ID: 934934460

View in Genome Browser
Species Human (GRCh38)
Location 2:98454605-98454627
Sequence GTGAAAAATAAGAGTACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 346}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934934460_934934468 26 Left 934934460 2:98454605-98454627 CCCACAGTACTCTTATTTTTCAC 0: 1
1: 0
2: 0
3: 20
4: 346
Right 934934468 2:98454654-98454676 CTATTGTTGACTCCTGCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 88
934934460_934934467 25 Left 934934460 2:98454605-98454627 CCCACAGTACTCTTATTTTTCAC 0: 1
1: 0
2: 0
3: 20
4: 346
Right 934934467 2:98454653-98454675 CCTATTGTTGACTCCTGCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 90
934934460_934934463 -9 Left 934934460 2:98454605-98454627 CCCACAGTACTCTTATTTTTCAC 0: 1
1: 0
2: 0
3: 20
4: 346
Right 934934463 2:98454619-98454641 ATTTTTCACATGTGCTCAAAGGG 0: 1
1: 1
2: 1
3: 35
4: 315
934934460_934934464 -5 Left 934934460 2:98454605-98454627 CCCACAGTACTCTTATTTTTCAC 0: 1
1: 0
2: 0
3: 20
4: 346
Right 934934464 2:98454623-98454645 TTCACATGTGCTCAAAGGGCTGG 0: 1
1: 0
2: 1
3: 10
4: 148
934934460_934934462 -10 Left 934934460 2:98454605-98454627 CCCACAGTACTCTTATTTTTCAC 0: 1
1: 0
2: 0
3: 20
4: 346
Right 934934462 2:98454618-98454640 TATTTTTCACATGTGCTCAAAGG 0: 1
1: 0
2: 2
3: 30
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934934460 Original CRISPR GTGAAAAATAAGAGTACTGT GGG (reversed) Intronic
905049938 1:35041789-35041811 GTGGAAAATGAGATCACTGTAGG - Intergenic
905522052 1:38607949-38607971 GTAAAAAAAAAAAGTACTGGGGG - Intergenic
908779811 1:67680002-67680024 GTGTAAGATAAGATTGCTGTAGG + Intergenic
909692995 1:78431373-78431395 GAGAAAAAAAAGAGTACTCTAGG + Intronic
910077107 1:83294491-83294513 GTGAAATATCAGAGTGCTGAAGG + Intergenic
910994340 1:93088099-93088121 GAAAAAAATAAGAGAACTGAGGG - Intronic
911791156 1:102016512-102016534 GAGAAAATTAGGAGTACTCTTGG + Intergenic
912117426 1:106424100-106424122 GTCAAAAATGAGTTTACTGTAGG - Intergenic
912329969 1:108810814-108810836 CTGAAAAATAATAGTAATTTAGG - Intergenic
913536447 1:119777555-119777577 TTGAAAAATAAGAATAATGAGGG + Intergenic
915381773 1:155448136-155448158 GTCAAAAATAAGTTCACTGTAGG + Intronic
915801964 1:158803035-158803057 CTGAAAAATAAAAGTACATTTGG - Intergenic
916524595 1:165597982-165598004 GTGAATAATAAGAATGCTTTGGG + Intergenic
917002943 1:170380402-170380424 GTGAAAAATGAGTTCACTGTAGG + Intergenic
917061260 1:171043267-171043289 GTCAAAAATGAGTTTACTGTGGG + Intronic
917178892 1:172270816-172270838 CTGAAAAAAAAAAGTACTGTGGG + Intronic
917331306 1:173883176-173883198 TTTAGAAAAAAGAGTACTGTTGG + Intronic
917438288 1:175043316-175043338 GTAAAAAATAAGTTCACTGTGGG + Intergenic
918415705 1:184304981-184305003 GTCAAAAATGAGTTTACTGTAGG + Intergenic
918559457 1:185847089-185847111 GTGAAAAATAAGAAATCTGATGG - Intronic
918872914 1:189999418-189999440 GTCTAAAATAAGAGTAATGCTGG - Intergenic
918929137 1:190831309-190831331 GTGACACATAAGAGTAATTTTGG - Intergenic
919323476 1:196074027-196074049 CTGAAGAATAACAGTACTTTTGG - Intergenic
923635900 1:235695933-235695955 TTAAAAAATTAGAGTACAGTAGG - Intronic
924367150 1:243307021-243307043 CTGAAAAATGAGACTACTGAAGG - Intronic
924425400 1:243945581-243945603 GTGTGGAATAAGAGTACTTTGGG + Intergenic
924552968 1:245095330-245095352 GTGAGAAATCAGGGTACTATTGG + Intronic
924754453 1:246929106-246929128 GGGAAATAAAAGAGTACAGTGGG + Intronic
1063305788 10:4898878-4898900 GTTAAAAATGAGTGCACTGTAGG + Intergenic
1063537379 10:6897321-6897343 TTGAAAAAGGAGAGTAATGTTGG + Intergenic
1063838092 10:10039599-10039621 GTGAAAAATCAAAGTACTAATGG - Intergenic
1064502798 10:15993088-15993110 GTGAAAAATAAGAGTGTCTTAGG - Intergenic
1064771335 10:18726755-18726777 TTGGTAAATAAGAATACTGTTGG - Intergenic
1065005376 10:21374815-21374837 TTGAAAAAGGAGAATACTGTTGG + Intergenic
1066591266 10:36996936-36996958 CTGAAAAATACAAGGACTGTTGG + Intergenic
1067052055 10:43027301-43027323 GGGAAAAATAAGAGCTCTGAAGG - Intergenic
1068772072 10:60832937-60832959 GTTAAAAATTAAAGAACTGTGGG + Intergenic
1068814957 10:61298871-61298893 GTGAAAAATTAGATGGCTGTAGG + Intergenic
1068830058 10:61483679-61483701 ATAAAAAATAAAAATACTGTTGG + Intergenic
1071113297 10:82188162-82188184 GTTAAAAATGAGTATACTGTAGG - Intronic
1071183338 10:83012525-83012547 AAGAAAAATAGGAGAACTGTGGG - Intergenic
1071244872 10:83751727-83751749 GGAAAAAATAATGGTACTGTGGG + Intergenic
1071704634 10:87983741-87983763 GGAAAAAGTAAGACTACTGTGGG - Intergenic
1071935060 10:90520545-90520567 GTCAAAAATAAGTTCACTGTAGG + Intergenic
1072917672 10:99549330-99549352 ATGGAAAATGACAGTACTGTGGG + Intergenic
1074069660 10:110053641-110053663 GTGAAAATTAAGACTACTGATGG - Intronic
1074546020 10:114403326-114403348 GTGAAAGACAAGACTACTTTAGG + Intronic
1077682798 11:4260208-4260230 GTCAAAAATGAGTTTACTGTAGG + Intergenic
1077687242 11:4306546-4306568 GTCAAAAATGAGTTTACTGTAGG - Intergenic
1077692403 11:4357733-4357755 GTCAAAAATGAGTTTACTGTAGG - Intergenic
1077848350 11:6049759-6049781 GTGAGAAATAAGGATATTGTAGG - Intergenic
1078711787 11:13799493-13799515 GTGAAAGATAAGAGGCCAGTGGG + Intergenic
1079625615 11:22613222-22613244 GTCAAAAATAAGTCTGCTGTAGG + Intergenic
1079728881 11:23915236-23915258 GTCAAAAATAAGTTAACTGTGGG + Intergenic
1079961075 11:26924143-26924165 GTCAAAAATAAGTTCACTGTAGG + Intergenic
1080637506 11:34136816-34136838 TTGAGAAAGAAGAGTTCTGTGGG + Intronic
1082752794 11:57038504-57038526 TTGAGAAATAAGAGCACTGTTGG - Intergenic
1085177126 11:74499072-74499094 CTCAAAAAAAAAAGTACTGTTGG + Intronic
1086548193 11:88023745-88023767 GTCAAAAATGAGTTTACTGTAGG - Intergenic
1087201720 11:95352223-95352245 GTCAAAAATGAGTTTACTGTAGG - Intergenic
1090866785 11:130707961-130707983 TTGAAAAATAAGAATAAAGTTGG + Intronic
1093738527 12:22653300-22653322 TTGAAAAAGAAGAGTAAAGTTGG - Intronic
1093933535 12:24977792-24977814 GTGAAAAATAATAATGATGTAGG - Intergenic
1094744132 12:33323796-33323818 GTGAAAAACAAGAGCACTTGTGG - Intergenic
1095355390 12:41267084-41267106 GTTAAAAATAACTGTAGTGTTGG + Intronic
1097347649 12:58512224-58512246 GTGAAAAAGAAGAGGAAAGTCGG + Intergenic
1097932580 12:65205634-65205656 GTGAAAATTGGGAGTTCTGTAGG + Intronic
1098948513 12:76614865-76614887 ATTAAAAATAAAAGCACTGTTGG - Intergenic
1101080526 12:101178351-101178373 TCGAAAAATAAGAATACAGTGGG + Intronic
1101121120 12:101581258-101581280 AGGCAAAATAAGAGCACTGTGGG + Intronic
1103251272 12:119502008-119502030 GGGGAAAAGAAGAGTATTGTGGG - Intronic
1104173576 12:126306282-126306304 ATGAAAATTAAGAGGGCTGTTGG - Intergenic
1104308961 12:127636533-127636555 GGGTAAAATAATAGGACTGTGGG - Intergenic
1105642534 13:22280453-22280475 TTTAAAAATAAGTGTACTGAAGG + Intergenic
1106095398 13:26638981-26639003 GTGGAAAATAGGAGGACAGTGGG - Intronic
1106500772 13:30326689-30326711 ATGAAAAATAAGAGAATTTTTGG + Intergenic
1106972848 13:35164260-35164282 GTGAAAAATTATAGAACTGTAGG - Intronic
1107315351 13:39125741-39125763 GTGTCAAATAATAGTTCTGTGGG + Intergenic
1107550884 13:41474185-41474207 GTTAAAAATGAGTTTACTGTAGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108937169 13:55896899-55896921 GTGAAATATAAAAATACTCTTGG + Intergenic
1109405773 13:61897833-61897855 TTGAAAAATAATAGTGCTTTTGG - Intergenic
1109857390 13:68149458-68149480 GTGAGCAATATGAGTACTGCTGG + Intergenic
1110114523 13:71795500-71795522 GTGTAAAATGAGAATGCTGTGGG - Intronic
1110183441 13:72644769-72644791 GAGAAAAGGAAGAATACTGTTGG - Intergenic
1110989930 13:82027239-82027261 GTGAAAAATAAGCTTTTTGTAGG + Intergenic
1111112437 13:83731500-83731522 TTTATAAATAAGAGTCCTGTAGG - Intergenic
1112309128 13:98302376-98302398 GTGAAAAAAAAGATGAGTGTGGG - Intronic
1112694874 13:101936668-101936690 AAGAAAAATAAGAGAACTTTAGG - Intronic
1112868289 13:103936087-103936109 GTGTAAAATAAGATCACAGTGGG + Intergenic
1114747447 14:25165031-25165053 GTCAAAAATGAGTTTACTGTAGG + Intergenic
1114955782 14:27817538-27817560 CTCAAAAGTAAGAGTACTCTTGG - Intergenic
1115134606 14:30094028-30094050 GTGAAAAATTAGTTGACTGTAGG - Intronic
1116547815 14:46192332-46192354 GTCAAAAATGAGTTTACTGTAGG + Intergenic
1116584147 14:46680624-46680646 ATTAAAATTAAGAGTAGTGTAGG - Intergenic
1116587360 14:46724578-46724600 GTGAAAATTAAGAGTTCTTGAGG + Intergenic
1117667416 14:58071074-58071096 GTGAAAAATAAATGTTCTTTTGG + Intronic
1117778353 14:59205826-59205848 GAGATAAATAAGAATACAGTAGG + Intronic
1118245791 14:64109119-64109141 GTCAAAAATAACATTACGGTGGG - Intronic
1118805602 14:69234065-69234087 GTCATAAAGAAAAGTACTGTGGG - Intronic
1120230017 14:81831728-81831750 GAGAACATTAAGAGAACTGTGGG + Intergenic
1122170246 14:99867268-99867290 ATGAAAAAGAAGAATACAGTTGG - Intronic
1126325802 15:47475997-47476019 GTGAAAACAAAGAGAATTGTTGG + Intronic
1126441495 15:48694427-48694449 GTGAGAGAGAAGAGTCCTGTGGG - Intergenic
1126726304 15:51635937-51635959 GTCATAAAGAAGAGTACTTTAGG - Intergenic
1128434665 15:67634565-67634587 GTAAAAAATAACAGAACTGTAGG - Intronic
1128598305 15:68973719-68973741 TTTAAAAATAAAAGTAATGTTGG - Intronic
1130369070 15:83268116-83268138 GTGAAAAATAAAGTTACCGTGGG + Exonic
1131766624 15:95682791-95682813 ATGAAAAATAAATTTACTGTTGG + Intergenic
1131883117 15:96879741-96879763 GTGCAAAAAAAAAGTATTGTAGG - Intergenic
1133878559 16:9758872-9758894 GTGAAAATAAACAGTACTTTTGG + Exonic
1136632657 16:31498043-31498065 GGGAAAAATAACAGAACTGAAGG + Intronic
1139793574 16:69462771-69462793 GTGAAATATAAGGGTACTCATGG - Exonic
1142993641 17:3748284-3748306 GAGAAAAATTAAAATACTGTTGG + Intronic
1144262704 17:13538441-13538463 GTGAAAAATTAGACAATTGTTGG - Intronic
1148002899 17:44400401-44400423 GTGAAAATTAATAGTTCTGATGG + Exonic
1148713094 17:49696171-49696193 GTGAATATGAAGAGAACTGTGGG + Intergenic
1149824605 17:59816504-59816526 GATAAAAAGAAGACTACTGTTGG + Intronic
1150496715 17:65613431-65613453 TTGAAAAGTAAGAGAACAGTTGG + Intronic
1153714485 18:7832909-7832931 GTCAAAAATGAGTATACTGTAGG + Intronic
1154183854 18:12162806-12162828 GTTGAAAATAAGTTTACTGTAGG + Intergenic
1155437996 18:25833187-25833209 GTGAAAAAAAAGAGGCCTGAGGG + Intergenic
1155826858 18:30456086-30456108 ATTAAAAGGAAGAGTACTGTGGG - Intergenic
1156618586 18:38820710-38820732 GTGAAAAAGAACAAAACTGTAGG + Intergenic
1164585476 19:29469713-29469735 TTGAAAAATAAAAGTAAAGTTGG + Intergenic
1164944186 19:32278786-32278808 TTGAAAAATAAGAACAATGTTGG + Intergenic
1164962760 19:32449472-32449494 TTGAAAAAGAAGAGTAAAGTTGG + Intronic
1165340395 19:35207376-35207398 AAGAAAAAGAAAAGTACTGTAGG + Intergenic
1166276835 19:41759754-41759776 GTAAAAAATAAAAGAACTTTGGG - Intronic
1167978804 19:53255163-53255185 GTAAAAAATTAGAGACCTGTGGG + Intergenic
929034552 2:37678161-37678183 TTGAAAAATAAGAGGAATATAGG - Intronic
930202939 2:48561850-48561872 ATAAAAAATAAAAGTAATGTGGG - Intronic
930375507 2:50560765-50560787 TTGAAAAATAAGAGTGTTTTGGG + Intronic
930463512 2:51714333-51714355 GTGAAAAATGAGTTCACTGTAGG + Intergenic
931589261 2:63863753-63863775 GTAATAACTAAGAGTACTGATGG + Intronic
931932309 2:67153035-67153057 GTCAAAAATGAGATTACTGCAGG - Intergenic
932388932 2:71367263-71367285 GTAAAAAATAAGAGAAATGGGGG + Intronic
932791969 2:74661758-74661780 CTGAAAAATAAGTGTACTACTGG - Intronic
934459236 2:94202975-94202997 GTGAAAAATCACAGTAGTCTTGG + Intergenic
934481493 2:94650536-94650558 CTCAAAAGTAAGAGTACTCTTGG + Intergenic
934813039 2:97300166-97300188 GTGAAATATCAGATTGCTGTAGG - Intergenic
934824656 2:97408314-97408336 GTGAAATATCAGATTGCTGTAGG + Intergenic
934934460 2:98454605-98454627 GTGAAAAATAAGAGTACTGTGGG - Intronic
936108385 2:109645131-109645153 CTGAGAAATAAAAGTGCTGTGGG - Intergenic
936885416 2:117305169-117305191 GTTAAAAATGAGTTTACTGTAGG - Intergenic
937531342 2:122830967-122830989 ATGAAAAATAAGAGTAATGAGGG - Intergenic
939039430 2:137170147-137170169 GTTTAAAAAAAGTGTACTGTGGG - Intronic
940314541 2:152313916-152313938 GTCAAAAATAAGTTCACTGTAGG + Intergenic
940990506 2:160091830-160091852 GCCAAAAATAAGAGTACTGATGG - Intergenic
941322939 2:164077882-164077904 GTGAAAAATAACATCACAGTAGG + Intergenic
941552222 2:166931130-166931152 GAGAGAAATAAGATTAGTGTAGG + Intronic
943782679 2:191842299-191842321 GAGCAAAATGAGAGTACTCTTGG - Intronic
943926983 2:193797356-193797378 GAGAAAAATAAAAGTGCAGTGGG - Intergenic
945999671 2:216470890-216470912 ATGAAAAAGAAGAGCAATGTTGG + Intronic
948645820 2:239403524-239403546 GTCAAAAAGAAGAGTAATGAAGG + Intergenic
1169133283 20:3179240-3179262 TAGAAAAATTAGAGTACAGTAGG - Intergenic
1171728363 20:28650085-28650107 GTGGATAATAGGAGTACTTTGGG + Intergenic
1176475712 21:7203010-7203032 GTGGATAATAGGAGTACTTTGGG - Intergenic
1176784725 21:13241393-13241415 ATGAAAAGTAAGAGTGGTGTGGG - Intergenic
1176978232 21:15349339-15349361 GTCAAAAATCAGATGACTGTAGG - Intergenic
1177784708 21:25658809-25658831 GTGAATAAAAATAGTCCTGTGGG - Intronic
1178522073 21:33294793-33294815 GTGAAGATTAAGAGCACTGGTGG + Intronic
1179668962 21:42932175-42932197 GTGAAAAAGAACAGAACTGGAGG - Intergenic
1181868801 22:25881477-25881499 GTGAAAAATTGGAGAGCTGTGGG + Intronic
1184265933 22:43346044-43346066 GTGAAAAATAGGACAGCTGTGGG - Intergenic
949282947 3:2367909-2367931 GAGAAAAATAATAGTACTTACGG - Intronic
949852616 3:8434157-8434179 GAGAAAAATAAGAAAACTGAGGG + Intergenic
951128436 3:19012225-19012247 GTGATAAATAAGAGCCATGTTGG + Intergenic
951281766 3:20759197-20759219 CTGAAAAATAAAAGTTTTGTAGG - Intergenic
951293021 3:20897686-20897708 TTGAAAAATAAGAAAAATGTAGG + Intergenic
951482742 3:23179065-23179087 GTGGAAAATAAAAGTATTCTTGG - Intergenic
951507144 3:23459922-23459944 GTTAACCATAAGAGAACTGTTGG - Intronic
952066020 3:29571564-29571586 GTGAAAAATGAGTTCACTGTAGG + Intronic
955207607 3:56910692-56910714 CTGAAAAATAATAGTACCGGTGG + Intronic
956348457 3:68307073-68307095 GTGAATAATGATAGTATTGTTGG + Intronic
956769933 3:72516640-72516662 GAGAAAAATCAGGGTACTGTTGG + Intergenic
957590400 3:82189730-82189752 GTTACACATAAGAGTGCTGTTGG + Intergenic
958108183 3:89104774-89104796 GTGAAAAACAAGATTTCTGGAGG - Intergenic
958594602 3:96205361-96205383 GTCAAAAATAAGATGACTATAGG - Intergenic
958631589 3:96690482-96690504 GTGAAAAGTAGTAGAACTGTAGG + Intergenic
958806337 3:98815349-98815371 GAGAAAAATAAGAAAACTGAAGG + Intronic
959627531 3:108469701-108469723 GCTAAAAATATGAGCACTGTAGG - Intronic
960808012 3:121602658-121602680 GTGTTAAGTAAGAGTACTGGAGG - Intronic
961002327 3:123382374-123382396 ATGAAAAATAAGATTACCATAGG + Intronic
961022533 3:123521164-123521186 ATCAAAAATAGGAGTAATGTAGG + Intronic
961442203 3:126959797-126959819 GTGAAAAATCAGAGAACAGAGGG + Intronic
962194365 3:133348097-133348119 TTGAAAAACAAGAGTAATGAGGG + Intronic
962661690 3:137607796-137607818 GAGAAAAGAAAGAGTACTGGAGG - Intergenic
963262222 3:143204496-143204518 GTGAAAAATTGGGGTTCTGTTGG - Intergenic
963466222 3:145686004-145686026 GTGTCACATAAGAATACTGTTGG + Intergenic
964403351 3:156322389-156322411 GGGAAAAATAAAAGAACAGTTGG + Intronic
964540584 3:157774984-157775006 TTGAAAAATAAGGGCAGTGTGGG + Intergenic
964936219 3:162091516-162091538 GTGAAAAATGAGTTCACTGTAGG + Intergenic
966929539 3:184666954-184666976 GTGAAAAATAAGACAACGTTTGG + Intronic
967571872 3:191038624-191038646 GTCAAAAATGAGTTTACTGTAGG + Intergenic
968144873 3:196289617-196289639 ATAAAAAATAAAATTACTGTTGG + Intronic
969209439 4:5675546-5675568 TTGAAAATGAAGAGTAATGTGGG - Intronic
969329489 4:6465259-6465281 TTGTAAAATAAGATAACTGTTGG + Intronic
969891795 4:10266743-10266765 GTGTAAGATAAAAGTACTGGTGG + Intergenic
969974364 4:11082803-11082825 GGGAAAAATCAGAGAACTCTGGG - Intergenic
970390553 4:15606806-15606828 CTGAAAAATCACAGTACTCTGGG + Intronic
970854953 4:20640343-20640365 CTGACAAATAAGAGAGCTGTTGG + Intergenic
971218713 4:24685641-24685663 GTGAAAAATAAGAGTCATCTTGG + Intergenic
971991694 4:33906309-33906331 ATGAAAAAAAAAAGAACTGTGGG + Intergenic
972145686 4:36021776-36021798 GAGAAAAATAAGAGAACCATTGG + Intronic
972379621 4:38507161-38507183 GTGAAATTTCAGAGTTCTGTGGG + Intergenic
972970183 4:44565266-44565288 GTCAAAAATCAGATCACTGTAGG - Intergenic
976301394 4:83518880-83518902 GGGATAAATAAGAGTAATGGTGG + Intronic
976415789 4:84773158-84773180 GAGAAAGATAAGAGTAGTGTGGG + Intronic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977239367 4:94548114-94548136 GTGAAAGAACAGAGTACAGTTGG - Intronic
977632500 4:99258746-99258768 GTCAAAGATCAGATTACTGTAGG + Intergenic
978523500 4:109640626-109640648 GAGAGAAATGAGAGAACTGTAGG - Intronic
979121817 4:116912479-116912501 TTGAAAATTAAGATAACTGTAGG + Intergenic
979218268 4:118192573-118192595 GTCAAAAATGAGTTTACTGTAGG + Intronic
979570280 4:122215359-122215381 TTAAAAAATAAGAGATCTGTTGG + Intronic
980413362 4:132452401-132452423 GTCAAAAATGAGTTTACTGTAGG - Intergenic
980838246 4:138224449-138224471 TTGAATAATAAGAATTCTGTAGG - Intronic
982643072 4:157986830-157986852 TTGAAAATTAAGAGTATTTTAGG + Intergenic
982791815 4:159600844-159600866 GTTAAAAAAAAGAGTAGTATGGG - Intergenic
982902616 4:161026271-161026293 TTGAAAAATAAAAGCACTTTTGG + Intergenic
983194573 4:164792820-164792842 TTGAAAAATAAGAGCAAAGTTGG + Intergenic
983237059 4:165191665-165191687 ATGAAAAATAGGAGTCCTGGAGG - Intronic
984576044 4:181449424-181449446 GTGAGTAATAAGAGTATTATAGG + Intergenic
985207591 4:187556113-187556135 GTAAAAAAAATGAGTACTGTGGG - Intergenic
985374438 4:189319683-189319705 GTTAAAAATGAGCTTACTGTAGG + Intergenic
985807230 5:2055025-2055047 GTCAAAAATAAGTAGACTGTGGG - Intergenic
986473583 5:8100391-8100413 ATGAAAAATATGAGTACTACTGG + Intergenic
986602581 5:9487895-9487917 TAGAAAAATAAGAGTTCAGTAGG - Intronic
987632701 5:20495515-20495537 GAGAAAAATAAAAGAACAGTTGG - Intronic
988002869 5:25371905-25371927 GTCAAAAATGAGTTTACTGTAGG - Intergenic
989111510 5:37911104-37911126 GTGAAAAATGAGTTCACTGTAGG - Intergenic
990487921 5:56277526-56277548 GTGAAAAATTACATTGCTGTGGG - Intergenic
990694627 5:58402045-58402067 GTTAAACATAAGAGGCCTGTGGG - Intergenic
991314393 5:65283818-65283840 GTAAAAATTAAGACAACTGTGGG + Intronic
991678491 5:69113430-69113452 CTGAAAATTTAGGGTACTGTAGG - Intronic
992138808 5:73774678-73774700 GTGAATAATGAGTGTATTGTTGG + Intronic
992850606 5:80803846-80803868 GTCAAAAATGAGTGCACTGTAGG + Intronic
992980372 5:82164635-82164657 GTTAAAAATGAGAAAACTGTGGG + Intronic
993405492 5:87507139-87507161 TTGAAAAAGAAGAGTAATTTTGG + Intergenic
993580801 5:89658927-89658949 GTCAAAAATAAGGCTACTGTAGG - Intergenic
993948780 5:94148018-94148040 GTCAAAAATAAGTTCACTGTAGG - Intergenic
994168447 5:96632859-96632881 TTGAAAAATAAGAGCAAAGTTGG - Intronic
995939410 5:117562260-117562282 TTGAAAAAGAAAAGCACTGTTGG + Intergenic
996927945 5:128851235-128851257 GTGAAAAATGAGTTTGCTGTAGG - Intronic
997060378 5:130494242-130494264 GTCAAAAATTAGTTTACTGTAGG - Intergenic
998058345 5:139098293-139098315 GTCAAAAATGAGTTTACTGTAGG - Intronic
998523006 5:142817515-142817537 GTGAAGGATAAGAGGGCTGTTGG + Intronic
1000459870 5:161501294-161501316 GTTAAAAAAAAAAGTGCTGTGGG + Intronic
1001438234 5:171717855-171717877 AGGAAAAATAAGAATACTGTAGG + Intergenic
1002038568 5:176493015-176493037 AGGAAAAATTAGAGTTCTGTGGG + Intronic
1002960745 6:1912764-1912786 GTGAAAAATAAGTGCACACTTGG + Intronic
1003578691 6:7320017-7320039 GTTAAAAATAAGAGCACAGTTGG - Intronic
1004113209 6:12741683-12741705 TTGACAAATAAGAGTAAAGTTGG - Intronic
1005156628 6:22814404-22814426 GTCAAAAATGAGCTTACTGTAGG + Intergenic
1005167031 6:22936745-22936767 GGGAAAGATAAGAGTACCATGGG - Intergenic
1005200680 6:23340963-23340985 GTGCAAAAAAAGGGGACTGTAGG + Intergenic
1006242294 6:32694494-32694516 GTCAAAAATGAGTGCACTGTAGG - Intergenic
1006880691 6:37336509-37336531 AAGAAAACTAAGAGAACTGTTGG - Intergenic
1007205902 6:40150584-40150606 GTAAAGAATAAGAATACTGAAGG - Intergenic
1007944930 6:45817640-45817662 GAGAAAAAGAAGACTACTGGGGG - Intergenic
1008124002 6:47648598-47648620 ATGGAAAATAAGACTTCTGTGGG - Intergenic
1008258720 6:49338010-49338032 CTGAAAAAGAAGAGTACCGTAGG + Intergenic
1008764938 6:54900432-54900454 AGAAAAAATGAGAGTACTGTTGG + Intronic
1009804277 6:68582444-68582466 GTGAAAAATAAGATAATTATTGG + Intergenic
1010280712 6:74019702-74019724 GTCAAAAATAAGTTCACTGTAGG - Intergenic
1010976600 6:82322267-82322289 GCAAAAAATAAGAGTAATCTTGG + Intergenic
1011343607 6:86345574-86345596 GTCAAAAATGAGTGCACTGTAGG - Intergenic
1011941946 6:92853160-92853182 CTGAAAAAGAAGAGTCCTCTTGG + Intergenic
1012355029 6:98303579-98303601 GTCAAAGATTAGATTACTGTAGG + Intergenic
1014093152 6:117428312-117428334 GTCAAAAATGAGTTTACTGTAGG + Intronic
1016884546 6:148947066-148947088 GTGTAAATTAAGAATAATGTGGG + Intronic
1016923868 6:149320585-149320607 TTGAAAAATAAGTATAATGTAGG + Intronic
1017365909 6:153637203-153637225 GTCAAAAATAAGTTCACTGTAGG + Intergenic
1021581041 7:22153698-22153720 TTGAAAAATGTGAGCACTGTGGG - Intronic
1021956251 7:25827585-25827607 GTCAAAAATGAGTTTACTGTAGG - Intergenic
1022988919 7:35687817-35687839 TTGAAATATAAAAGTATTGTTGG - Intronic
1023247627 7:38222244-38222266 GTGAAATATCAGTGTACTGGAGG + Intronic
1023590314 7:41774529-41774551 CTTAAAAATAAGAAAACTGTTGG + Intergenic
1027550071 7:79580783-79580805 GGGAATAATAATATTACTGTTGG - Intergenic
1028384456 7:90238962-90238984 GTGAAATATCAGTGTCCTGTAGG + Intergenic
1030074576 7:105725350-105725372 GTGACAAATTACAGGACTGTTGG + Intronic
1030444620 7:109633595-109633617 GTGAGAAAAAATAGGACTGTTGG - Intergenic
1030589802 7:111466667-111466689 CTTAGAAATAAGAGTACAGTAGG + Intronic
1031405359 7:121379051-121379073 ATGCAAAATAAAAGTTCTGTGGG - Intronic
1031453872 7:121955954-121955976 GTGAAAGATAGGAGGACTTTGGG + Intronic
1031741491 7:125437318-125437340 GTCAAAAATAAGTTTATTGTAGG + Intergenic
1033496517 7:141902678-141902700 GTGAATAATTATAGTACAGTGGG + Intergenic
1033883037 7:145911205-145911227 GTGGACAATTAGGGTACTGTGGG + Intergenic
1034070495 7:148180057-148180079 GAGAAAAAGAAGAGAAATGTTGG + Intronic
1035244110 7:157551323-157551345 GTGAAAAATACCACAACTGTAGG + Intronic
1036078193 8:5524129-5524151 GTGTAAAATCAGAGTGCTCTGGG + Intergenic
1036479540 8:9126316-9126338 TTGTAAAATAACAGTGCTGTAGG + Intergenic
1040430587 8:47337871-47337893 GTGAAAAATTAGTTTACTGTAGG + Intronic
1041532803 8:58890779-58890801 GTTGAAAATGAGAGTAGTGTGGG + Intronic
1042373015 8:68014307-68014329 GAGAAAATAAAGAGTACTCTGGG + Intronic
1042502318 8:69523095-69523117 GTAAAAAAGAAGAGTATTGCTGG + Intronic
1043212804 8:77546263-77546285 GTCAAAAACAAGATAACTGTAGG + Intergenic
1043687321 8:83103419-83103441 CTGATAAATAACAGTCCTGTAGG + Intergenic
1044022717 8:87127101-87127123 TTGAAAAATAAGAGCAATTTTGG - Intronic
1045405033 8:101857430-101857452 GTGAAAAGTCAGAGTTCTGTGGG - Intronic
1046923243 8:119757236-119757258 GTGTAAAATAAGACTACGGAAGG + Intronic
1047478276 8:125256627-125256649 TTAAAAAAGAAGAGGACTGTTGG + Intronic
1050819564 9:9860972-9860994 TTAAAAAATAACAGAACTGTTGG + Intronic
1050912863 9:11095978-11096000 GTGAAAAATATGCATACTGAGGG - Intergenic
1050930856 9:11324320-11324342 CTGAAAAAAAAATGTACTGTAGG + Intergenic
1051022894 9:12567041-12567063 GTGAAAACTAACTGTACTTTAGG - Intergenic
1051038920 9:12782528-12782550 GTGAAAAATGAGTTCACTGTAGG + Intronic
1051517006 9:17940922-17940944 GAGAGAAATAAGAGTAATGCAGG - Intergenic
1052733224 9:32313861-32313883 GTAAAAAATGAGTTTACTGTAGG - Intergenic
1053522603 9:38795946-38795968 TTGAAAAAGAAGAGTAAAGTTGG - Intergenic
1053676342 9:40433571-40433593 CTCAAAAGTAAGAGTACTCTTGG - Intergenic
1053926116 9:43059687-43059709 CTCAAAAGTAAGAGTACTCTTGG - Intergenic
1054194831 9:62020368-62020390 TTGAAAAAGAAGAGTAAAGTTGG - Intergenic
1054287377 9:63191322-63191344 CTCAAAAGTAAGAGTACTCTTGG + Intergenic
1054289409 9:63269096-63269118 CTCAAAAGTAAGAGTACTCTTGG - Intergenic
1054387442 9:64573642-64573664 CTCAAAAGTAAGAGTACTCTTGG - Intergenic
1054508280 9:65942723-65942745 CTCAAAAGTAAGAGTACTCTTGG + Intergenic
1054643577 9:67568322-67568344 TTGAAAAAGAAGAGTAAAGTTGG + Intergenic
1054751537 9:68912156-68912178 GGGAAAAATCAGAGAGCTGTGGG - Intronic
1055342122 9:75294981-75295003 GTGAAAAATGAGTTCACTGTAGG + Intergenic
1056035648 9:82602049-82602071 GTGTAAAATAAGATTTTTGTAGG + Intergenic
1056531448 9:87491981-87492003 TTGAAAAAGAAGAGTACTAGTGG - Intergenic
1057048122 9:91901513-91901535 GTTAAAAATAAAAGTGCTCTGGG + Intronic
1057284568 9:93741180-93741202 GTTCAAAATAAGAGAACTGGTGG + Intergenic
1057409014 9:94799939-94799961 GTGAAAAAATGGAGTACTGTTGG + Intronic
1057484755 9:95473975-95473997 GAGACAAAAATGAGTACTGTTGG - Intronic
1057579296 9:96271986-96272008 GTTAAAAATAAAAGTAATGGGGG - Intronic
1058820404 9:108724149-108724171 GACAAAAATAAGATTCCTGTTGG + Intergenic
1059857199 9:118413018-118413040 GTGGTAAATAAATGTACTGTAGG + Intergenic
1059933454 9:119284092-119284114 GAGAGAAATAAGAGGACTGGTGG - Intronic
1187185397 X:16979955-16979977 GTGACAAATCACAGTACTATTGG + Intronic
1187579041 X:20588980-20589002 GTCAAAAATGAGTTTACTGTAGG + Intergenic
1188027662 X:25227373-25227395 GTCAAAAATAAGTTCACTGTAGG - Intergenic
1188303835 X:28538209-28538231 CTGAAAAATAAAAGCAATGTGGG + Intergenic
1188351036 X:29130991-29131013 GTGATAATTAAGAGCAGTGTTGG + Intronic
1188395091 X:29672799-29672821 AAGAAAAATAAGAGCACGGTTGG - Intronic
1188487004 X:30692936-30692958 GTGATAAATAAGAATACAGATGG + Intronic
1188812432 X:34667358-34667380 GTAAAAAATAAGAAGACTGAAGG - Intergenic
1189192335 X:39121419-39121441 GTGAAAATTTAGAGTATTTTAGG + Intergenic
1189459912 X:41231789-41231811 CAGAAAAATGAGAGCACTGTAGG + Intronic
1193687989 X:84602346-84602368 GTCAAAAATAAATTTACTGTAGG + Intergenic
1193894031 X:87088363-87088385 ATGGAAGATAAGAGTACTTTAGG - Intergenic
1193927763 X:87509875-87509897 TTGAAAAATGAGAATACGGTTGG - Intergenic
1194267511 X:91773446-91773468 CAGAAAAATAAGAATACAGTAGG + Intergenic
1194327466 X:92537720-92537742 GTCAAAAATAAGTTCACTGTAGG - Intronic
1194332899 X:92606313-92606335 GTGAAAAATAAGAACAAAGTTGG + Intronic
1194418347 X:93640739-93640761 GTCAAAAATGAGTTTACTGTAGG - Intergenic
1194495230 X:94608207-94608229 GTCAAAAACAAGTGCACTGTAGG + Intergenic
1194946676 X:100076483-100076505 GTAAAGAATAAGAAAACTGTGGG - Intergenic
1195171797 X:102275964-102275986 GTCAAAAATGAGATCACTGTAGG + Intergenic
1195187063 X:102411129-102411151 GTCAAAAATGAGATCACTGTAGG - Intronic
1195603572 X:106776312-106776334 GTGAAACAAAAGAGGGCTGTAGG + Intronic
1195871870 X:109494761-109494783 GGGAAAAATAAGAGTATGTTTGG - Intergenic
1196305083 X:114092561-114092583 GTCAAAAATGAGTTTACTGTAGG - Intergenic
1196509139 X:116485172-116485194 GTCAAAAATGAGTTTACTGTAGG - Intergenic
1196591698 X:117492846-117492868 GTTAAATATAATAGTACTATAGG - Intergenic
1197126338 X:122950450-122950472 GTCAAAAATGAGTTTACTGTAGG + Intergenic
1197308052 X:124868329-124868351 GTCAAAAATGAGTTTACTGTAGG - Intronic
1197919040 X:131569856-131569878 TTGAAAAATAAGAATAAAGTTGG - Intergenic
1198699980 X:139386094-139386116 GTGAAAAATGAGAGAGGTGTGGG + Intergenic
1199108718 X:143905026-143905048 TTAAAAAATAAGAGTACTGGTGG - Intergenic
1199473909 X:148225130-148225152 GTGAAAACTATGAGTTCTCTGGG - Intergenic
1200008534 X:153104199-153104221 GTGGAAAATAGGATTAGTGTGGG + Intergenic
1200584719 Y:4994385-4994407 CAGAAAAATAAGAGTAAAGTAGG + Intergenic
1200636182 Y:5656939-5656961 GTCAAAAATAAGTTCACTGTAGG - Intronic
1200641595 Y:5725339-5725361 GTGAAAAATAAGAACAAAGTTGG + Intronic