ID: 934927540

View in Genome Browser
Species Human (GRCh38)
Location 2:98392007-98392029
Sequence TCTCCCGGAACACTCCCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934927540_934927552 27 Left 934927540 2:98392007-98392029 CCCCACGGGAGTGTTCCGGGAGA 0: 1
1: 0
2: 1
3: 7
4: 60
Right 934927552 2:98392057-98392079 ACCCTTGACCATGAGAGGCCAGG 0: 1
1: 0
2: 1
3: 16
4: 179
934927540_934927546 -6 Left 934927540 2:98392007-98392029 CCCCACGGGAGTGTTCCGGGAGA 0: 1
1: 0
2: 1
3: 7
4: 60
Right 934927546 2:98392024-98392046 GGGAGACCCAGCATGGTGGATGG 0: 1
1: 0
2: 0
3: 34
4: 356
934927540_934927547 -5 Left 934927540 2:98392007-98392029 CCCCACGGGAGTGTTCCGGGAGA 0: 1
1: 0
2: 1
3: 7
4: 60
Right 934927547 2:98392025-98392047 GGAGACCCAGCATGGTGGATGGG 0: 1
1: 0
2: 0
3: 16
4: 204
934927540_934927550 22 Left 934927540 2:98392007-98392029 CCCCACGGGAGTGTTCCGGGAGA 0: 1
1: 0
2: 1
3: 7
4: 60
Right 934927550 2:98392052-98392074 TACCTACCCTTGACCATGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 71
934927540_934927544 -10 Left 934927540 2:98392007-98392029 CCCCACGGGAGTGTTCCGGGAGA 0: 1
1: 0
2: 1
3: 7
4: 60
Right 934927544 2:98392020-98392042 TTCCGGGAGACCCAGCATGGTGG 0: 1
1: 0
2: 0
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934927540 Original CRISPR TCTCCCGGAACACTCCCGTG GGG (reversed) Intronic
903325779 1:22567758-22567780 TCTCCTGGAACTTTCCCGTGGGG - Intronic
904795945 1:33056555-33056577 TCTCTTGGATCACTCCCTTGGGG + Intronic
912567493 1:110598657-110598679 TCTAGAGGCACACTCCCGTGGGG + Intronic
912623549 1:111189622-111189644 TCTCAAGCAACAGTCCCGTGAGG + Intronic
919658273 1:200218323-200218345 CCTCCCGGAACCCTACCATGAGG - Intergenic
1070818866 10:79343133-79343155 TCTCCCTGACCATGCCCGTGAGG + Intergenic
1073147710 10:101291666-101291688 TCTCCCGGAGGCCTCCCGCGTGG - Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1089743696 11:120602363-120602385 ACTCCCTGAACAGTCCCCTGGGG - Intronic
1091934628 12:4425258-4425280 TAGCCTGGAACACTCCTGTGTGG + Intergenic
1096494180 12:52029816-52029838 TCTCCAGGCACTCTCCCTTGAGG + Intronic
1098591958 12:72224543-72224565 TCTCCCACAACCCTCCCTTGGGG - Intronic
1101491197 12:105211393-105211415 TCACACTGAACACTTCCGTGTGG + Intronic
1109140105 13:58704121-58704143 TTTCCCGACACACTCCAGTGAGG + Intergenic
1112938222 13:104827394-104827416 TATCCCAGAACACCACCGTGAGG + Intergenic
1113774556 13:112935610-112935632 TCACTCAGAACACTCACGTGAGG - Intronic
1114728097 14:24960598-24960620 TCTTCCAGAACACTCCCGATGGG + Intronic
1129101855 15:73272606-73272628 TCTCCTGGAATACTCCTGTCAGG - Intronic
1132618238 16:852731-852753 CTGCCCGGAACCCTCCCGTGCGG - Intergenic
1132769227 16:1551759-1551781 TCTGCCGGACCACGCACGTGTGG - Intronic
1134519809 16:14913433-14913455 TCTCCCGGACAGCTCCCGAGGGG - Intronic
1134554122 16:15152802-15152824 TCTCCCGGACAGCTCCCGAGGGG + Intergenic
1134707481 16:16312089-16312111 TCTCCCGGACAGCTCCCGAGGGG - Intergenic
1134960062 16:18400036-18400058 TCTCCCGGACAGCTCCCGAGGGG + Intergenic
1140478531 16:75250795-75250817 CCTCCCGCGACACTCGCGTGCGG + Intronic
1148105841 17:45118391-45118413 TGTCCTGGAACACACACGTGTGG + Exonic
1154051365 18:10962397-10962419 TGTCCCTTAACACTCCTGTGAGG + Intronic
1158160072 18:54471424-54471446 ACTCACGGAACACTCCCCTGTGG - Intergenic
1166321063 19:42019175-42019197 TCTCCCCCAACCCTCCTGTGAGG + Intronic
927001458 2:18798792-18798814 TCTCCCTGAACACTCCCAGTGGG + Intergenic
927474181 2:23400024-23400046 TCTGCCGGGACACTCCCCAGTGG - Intronic
933798039 2:85936902-85936924 TCTCCCGGTATCCTTCCGTGGGG + Intergenic
934927540 2:98392007-98392029 TCTCCCGGAACACTCCCGTGGGG - Intronic
937220901 2:120342899-120342921 TGGCCAGGAACACTCCTGTGAGG + Intergenic
941869301 2:170366982-170367004 TCACCTGGAACACTGCCCTGAGG + Intronic
947089388 2:226493321-226493343 TCTCCAGTAACAATCCCTTGTGG - Intergenic
948355434 2:237373708-237373730 TCTCCCGGGTCACTCGGGTGGGG - Intronic
948403367 2:237700611-237700633 TCTCCCTGAACAGCCCCGTGGGG + Intronic
1170437976 20:16349980-16350002 TTCCCTGGAACACTTCCGTGAGG + Intronic
1171448001 20:25218209-25218231 TGGCCCGGAACACTCCTGTGTGG - Intronic
1176219622 20:63963819-63963841 TCACCCGGAAGACTCTCGTGGGG - Exonic
1179457636 21:41509858-41509880 TCTCCCGGAAGCCTCCTGTGGGG + Intronic
1180636152 22:17264552-17264574 TCTCCCGGAACCTTCCAGAGTGG + Intergenic
1181699896 22:24614901-24614923 TCTCCCGAGGCACTCACGTGTGG - Exonic
1184602961 22:45554338-45554360 TCGCCTGGAGCACTCCCGTTTGG + Intronic
1185208553 22:49553971-49553993 TCTTCCAGAACATTCCAGTGTGG + Intronic
1185372498 22:50467528-50467550 TCACCCTGAACACCTCCGTGTGG + Exonic
961322369 3:126084381-126084403 TCTCCCGTAGCGCTCCCGCGGGG - Intronic
968891186 4:3369325-3369347 GCTCACTGAACACTCTCGTGCGG + Intronic
980510116 4:133774087-133774109 TCTCCCTAATCACTCCCCTGGGG + Intergenic
990611784 5:57464822-57464844 GCTCCCGGAACACTAATGTGTGG - Intergenic
992414450 5:76539272-76539294 TTTCCTGGAACATTCCCTTGAGG + Intronic
997370990 5:133359854-133359876 TCCCCGGGAAAGCTCCCGTGAGG - Intronic
1005640507 6:27791987-27792009 TATCCCGGGAAACTCCCGAGGGG - Intergenic
1007616830 6:43184781-43184803 TCTCCCTGAAGACACCAGTGAGG - Exonic
1015179393 6:130345583-130345605 TCTCCTGAAACACCCCCGAGAGG + Intronic
1016808855 6:148240001-148240023 TCTCCCAGGACACTGACGTGTGG + Intergenic
1016872853 6:148836130-148836152 GCTCCCCCAACCCTCCCGTGTGG - Intronic
1017122937 6:151041090-151041112 TCTCCTGGAACAGTCGGGTGTGG + Intronic
1030689086 7:112514419-112514441 TCTCCAGGACCATTCCCGGGAGG - Intergenic
1033330699 7:140414710-140414732 TGTGCCGGGACACTTCCGTGAGG - Intronic
1037574168 8:20185049-20185071 TGTCTCGGAACATTCCTGTGAGG - Intergenic
1040530794 8:48265009-48265031 TCTCTCAGAACACTGCCATGGGG + Intergenic
1052978104 9:34426877-34426899 TCTCCCTGAGCATTCCTGTGAGG + Intronic
1055639827 9:78311002-78311024 CATCCCAGAACACTCCCCTGAGG - Intronic
1057720644 9:97529108-97529130 TCTCCCTGAACACTCCCATGAGG - Intronic
1061800608 9:133111720-133111742 TCTCCCAGAACACATCCCTGGGG - Intronic
1185831645 X:3308879-3308901 TCTCCAGGAACCCTCCAGTGGGG - Exonic
1187050962 X:15695297-15695319 TCTCCTGGAACATGCCCTTGAGG + Intronic