ID: 934933921

View in Genome Browser
Species Human (GRCh38)
Location 2:98451087-98451109
Sequence TTCCAATCCCAGACAGGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934933921_934933925 -9 Left 934933921 2:98451087-98451109 CCATAGCCTGTCTGGGATTGGAA 0: 1
1: 0
2: 0
3: 10
4: 130
Right 934933925 2:98451101-98451123 GGATTGGAAAGCCAGGGTCCTGG 0: 1
1: 0
2: 3
3: 15
4: 239
934933921_934933929 16 Left 934933921 2:98451087-98451109 CCATAGCCTGTCTGGGATTGGAA 0: 1
1: 0
2: 0
3: 10
4: 130
Right 934933929 2:98451126-98451148 GCAGTGTGCATGTCTCTTTCTGG 0: 1
1: 0
2: 1
3: 10
4: 244
934933921_934933926 -8 Left 934933921 2:98451087-98451109 CCATAGCCTGTCTGGGATTGGAA 0: 1
1: 0
2: 0
3: 10
4: 130
Right 934933926 2:98451102-98451124 GATTGGAAAGCCAGGGTCCTGGG 0: 1
1: 0
2: 1
3: 21
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934933921 Original CRISPR TTCCAATCCCAGACAGGCTA TGG (reversed) Intronic
902614838 1:17618221-17618243 TCCCAACCCCAGGCTGGCTAGGG + Intronic
905242284 1:36588866-36588888 TTCCAACCCCAGTAAGGCTTTGG + Intergenic
906952302 1:50344825-50344847 TTCAGATCCCAGCCAGGCTCTGG + Intergenic
916795543 1:168163761-168163783 TCCCACTCCTAGAGAGGCTAAGG + Intergenic
917062932 1:171059866-171059888 TCCCACTCCCAGACAGGCCCTGG - Intronic
917746840 1:178018249-178018271 TTGCAATCCCAGGGAGGCAAGGG + Intergenic
919663099 1:200267459-200267481 TTCCAGTCCCACACAGGCAGGGG + Intergenic
920345230 1:205301956-205301978 TTCCCATCCCTGGCAGCCTAGGG + Intergenic
920821191 1:209382977-209382999 CTGCATTCCCAGACAGGTTAAGG + Intergenic
920839372 1:209541073-209541095 TTCCAAATCCAGGCAGGCTATGG - Intergenic
921512980 1:216054796-216054818 GTCCAATTACAGACAGGCCAAGG - Intronic
922372767 1:224927973-224927995 TCCCAATCCCTGACAGGCCCTGG - Intronic
922553847 1:226518218-226518240 TTCCAGTCCCAGCCCTGCTATGG + Intergenic
923647729 1:235841200-235841222 TTCCAATACCAGACCGAATAAGG + Intronic
1063776894 10:9273869-9273891 CTGCAATCCCAGGCAGGCTGAGG + Intergenic
1064540878 10:16403878-16403900 TGACAATCCCAGCCAGGCTGTGG + Intergenic
1072875779 10:99171856-99171878 TTTCAATCCTAGACACTCTAGGG - Intronic
1073763953 10:106661826-106661848 TCTCAATCCCTAACAGGCTAAGG + Intronic
1074762852 10:116680361-116680383 TTCCAATCCAAGACATCCAAGGG + Intronic
1077002200 11:329520-329542 TTGCAATCCCAGTCAGCCCAGGG - Intergenic
1078006118 11:7533683-7533705 TTCAAATCCCACCCATGCTAAGG - Intronic
1081823884 11:46027464-46027486 TTCCCATCCCAGAAAGGGCAGGG - Intronic
1082759619 11:57114712-57114734 TTCAGCTCCCACACAGGCTATGG + Intergenic
1083037273 11:59651003-59651025 TTCCATTCACAGATAGGCAAAGG + Intronic
1083342776 11:61968997-61969019 CTCCTATCCCAGACTGGGTAAGG - Intergenic
1085195900 11:74671564-74671586 TGCCACTCCCACACAGGCTGTGG - Intergenic
1086484908 11:87289074-87289096 TTACAATCACAGACATGCAATGG + Intronic
1087890811 11:103536406-103536428 TACAGATCCCAGAGAGGCTAGGG + Intergenic
1088619944 11:111671555-111671577 CTCCAATCACAGCCAGGCCAAGG - Intronic
1088740434 11:112762535-112762557 TTCCATTTCCAGACATGCTCTGG + Intergenic
1090205619 11:124882449-124882471 TGCCAATCCCAGAGAGTCCAGGG - Intergenic
1101484017 12:105132625-105132647 TTCCCCTCCCAGAAAGACTAGGG - Intronic
1101516108 12:105436911-105436933 TTCAAAGCCCAGACAGGACAGGG + Intergenic
1102815163 12:115859477-115859499 CTCCAAAGCCAGACTGGCTAGGG + Intergenic
1103959831 12:124602488-124602510 TTCAGATACCAGAGAGGCTAAGG - Intergenic
1105465472 13:20635711-20635733 TTCCACTCCCCGACAGGCCCCGG - Intronic
1105899349 13:24742348-24742370 CTCCCATCCCAGACATGCCAAGG + Intergenic
1108272399 13:48774507-48774529 TTCCCATCCCAAACAGCTTAGGG + Intergenic
1109383031 13:61590060-61590082 TGTCTATCCCAGACAGTCTATGG - Intergenic
1113054842 13:106257078-106257100 TTCCATTCCCAGAGAAGCCAGGG + Intergenic
1113846987 13:113397836-113397858 TTGCAATCCCAGTCAGCCCAGGG + Intergenic
1117716542 14:58587339-58587361 TTCCAGTCCCCTAGAGGCTAGGG + Intergenic
1118688358 14:68313955-68313977 TTCCAGGCCTAGAGAGGCTATGG - Intronic
1120663499 14:87278644-87278666 TTCCCAGCCCAGAGAGGCCAGGG - Intergenic
1121034857 14:90693466-90693488 TACCAAACCCAGACAGAATAAGG - Intronic
1123771848 15:23537020-23537042 TACAAATCCCAGAGAGGTTAGGG - Intergenic
1124079101 15:26474946-26474968 TCCCAGTCCCAGAGAGGCTGGGG + Intergenic
1124216483 15:27811685-27811707 TGCCAACCCCAGACACGCCACGG - Intronic
1125448415 15:39782753-39782775 TTCCACTACCAGAGAGGCTGAGG - Exonic
1126105365 15:45143635-45143657 TTCCAATCCCAGTCTGACTCTGG - Intronic
1129321661 15:74778343-74778365 TTCCCATCTCAGCCAGGCTGAGG - Intergenic
1130034022 15:80341670-80341692 TCCCAATCCCAGAGAGGCTGGGG - Intergenic
1130583965 15:85164977-85164999 TTCCAATCCTAGAAAGCCTGAGG - Intergenic
1132212663 15:100036020-100036042 TTCCAAACCCAACCAGCCTATGG + Intronic
1135978344 16:27126307-27126329 TCCCAATCCCTGACAGGCCCTGG - Intergenic
1136126844 16:28189480-28189502 GTCCTATCACAGTCAGGCTAAGG - Intronic
1137050951 16:35712765-35712787 CTCCGACCCCAGACAGTCTAAGG - Intergenic
1138314691 16:56059858-56059880 TGCAAATGCCAGACAGGCTTAGG + Intergenic
1140723294 16:77789562-77789584 TTCCTTTCCCCGTCAGGCTACGG - Intronic
1143604724 17:7976169-7976191 TTCCAGTCCCAGAAAGGCTGGGG + Intergenic
1145806511 17:27737246-27737268 TTACCATCCCAGAAATGCTAGGG + Intergenic
1147315906 17:39620149-39620171 TTCCTTTCCCAGACAGGCCAAGG + Intergenic
1157607082 18:48932711-48932733 ACCCAACCCCAGACAGGCCAGGG + Intronic
1160940051 19:1615996-1616018 TACCAATGCCAGACAGATTAAGG + Intronic
1161563044 19:4984317-4984339 TTCCATTCCAAGACAGCTTAGGG + Intronic
1163519131 19:17781518-17781540 TTCTTATCCCAGACAGGACACGG + Exonic
1166266986 19:41690554-41690576 TTTCCATCTCAGAGAGGCTAAGG - Intronic
932685539 2:73866144-73866166 TTCTAATCTCAAACAGGCTAAGG - Exonic
933293170 2:80460216-80460238 TTCCAAGCAAAGAAAGGCTATGG - Intronic
933557823 2:83852093-83852115 TTCCATTCCCTGACAGGCCACGG - Intergenic
934933921 2:98451087-98451109 TTCCAATCCCAGACAGGCTATGG - Intronic
937446090 2:121959521-121959543 TTCCAATGCCTTAAAGGCTAGGG - Intergenic
940007338 2:149020073-149020095 TTCTAATCCCAGAGAGACTGAGG - Intronic
940311550 2:152284643-152284665 TTCCAATTCCAGGGATGCTATGG - Intergenic
940857859 2:158743708-158743730 CTGCAATCCCAGAAAGCCTAAGG + Intergenic
941096455 2:161243959-161243981 TTCCACTTGCAGACATGCTAGGG + Intergenic
941264364 2:163341644-163341666 CTCCTTTCCCAGACAGGTTAGGG + Intergenic
941765429 2:169291500-169291522 TTCCAATCCCAGGTATGATAAGG - Intronic
947937161 2:234017230-234017252 TTCCATTCTCAGGCAGGATATGG - Intronic
1168788846 20:562634-562656 TTCTGATCCCAGCCAGGCCAGGG - Intergenic
1168896769 20:1329042-1329064 TCCCAATCCCAGCCAGGATTGGG + Intronic
1172272300 20:33661495-33661517 TTTCATTCTCAGACAGGCCAGGG + Intronic
1173199316 20:40943126-40943148 TTACAATCACAGACAGCCTACGG + Intergenic
1177587820 21:23120865-23120887 TTCCTATACCAGACAAGATATGG - Intergenic
1180665522 22:17508461-17508483 TTACAATCCCAGACACACAATGG - Intronic
1181440230 22:22931945-22931967 TTCCAGCCCCAGACAGCCTCAGG + Intergenic
949860990 3:8504584-8504606 AACCAACCCCAGACAGGCTGGGG + Intronic
951866486 3:27314308-27314330 TTTCAATCCCACCCAAGCTATGG + Exonic
951897581 3:27624965-27624987 TTCCTATGCCAGACCAGCTAAGG - Intergenic
951926565 3:27914519-27914541 TTCCAATGCCAGGCAGGCAGTGG - Intergenic
954217335 3:49131924-49131946 TTCCAATCCCAGGCTGGGTCAGG - Intronic
957078384 3:75618799-75618821 TGCCAATCCCAGCCAGGAGAAGG - Intergenic
962075530 3:132077685-132077707 TTGGAATCCTAGGCAGGCTAAGG - Intronic
962467409 3:135673465-135673487 GTCAAATACCAGACAGGCTGAGG + Intergenic
963684961 3:148421728-148421750 TTCCAGTCCCAGTCAGGAAAAGG + Intergenic
967201142 3:187073674-187073696 TACCAATGCCTGACAGGCTCTGG + Intronic
968911197 4:3477755-3477777 CTCCAATCCCAGAGGGGCCAAGG - Intronic
972549905 4:40122226-40122248 TGCCAATTCCAGACAGTCTATGG - Exonic
973243999 4:47990408-47990430 TTCCAATCCCAGTAAGCCTGAGG - Intronic
973686703 4:53377691-53377713 CTCCAATCCCAGGAAGGCGACGG - Exonic
979927708 4:126588289-126588311 TCCCAACCCCTGACAGGCTCCGG - Intergenic
980571487 4:134625949-134625971 GCCTAATCCCAGACAGGCAAAGG + Intergenic
981578338 4:146227967-146227989 GTACAAGCCCAGACAGGCCAGGG + Intronic
984679396 4:182590123-182590145 TTCCAATCCCAGGGAGGCCCAGG + Intronic
984881680 4:184415027-184415049 TTCCAATTCCAGACGCCCTAGGG + Intronic
987063334 5:14263199-14263221 TTTCTTTCCCAAACAGGCTAAGG + Intronic
991727648 5:69552146-69552168 TTGCAATCCCAGCTAGGCTGAGG - Intronic
991867309 5:71075728-71075750 TTGCAATCCCAGCTAGGCTGAGG + Intergenic
1007235266 6:40386556-40386578 CTCCAATCCCAGACAGACTCCGG + Intergenic
1008917744 6:56807932-56807954 TTCCAATTCCAGGCATACTATGG + Intronic
1010796247 6:80120015-80120037 TCCCAATCCCCGACAGGCCCTGG + Intronic
1011249353 6:85354304-85354326 TTCCAGTCCAAGCCAGGCAAGGG + Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1014674929 6:124352032-124352054 TTCCATTCCCATACAAGCCATGG + Intronic
1016464778 6:144314580-144314602 TTCCCATTTCAGAAAGGCTATGG + Intronic
1017617714 6:156262754-156262776 TTCTAATCTCAGAAAGCCTATGG + Intergenic
1018247222 6:161834852-161834874 TTTAAATCCCAGGCAGGCAATGG - Intronic
1027768341 7:82374996-82375018 TTCTAATCCCCAACAAGCTAAGG + Intronic
1028781888 7:94746685-94746707 GACCAATTCCAGAAAGGCTAGGG - Intergenic
1028887236 7:95947696-95947718 TTCCAAGCTTAGACAGGCAAAGG + Intronic
1030135086 7:106238961-106238983 TTCCTTCCCCAGGCAGGCTAGGG + Intergenic
1032121840 7:129162400-129162422 GTCCACTGCCAGGCAGGCTAGGG - Exonic
1033463850 7:141572783-141572805 TTTGAAACCCCGACAGGCTATGG + Intronic
1034470186 7:151250734-151250756 TTGCTTTCCCAGAGAGGCTAAGG + Intronic
1040893247 8:52339129-52339151 TTCCAAGCCCATCCAGGCTGTGG + Intronic
1048478563 8:134766522-134766544 TTCCAATCCCAGCAATGCCAGGG + Intergenic
1048829234 8:138459885-138459907 TTTAAATCCCAGGCAGCCTAAGG + Intronic
1049564123 8:143329081-143329103 TTCCCTTCCCAGGCAGGCTGTGG - Intronic
1051000678 9:12278635-12278657 TTCCAGTCCCATCCAGGTTACGG - Intergenic
1054716829 9:68564942-68564964 GCCCAATCCCACAAAGGCTAGGG + Intergenic
1055784724 9:79860504-79860526 TTCCATTCCCAAAAAGGCTGAGG - Intergenic
1060242352 9:121914817-121914839 CTCCATTCCCAGATAGCCTAGGG - Intronic
1061044000 9:128154515-128154537 TCCCAAGCCCAGAGAGGCTCAGG + Intergenic
1062637121 9:137497372-137497394 TCCCAATGCCAGACAGACTCAGG + Intronic
1186461858 X:9754341-9754363 CTCCCAGCCCAGCCAGGCTAGGG - Intronic
1188653877 X:32666361-32666383 CTCCACTCCCAGACAGGCGATGG + Intronic
1190979298 X:55441763-55441785 ATCAAATCCCTGACAGGCGATGG - Intergenic
1194495479 X:94612511-94612533 TTCCAATCCCAGTAATGCTGTGG + Intergenic
1198774458 X:140164848-140164870 TGCCAATCAAAGACAGGCAAGGG - Intergenic
1199835451 X:151585622-151585644 ATCCAAGGACAGACAGGCTATGG + Intronic
1200223438 X:154403431-154403453 TTCCTCACCCAGACGGGCTAGGG - Intronic