ID: 934932921

View in Genome Browser
Species Human (GRCh38)
Location 2:98443117-98443139
Sequence TTGATTATGACTGCCAGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934932921 Original CRISPR TTGATTATGACTGCCAGGCG TGG Intergenic
903874307 1:26462309-26462331 TAGAATATGACGGCCAGGCATGG - Intronic
905386252 1:37606258-37606280 TTGAAGAAGACAGCCAGGCGAGG + Intergenic
907585445 1:55612859-55612881 GTGTTTATGACTGCCAAGCAGGG + Intergenic
908085474 1:60628047-60628069 TTGTTTATTCCAGCCAGGCGCGG + Intergenic
909355017 1:74698046-74698068 TTAAGAATGACTGCCAGGCTTGG + Intergenic
910067827 1:83174595-83174617 TTGTTTCTGACTGCCATGCTGGG + Intergenic
910954780 1:92690166-92690188 TTCATTATTTCAGCCAGGCGTGG - Intronic
914506567 1:148295086-148295108 TGGATTGTGACAGCCAGGGGGGG - Intergenic
915621025 1:157084344-157084366 ATTAATATGACTGCCAGGTGAGG - Intergenic
917874650 1:179275043-179275065 TTCACTATGTCTGCCAGGCTGGG - Intergenic
918866101 1:189902471-189902493 TTAAATATAACTGCCAGGCTGGG - Intergenic
919752107 1:201044160-201044182 TTGATTCTGAGTCCCAGGAGAGG + Intronic
921224647 1:213006169-213006191 TTGCTAATGAAGGCCAGGCGTGG + Intronic
921412844 1:214854349-214854371 TGGATTATGCCTGGAAGGCGGGG - Intergenic
923473758 1:234314158-234314180 TTCATTCTGACAGGCAGGCGGGG - Intronic
1068173151 10:53422151-53422173 TTGATTTTGACTACCAGGGTAGG + Intergenic
1069795056 10:71046641-71046663 GTGATAATGACTGCCAGCGGGGG + Intergenic
1069898153 10:71691697-71691719 TTGGATGTGACTGCCAGGCAGGG - Intronic
1071264431 10:83952067-83952089 TTGATTATAACTCCCAGTTGAGG + Intergenic
1076387928 10:130071912-130071934 TAGAATATGACGGCCAGGCGCGG - Intergenic
1084628355 11:70327479-70327501 TTGATCATGAATGCCGGGCGTGG + Intronic
1088557863 11:111080940-111080962 TTCATTTTGACAGCCAGGAGTGG - Intergenic
1088773930 11:113063376-113063398 TTGTCAATGACTGCCAGGCCAGG - Intronic
1095394311 12:41744593-41744615 ATGATTAAGACTTCCAGGCCAGG - Intergenic
1096138155 12:49220018-49220040 TTGTAGATGACAGCCAGGCGTGG + Intronic
1097772853 12:63609175-63609197 TTTATAAAGACTGCCAGGGGTGG - Intronic
1111002005 13:82196741-82196763 TTGATTCTGAAAGCCAGTCGAGG - Intergenic
1111960081 13:94800614-94800636 ATGTTTATGACCGCCAGGGGAGG + Intergenic
1113095668 13:106661546-106661568 TTAATTATTACTCCCAGGAGAGG - Intergenic
1113557217 13:111247559-111247581 ATGAATATGAAGGCCAGGCGTGG - Intronic
1114543363 14:23480394-23480416 TTTATAAGGATTGCCAGGCGTGG - Intronic
1117065712 14:52011642-52011664 TTGATTACGACTGCCGGGAGAGG - Exonic
1117382418 14:55177960-55177982 TTGATAATTACGGCCAGGCACGG + Intronic
1118751211 14:68808909-68808931 TTGATGTTGTCTGCCAGGCCTGG - Intergenic
1129425742 15:75461463-75461485 TTAAGTATGCCTGCCGGGCGTGG + Intergenic
1129903571 15:79170323-79170345 TTTATTATGACTGCCAGCAAAGG + Intergenic
1131306636 15:91250371-91250393 TTGATTATGATTGTCAGTTGTGG - Intronic
1132051159 15:98609018-98609040 TTTATTATCAAAGCCAGGCGCGG - Intergenic
1135518829 16:23157742-23157764 TTGTTTTTGCCTGCCAGGCATGG - Intergenic
1135806253 16:25545543-25545565 TTGATGATGATTACCAGGAGAGG - Intergenic
1138909060 16:61374659-61374681 TTTATTAAGAGTGCCAGGCTGGG + Intergenic
1139819415 16:69708893-69708915 TCTATTAAGACTGCCAGGTGAGG - Intronic
1142085732 16:88179274-88179296 TCGTTCATGACTGCCAGGTGGGG - Intergenic
1143951581 17:10636959-10636981 TTGGCTGTGACTGCCAGCCGAGG + Intronic
1148061763 17:44841626-44841648 TTGATTAGTCTTGCCAGGCGCGG + Intergenic
1148331320 17:46815528-46815550 TGGAATCTGACTGCCAGGCGGGG + Intronic
1148525119 17:48324956-48324978 TTAAATATCATTGCCAGGCGCGG + Intronic
1149327029 17:55542405-55542427 TTTTTTATCACCGCCAGGCGCGG + Intergenic
1151854996 17:76714624-76714646 TTGTTTATTCCTGCCAGGCCAGG - Exonic
1159921995 18:74235058-74235080 TTAATTATGACTTCAAGGCCGGG + Intergenic
1161185680 19:2918214-2918236 TTGAGTATGACTGACATTCGTGG - Exonic
1165548580 19:36563129-36563151 TTGCCTATGGGTGCCAGGCGCGG + Intronic
1168157160 19:54481046-54481068 TTTTTTTTAACTGCCAGGCGCGG + Intergenic
1168656210 19:58130381-58130403 TGGATCATGTCGGCCAGGCGCGG + Intronic
925678472 2:6391441-6391463 GAGGTCATGACTGCCAGGCGTGG + Intergenic
927998462 2:27503434-27503456 TTGATCATGACTCCCAGCTGAGG + Intronic
928169865 2:28996524-28996546 AAGATAATGACTGCCAGGCTGGG + Intronic
931762031 2:65426615-65426637 TTGATTTTGACTGGGAGGAGGGG + Intronic
932008149 2:67948247-67948269 TTAGTTATGTCTGCCAGGGGTGG + Intergenic
932532517 2:72551484-72551506 TTTATTATGTTTGCCAGGTGCGG - Intronic
934714520 2:96536048-96536070 TTGACTATTACTGGCAGGCCTGG + Intergenic
934932921 2:98443117-98443139 TTGATTATGACTGCCAGGCGTGG + Intergenic
944754030 2:202741130-202741152 TTGGTGATGAACGCCAGGCGCGG + Intronic
946253028 2:218424953-218424975 ATGAAGATGACTGCCAGGCTGGG - Intronic
948038929 2:234883726-234883748 TTGAAACTGACTGCCAGGCATGG + Intergenic
948393758 2:237630015-237630037 TTAATTCTGACAGCCAGGGGAGG - Intronic
948780508 2:240318958-240318980 TTGATTCTGACTGGTAGGCATGG - Intergenic
1170045357 20:12079740-12079762 TTGAGTTTGACTTCCAGGAGGGG + Intergenic
1171946271 20:31380554-31380576 TGGATCATAACCGCCAGGCGTGG - Intronic
1171989537 20:31685110-31685132 TTGAGAAAGACAGCCAGGCGTGG + Intronic
1172656115 20:36539566-36539588 TGAATGATGACTGCCAGGGGCGG + Intergenic
1173386313 20:42591650-42591672 GTGATCAAGACTGCCAGGCAAGG + Intronic
1173985502 20:47258716-47258738 TTGATTCTGTCTGTCAGCCGTGG - Intronic
1175720002 20:61280125-61280147 TTGATTGGGTCTGCCAGGCTGGG + Intronic
1180045801 21:45304565-45304587 TGGACCATGACTGCCAGGCACGG - Intergenic
1181430941 22:22881355-22881377 CTGACTATTACTGTCAGGCGTGG + Intronic
951624093 3:24641359-24641381 TTGATTAAGTCTTCCAGGTGTGG - Intergenic
952285279 3:31962245-31962267 TTGGTGATGCCGGCCAGGCGCGG - Intronic
953526863 3:43698490-43698512 TGGTTTGTGACTGCCAGGCCAGG + Intronic
956004813 3:64767363-64767385 TTCATTATGACTGCCTGACGGGG + Intergenic
959514831 3:107253534-107253556 TTGAGTTTGACTGCCAGGGCTGG - Intergenic
959694368 3:109233905-109233927 TTAATTATGACCGCCTGGCTGGG - Intergenic
963843130 3:150128501-150128523 TTGAGTATGAGTGCAAGGCCTGG + Intergenic
966808398 3:183823879-183823901 TTGATAGGGACTGCCAGGGGTGG - Intronic
966838189 3:184066029-184066051 TACACTATGACGGCCAGGCGCGG + Intergenic
968195590 3:196703584-196703606 TTGATTATGGCTGCCTGGGGCGG - Intronic
972637099 4:40893996-40894018 TAGATTATGAGGGCCGGGCGCGG + Intronic
972653689 4:41045580-41045602 ATGATTAAGACTGCCAGGCACGG - Intronic
973250072 4:48051178-48051200 TTGGTTATTACTACCAGGCAGGG - Intergenic
974386782 4:61210763-61210785 CTGATCATGACTTCAAGGCGTGG + Intronic
978816439 4:112911609-112911631 TTGATAATGGCAGCCAGGTGTGG - Intronic
981581741 4:146256285-146256307 TTGTTGATTACTGCCAGGGGTGG - Exonic
984333467 4:178357109-178357131 TTGAATATGATTGCCAGGACTGG - Intergenic
984657202 4:182331030-182331052 TTGAATATGAATGTCAGGAGTGG + Intronic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
987167273 5:15213809-15213831 TTGATTATGAATGGAAGGAGTGG + Intergenic
987815771 5:22899985-22900007 ATGAATATCACGGCCAGGCGCGG + Intergenic
988574714 5:32410316-32410338 TTCATTATCAAGGCCAGGCGTGG + Intronic
989383373 5:40830954-40830976 TTGATGATGACAGCCGGGAGTGG + Exonic
990825808 5:59896271-59896293 TTTATTATTCCTGCCAGGCTGGG + Intronic
992045940 5:72889346-72889368 TTTACTATCCCTGCCAGGCGCGG - Intronic
1005891429 6:30142362-30142384 TTGATTATGAATGCTAGTAGTGG + Intronic
1006805861 6:36788559-36788581 TTGATTCTGACTGCAAGGCTGGG - Intronic
1007698696 6:43750694-43750716 TTAATTATGTAGGCCAGGCGTGG - Intergenic
1007857195 6:44870304-44870326 TTGTGTATGTCGGCCAGGCGTGG + Intronic
1008298092 6:49802996-49803018 TTCAGTAGGACAGCCAGGCGCGG + Intergenic
1013586251 6:111581685-111581707 TTGATTCTTAAGGCCAGGCGTGG + Intronic
1014962216 6:127701149-127701171 TTGGTTATGACTGGCTGGGGAGG - Intergenic
1020863439 7:13524265-13524287 TTGATTCTGACTGGCAGATGAGG - Intergenic
1022932417 7:35132870-35132892 TTTATAAAGACTGCCAGGGGTGG - Intergenic
1023893290 7:44410198-44410220 TTGATTATGACATCTAGGTGAGG - Intronic
1024406853 7:48992002-48992024 TTGTTTATAACTCCCAGGAGTGG - Intergenic
1027276268 7:76560166-76560188 TTGTTTCTGACTGCCATGCTGGG - Intergenic
1029828344 7:103225660-103225682 TTTATAAAGACTGCCAGGGGTGG - Intergenic
1031980870 7:128123537-128123559 TTAATTAAGACTGCCAGGGATGG + Intergenic
1034832470 7:154321490-154321512 TTGATGATGGCGGCCAGGCGCGG + Intronic
1038547156 8:28434655-28434677 TTTATTATGACTCCCAGTTGAGG + Intronic
1040475422 8:47772532-47772554 TTGATTGTTACAGCCAGGTGTGG - Intergenic
1041685565 8:60641701-60641723 TTGAGTATGAATGCAAGGTGAGG - Intergenic
1044579137 8:93805291-93805313 TTGCTAAGGACTGCCAGGCATGG + Intronic
1047168141 8:122463597-122463619 TTTATTATTAATGCCAGGAGCGG + Intergenic
1057140657 9:92725000-92725022 TTGATCTTGACTGGCAGGCCTGG - Intronic
1185829236 X:3283636-3283658 TTCATTATGACTGACATGCCAGG + Intronic
1187010696 X:15275911-15275933 TGCATTATCACTGCCAGGGGCGG - Intergenic
1191999514 X:67133674-67133696 TTGATAATGAGTGTCAGGCAGGG - Intergenic
1193662229 X:84271504-84271526 GTGATTAAGTCAGCCAGGCGTGG + Intergenic