ID: 934928862

View in Genome Browser
Species Human (GRCh38)
Location 2:98404045-98404067
Sequence GGGGAGAGTGCAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934928855_934928862 27 Left 934928855 2:98403995-98404017 CCCTCAGCAGCAGCTGCATGGCA No data
Right 934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG No data
934928856_934928862 26 Left 934928856 2:98403996-98404018 CCTCAGCAGCAGCTGCATGGCAA No data
Right 934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934928862 Original CRISPR GGGGAGAGTGCAGTGATTGT GGG Intergenic
No off target data available for this crispr