ID: 934933278

View in Genome Browser
Species Human (GRCh38)
Location 2:98445336-98445358
Sequence CCGAGCGGGCGCGTGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 150}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934933269_934933278 -3 Left 934933269 2:98445316-98445338 CCCCAGCAGGGAGCCGGGTGCCG 0: 1
1: 0
2: 1
3: 22
4: 187
Right 934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 150
934933261_934933278 16 Left 934933261 2:98445297-98445319 CCCCGTGAAGACGCGGCCGCCCC 0: 1
1: 0
2: 0
3: 4
4: 69
Right 934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 150
934933262_934933278 15 Left 934933262 2:98445298-98445320 CCCGTGAAGACGCGGCCGCCCCA 0: 1
1: 0
2: 0
3: 6
4: 66
Right 934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 150
934933263_934933278 14 Left 934933263 2:98445299-98445321 CCGTGAAGACGCGGCCGCCCCAG 0: 1
1: 0
2: 0
3: 5
4: 107
Right 934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 150
934933255_934933278 27 Left 934933255 2:98445286-98445308 CCGACCCCCAGCCCCGTGAAGAC 0: 1
1: 1
2: 2
3: 31
4: 332
Right 934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 150
934933271_934933278 -5 Left 934933271 2:98445318-98445340 CCAGCAGGGAGCCGGGTGCCGAG 0: 1
1: 0
2: 2
3: 23
4: 242
Right 934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 150
934933259_934933278 21 Left 934933259 2:98445292-98445314 CCCAGCCCCGTGAAGACGCGGCC 0: 1
1: 0
2: 0
3: 5
4: 64
Right 934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 150
934933260_934933278 20 Left 934933260 2:98445293-98445315 CCAGCCCCGTGAAGACGCGGCCG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 150
934933256_934933278 23 Left 934933256 2:98445290-98445312 CCCCCAGCCCCGTGAAGACGCGG 0: 1
1: 0
2: 0
3: 4
4: 108
Right 934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 150
934933258_934933278 22 Left 934933258 2:98445291-98445313 CCCCAGCCCCGTGAAGACGCGGC 0: 1
1: 0
2: 1
3: 3
4: 91
Right 934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 150
934933270_934933278 -4 Left 934933270 2:98445317-98445339 CCCAGCAGGGAGCCGGGTGCCGA 0: 1
1: 0
2: 0
3: 7
4: 160
Right 934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 150
934933268_934933278 0 Left 934933268 2:98445313-98445335 CCGCCCCAGCAGGGAGCCGGGTG 0: 1
1: 0
2: 4
3: 38
4: 302
Right 934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934933278 Original CRISPR CCGAGCGGGCGCGTGGCCGC GGG Intronic
900269215 1:1778557-1778579 CCGCGCGGGCGGGAGGCGGCGGG + Intronic
901641424 1:10694859-10694881 AAGAGTGGGCGCGTGCCCGCGGG - Intronic
901641433 1:10694890-10694912 GCGAGCGCGCGCGCGGCCGCCGG - Intronic
902371983 1:16013110-16013132 CCAAGCGGCCGCTGGGCCGCTGG - Intergenic
902478836 1:16701310-16701332 CCGCGCGGGTGCCTGACCGCAGG - Intergenic
903493110 1:23743991-23744013 CCCAGCGGGTGCGTGTTCGCTGG + Intronic
904847477 1:33430950-33430972 ACGGGCGGGCGCGTGCGCGCTGG - Intronic
906615840 1:47232256-47232278 CCGGGCGGGCGCGGGGCGGGCGG - Intergenic
908780397 1:67685342-67685364 CCGGGCGGGCGAGGGGCGGCCGG + Exonic
910448898 1:87328126-87328148 GCGAGCGGGCGCGGGTCCTCAGG + Intergenic
914869109 1:151458760-151458782 CCGAGCGTGCGTGTGGACGTCGG + Intronic
923126639 1:231039810-231039832 CCGAAAGGGCGGGTGGGCGCGGG + Intronic
924560360 1:245153653-245153675 CAGAGTGGGGGCGTGGCCCCAGG + Intergenic
1067091345 10:43267082-43267104 CGGAGCGGGCGCGAGAGCGCGGG + Intergenic
1067669635 10:48307003-48307025 CCGAGGGGGCGTGGGGCTGCGGG + Intronic
1068669665 10:59710050-59710072 CCGAGAGGGCGCCTGGCCGACGG - Exonic
1074169734 10:110920000-110920022 GCGAGCCGGCGCGAGGGCGCGGG + Intronic
1077074940 11:696052-696074 GCGCGCGGGCGCCTGGCCCCGGG + Intronic
1077107869 11:849761-849783 CCGCGCGGGGGCGGAGCCGCCGG + Intronic
1077360792 11:2139431-2139453 CCGCGCGGGCCCTGGGCCGCGGG - Intronic
1077470987 11:2760487-2760509 CCCAGCGGGGGCTTGGCCGTGGG - Intronic
1083436326 11:62646160-62646182 CCGAGGGGCCGCGGGGCCGCAGG + Intronic
1083657003 11:64234610-64234632 CCGGGCGGGCGGGCGGCCGGTGG - Exonic
1083658326 11:64240997-64241019 GCCAGCGGGCGTGTGGCCGCGGG + Intronic
1083822562 11:65181489-65181511 CCGGGCGGGCCCGGGGCTGCGGG + Exonic
1084310447 11:68313215-68313237 CGGGGCGGCCGCGCGGCCGCTGG - Intronic
1084972998 11:72781603-72781625 CCGGGCGGGCGCGGGGCGGGTGG + Intronic
1090699328 11:129279686-129279708 CGGAGCGCGCGCGCGGCCGAGGG + Intergenic
1096647683 12:53047447-53047469 GCCAGGGGGCGCGGGGCCGCCGG + Intronic
1101466907 12:104958325-104958347 CCGCGCGGGGGCGGGGCGGCGGG - Intronic
1101692413 12:107093999-107094021 CCGAGCGCGCTCCTGCCCGCCGG - Intergenic
1103432965 12:120903910-120903932 CCGAGCGAGCCCGCCGCCGCCGG - Exonic
1106665390 13:31846510-31846532 CCGAGCGCGCCGGTGCCCGCAGG + Intergenic
1121617022 14:95320002-95320024 GCGAGCGAGCGCGGGGCGGCGGG + Intergenic
1122137949 14:99645463-99645485 GTGAGCGGGCGCGCGGCCACCGG + Intronic
1122982825 14:105199302-105199324 GCCAGCGGGGGCCTGGCCGCAGG - Intergenic
1123004449 14:105314675-105314697 CCGGGCGCGCGCGGGGCGGCCGG + Exonic
1124453650 15:29821855-29821877 CAGGGCTGGCGCGGGGCCGCGGG - Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1128455633 15:67829871-67829893 CCGCGAGCGCGCGTGGCCGCCGG - Intronic
1128865989 15:71115562-71115584 CAGGGCGGGCGCGGGGCGGCTGG + Intronic
1132055545 15:98648487-98648509 GCGAGCGGGCGCGTGTGCGCGGG + Intergenic
1132512787 16:352569-352591 CGGAGCGGGCGGGTGGGAGCTGG - Exonic
1132719808 16:1309979-1310001 CCGAGCGGCCGGGCCGCCGCAGG + Intronic
1132815909 16:1826522-1826544 CGGAGCGGGCGCGGGGCCGCGGG - Intronic
1132887573 16:2189389-2189411 CCGAGCGGGGGCGGGGCAGCGGG - Intronic
1134216580 16:12321267-12321289 CTGAGGGGGAGGGTGGCCGCTGG - Intronic
1136365000 16:29805912-29805934 GCGAGCGCGCGCGTGGCCAGCGG - Intergenic
1141526960 16:84617951-84617973 CCGAGCGCGCCCCTGGCCGGCGG + Exonic
1141830862 16:86509566-86509588 GCGAGCGGGCGGGCAGCCGCCGG - Intergenic
1142078065 16:88131893-88131915 CAGAGCGGGCAGGTGGGCGCGGG - Intergenic
1142476761 17:193510-193532 CCGAGCAGGGGCGTGGTGGCTGG - Intergenic
1142848133 17:2691934-2691956 CGGGGCGGGGGCGGGGCCGCGGG - Intronic
1144328958 17:14207175-14207197 CCGAGCGGAGGCGGGGACGCAGG + Exonic
1144828393 17:18119157-18119179 GTGACCGGGCGCGCGGCCGCAGG - Exonic
1145962896 17:28897670-28897692 GCGAGCGGGCGGCCGGCCGCTGG - Exonic
1150069782 17:62140594-62140616 CCGGGCGGCCGCAAGGCCGCAGG + Intergenic
1150488919 17:65561355-65561377 CCGAGCCGCGGCGTGGGCGCGGG - Intronic
1152111570 17:78360002-78360024 CCGGGCGGGCGGCTGGCGGCTGG + Exonic
1152463752 17:80454625-80454647 CCGGGCTGGCGCGAGGCCGCAGG - Intergenic
1152675249 17:81636880-81636902 CCGGGCGGGAGCGGGGACGCCGG - Intronic
1152718530 17:81911327-81911349 CGGAACGGGCGCGGGGCTGCAGG - Exonic
1152786087 17:82248837-82248859 CCGGGCGGGCGCTGGGCCTCGGG - Intronic
1153480591 18:5543405-5543427 CCGCCCGGGCGGGTGGCGGCTGG - Intronic
1155963888 18:32018665-32018687 CAGGGCGAGCGCGCGGCCGCGGG - Exonic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161435061 19:4258220-4258242 CCTGGCGGGCGCGGGGCGGCGGG - Exonic
1161950921 19:7467450-7467472 GCGTGCGGGCGCGCGGCTGCAGG + Exonic
1162778709 19:12995805-12995827 CCGGGCGGGAGCGCGGCGGCCGG - Exonic
1163551186 19:17967184-17967206 GCGAGCGGGCGCGGGGCCCGGGG - Intronic
1163607124 19:18281542-18281564 CCGAGCGGACGGGGGGGCGCGGG - Exonic
1164155746 19:22596038-22596060 GCGGGCGGGGGCGGGGCCGCAGG - Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1164958393 19:32405949-32405971 CCGAGAGGGCGGGCGGGCGCCGG + Intronic
1165242884 19:34481800-34481822 CCCGGCCCGCGCGTGGCCGCCGG + Exonic
1166094460 19:40530467-40530489 GGGAGGGGGCGCGCGGCCGCCGG + Intronic
1167096981 19:47379832-47379854 CCCAGCGGGCACGGAGCCGCAGG - Exonic
1167271458 19:48508888-48508910 CCGAGCCAGCGCGGGGCCCCTGG - Exonic
1167638220 19:50667300-50667322 CCGAGGGGGCGGGAGGCGGCAGG + Exonic
1202712855 1_KI270714v1_random:27141-27163 CCGCGCGGGTGCCTGACCGCAGG - Intergenic
926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG + Intronic
930032903 2:47069277-47069299 CCCATCGGGCCCCTGGCCGCTGG + Intronic
934079205 2:88452757-88452779 CGGAGCGGGGCGGTGGCCGCGGG + Intergenic
934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG + Intronic
936512201 2:113157458-113157480 CCCAGCCGGCGCCTGGGCGCGGG + Intronic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
946622461 2:221573618-221573640 CCCAGCGGCCGCCCGGCCGCCGG - Intronic
1168806505 20:675235-675257 CCCGGCTGGCGCGTGGCTGCGGG + Intronic
1169048777 20:2558982-2559004 CCGCGCGGGGGAGTGGCCGCGGG + Intronic
1173581280 20:44148596-44148618 CCGAGCTGCCGCGTGGCCTTAGG + Intronic
1176194493 20:63831044-63831066 CCGGGCGGGCGCATCGCGGCGGG - Intronic
1176380537 21:6110531-6110553 CCGAGAGGCCGCTTGCCCGCGGG - Intergenic
1176547891 21:8209278-8209300 GGGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176547957 21:8209468-8209490 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176555851 21:8253683-8253705 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1176566824 21:8392311-8392333 ATGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176566888 21:8392503-8392525 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176574788 21:8436717-8436739 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176611402 21:8988010-8988032 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1179742935 21:43427709-43427731 CCGAGAGGCCGCTTGCCCGCGGG + Intergenic
1183675533 22:39297098-39297120 CCCAGCGGGCCCGTGGGAGCTGG - Intergenic
1184136756 22:42554269-42554291 CCGAGCGTGCGCGTGGGTGTCGG + Intronic
1184242329 22:43217755-43217777 CCCAGCGGGCGGGTGTGCGCTGG - Intronic
1184523542 22:45009055-45009077 GCGAGCGGCGGCGTGGCGGCCGG - Intronic
1184680977 22:46071972-46071994 ACGAGCGGCCGCGCGGCGGCCGG + Intronic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203252836 22_KI270733v1_random:125768-125790 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260892 22_KI270733v1_random:170854-170876 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
953484964 3:43286559-43286581 CCGAGCGGGCTGCCGGCCGCGGG - Exonic
954409641 3:50364836-50364858 CTGGGCGGGCGCAAGGCCGCGGG + Intronic
956080247 3:65549450-65549472 CCGAGCGCGCGCCTGGGCTCCGG - Intronic
966764435 3:183447469-183447491 CCAATCGGGCTCGTGCCCGCGGG - Intergenic
968293453 3:197555879-197555901 CCGAGGGGGGGCGCTGCCGCAGG + Exonic
968585452 4:1414239-1414261 CGGGGTGGGCGCGTGTCCGCGGG + Intergenic
968585462 4:1414269-1414291 CGGGGTGGGCGCGTGTCCGCGGG + Intergenic
968585482 4:1414329-1414351 CGGGGTGGGCGCGTGTCCGCGGG + Intergenic
968585492 4:1414359-1414381 CGGGGTGGGCGCGTGTCCGCGGG + Intergenic
968803196 4:2756304-2756326 CCGGGAGGCCGCGCGGCCGCCGG + Exonic
969053204 4:4386873-4386895 CAGGGCGGGCGCGTGGTCCCAGG + Exonic
973945341 4:55949152-55949174 CCGGGAGGCCGCGCGGCCGCGGG + Intronic
976184532 4:82430713-82430735 CCGAGATCGCGCGGGGCCGCCGG + Exonic
976733158 4:88284241-88284263 CCGAGTCGGCGCTTGGCCGGCGG - Intronic
978384689 4:108167904-108167926 GCGGGCGAGCGCGGGGCCGCCGG + Exonic
981782650 4:148444812-148444834 CCGAGCGGACGCGCAGCCCCGGG - Intergenic
981782888 4:148445591-148445613 CCGAGCGGGCACGAGGGCGCGGG - Intergenic
990042310 5:51389569-51389591 GCGAGCGAGCGCGCGACCGCGGG + Intronic
990148398 5:52788359-52788381 CTGGGCGGGCGCGGGGCCGAGGG - Exonic
1002487617 5:179550529-179550551 CCCAGCGGGCGGGCGGGCGCGGG - Intergenic
1002927115 6:1611071-1611093 CGGACCGGGCGCGTTGCCGTCGG - Exonic
1003633218 6:7807558-7807580 CCGGCCGGGCGCGTGGGCTCAGG - Intronic
1007585101 6:42984628-42984650 CGGAGCCGGAGCGGGGCCGCAGG + Exonic
1007589815 6:43014318-43014340 CCGAGCCGGGGCGGGGCCGCGGG - Exonic
1012410123 6:98947635-98947657 GCGCGGGGGCGCGGGGCCGCGGG + Intronic
1015724884 6:136289840-136289862 CCGATCTGGGGCGTGGCCTCGGG + Exonic
1019014957 6:168873481-168873503 CCGAGCTGGCGGCCGGCCGCTGG + Intergenic
1019286623 7:226497-226519 CCGGGCGGCCGTGTGGCTGCGGG - Intronic
1023810360 7:43906654-43906676 CGGAGCGGGCGGGCGGCCGGCGG - Exonic
1025106461 7:56175178-56175200 CCGGGCGGGGGCGTGGCGTCCGG + Intergenic
1026010039 7:66629213-66629235 CCGGGCGGGCGGCGGGCCGCGGG + Intronic
1027111308 7:75442248-75442270 CCGGGCGGGCGGGTGGGCGGCGG + Intronic
1032021660 7:128409984-128410006 CCGAGGAGGGGCGGGGCCGCCGG + Exonic
1034470450 7:151251879-151251901 CCGAGCGAGCGGGCGGCGGCCGG + Intronic
1034508923 7:151519219-151519241 CCGGGCGGGCAGGTGGCGGCCGG - Intronic
1034825624 7:154259881-154259903 CAGAGCAGGCACGTGGCTGCTGG + Intronic
1036664510 8:10730157-10730179 CCGAGCGGGCTGGGGGCCGGGGG - Intronic
1036910381 8:12754072-12754094 CCGCGCGGGCGCCCGGCCCCGGG - Intronic
1037450798 8:19014008-19014030 CAGGGCGGGCGCGCGGCTGCGGG - Intronic
1038575590 8:28701432-28701454 GCGAGCGGGGGCGCGGACGCGGG - Exonic
1039212702 8:35235373-35235395 CCGGGCTGGGGCGGGGCCGCGGG - Intergenic
1039467796 8:37796723-37796745 CAGGGCGGGCGCGGGGACGCAGG + Intronic
1042235781 8:66612678-66612700 CCAAGCGGCCGCGGGGACGCGGG + Intronic
1043847232 8:85177343-85177365 CCGACCCGGCAGGTGGCCGCGGG + Intronic
1047739400 8:127794578-127794600 CCGGGCGGGCTCGGGGCGGCCGG + Intergenic
1049710277 8:144060239-144060261 CCGAGCGAGAGCCTGGCCGGCGG + Intronic
1057337404 9:94166534-94166556 TCCAGCGGGCGGGTGGCCCCGGG + Intergenic
1057921882 9:99104848-99104870 CCGAGAGGCCGCGTGGGGGCGGG - Intronic
1060426701 9:123512339-123512361 TCGAGGGGGAGCGTGGCCCCTGG + Intronic
1061108918 9:128552942-128552964 GGGAGGGGGCGCGAGGCCGCCGG + Intronic
1062696504 9:137878551-137878573 CCGTGCGCGCGCCTGGCTGCAGG + Intronic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203469239 Un_GL000220v1:108919-108941 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203477060 Un_GL000220v1:152891-152913 GCGAGCGGGCGCGGGGGCGGCGG - Intergenic
1187281418 X:17860898-17860920 CCGGGCGGGGGCGGGGACGCGGG - Intronic
1187403608 X:18983960-18983982 CCGATCTGCCGCGTGGGCGCGGG + Exonic
1189001999 X:36957671-36957693 CGGAGCGGGCGCGGGGCCGGCGG + Intergenic
1200249885 X:154547181-154547203 CCGCGAGCGCGCGAGGCCGCCGG - Exonic