCAGCAACACCAGGG - Intergenic
1058579617 9:106440876-106440898 CAACAACAACAACAACAACAGGG - Intergenic
1059032866 9:110719167-110719189 CAACAACAACAACAACAACAAGG + Intronic
1059297343 9:113283352-113283374 CACCATCACCAGGAGCAACAGGG - Intronic
1059410505 9:114129255-114129277 CACTATCACAAGAAACAGCAAGG + Intergenic
1059849613 9:118322680-118322702 CAAAAACAACAGCAACAAAAAGG - Intergenic
1060248657 9:121967826-121967848 TACTGACACAAGCCACAACAAGG + Intronic
1060258226 9:122051496-122051518 CAGTATCACAAGCAACCACATGG - Intronic
1060948280 9:127583541-127583563 AACTAATACAGGCAACAACACGG - Intergenic
1061856873 9:133446486-133446508 CACTCACACATGCTACAACATGG - Intronic
1186378784 X:9034665-9034687 CAACAACAACAACAACAACAGGG - Intronic
1186477564 X:9869617-9869639 CTCTGACACAGGCAACAACATGG - Intronic
1187278555 X:17838010-17838032 TACTGACACAACCAACAACATGG + Intronic
1187969900 X:24648644-24648666 CACCAACATCAGCATCACCAGGG + Intronic
1188290361 X:28380166-28380188 TACTGACACAAGCAACAACATGG - Intergenic
1188659201 X:32737121-32737143 CACCAACAGCAACAACAAAAGGG + Intronic
1188795000 X:34452780-34452802 TACTAACACATGCTACAACATGG + Intergenic
1189805503 X:44731643-44731665 TACTAATACATGCAACAACATGG + Intergenic
1191176879 X:57513415-57513437 CAACAACAACAACAACAACATGG - Intergenic
1191718659 X:64210803-64210825 CACTAAGTTCAGCATCAACATGG + Intergenic
1191741699 X:64442750-64442772 CAATAAAAACAACAACAACAAGG + Intergenic
1191810995 X:65188458-65188480 AACAAATACCAGCAACAATATGG - Intergenic
1192338403 X:70240710-70240732 CACTAACACGTGCTACAGCATGG - Intergenic
1192830806 X:74749213-74749235 CACTAAAAGCAGCAACATTAAGG + Intronic
1193201887 X:78701238-78701260 AGGTAACACCAGCAACAAAAAGG + Intergenic
1193230599 X:79040943-79040965 CAATAACAACAACAACAAAAAGG - Intergenic
1193493675 X:82183810-82183832 CACTACCACCACCACCACCATGG - Intergenic
1193657067 X:84211356-84211378 CAACAACAACAACAACAACAAGG - Intergenic
1194350044 X:92815847-92815869 CTTTAACAACAACAACAACATGG + Intergenic
1194760141 X:97786768-97786790 TATTAACACCTGCAACAATATGG + Intergenic
1195806414 X:108772590-108772612 CACTAGCACCAGCATCACCTGGG + Intergenic
1196362551 X:114881363-114881385 CACTAAAAGCACAAACAACAAGG - Intronic
1196517166 X:116627950-116627972 CAGCAACAACAACAACAACAAGG - Intergenic
1196551829 X:117037471-117037493 CACTACCACCCTCAACATCAAGG - Intergenic
1196607245 X:117671176-117671198 CATCAACAACAGCAACAAAAAGG - Intergenic
1196970712 X:121105313-121105335 CACTAACAAAAACAACAAAAAGG - Intergenic
1197415073 X:126165132-126165154 CACCAACCCCAGCAACCGCAAGG - Exonic
1197626801 X:128811100-128811122 TACTCACAATAGCAACAACATGG - Intergenic
1198450661 X:136764459-136764481 CACTACTACCTGCAACAACACGG + Intronic
1199272892 X:145905879-145905901 CTCTAACAACAACAACAAAAAGG + Intergenic
1199701780 X:150383915-150383937 TACTAATACAAGCTACAACATGG - Intronic
1199718048 X:150520708-150520730 TACTGATACCAGCTACAACATGG + Intergenic
1201461777 Y:14233211-14233233 CAACAACAACAACAACAACAAGG - Intergenic
1201887671 Y:18903581-18903603 CAATAATACCAGTTACAACAAGG + Intergenic
1202360002 Y:24097528-24097550 CATCAACACCAGCTACAACCAGG + Intergenic
1202510775 Y:25572586-25572608 CATCAACACCAGCTACAACCAGG - Intergenic