ID: 934937933

View in Genome Browser
Species Human (GRCh38)
Location 2:98478631-98478653
Sequence GACCCTCTTCACAGCCACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 132}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934937933_934937935 -8 Left 934937933 2:98478631-98478653 CCAATGTGGCTGTGAAGAGGGTC 0: 1
1: 0
2: 0
3: 30
4: 132
Right 934937935 2:98478646-98478668 AGAGGGTCCCTGCCCCAGCTGGG 0: 1
1: 0
2: 4
3: 30
4: 248
934937933_934937949 27 Left 934937933 2:98478631-98478653 CCAATGTGGCTGTGAAGAGGGTC 0: 1
1: 0
2: 0
3: 30
4: 132
Right 934937949 2:98478681-98478703 AATGGGAGTAGGAAGGTTGAGGG 0: 1
1: 0
2: 2
3: 28
4: 315
934937933_934937945 10 Left 934937933 2:98478631-98478653 CCAATGTGGCTGTGAAGAGGGTC 0: 1
1: 0
2: 0
3: 30
4: 132
Right 934937945 2:98478664-98478686 CTGGGGAGAATAGGGTGAATGGG 0: 1
1: 0
2: 3
3: 28
4: 304
934937933_934937934 -9 Left 934937933 2:98478631-98478653 CCAATGTGGCTGTGAAGAGGGTC 0: 1
1: 0
2: 0
3: 30
4: 132
Right 934937934 2:98478645-98478667 AAGAGGGTCCCTGCCCCAGCTGG 0: 1
1: 0
2: 3
3: 21
4: 238
934937933_934937947 20 Left 934937933 2:98478631-98478653 CCAATGTGGCTGTGAAGAGGGTC 0: 1
1: 0
2: 0
3: 30
4: 132
Right 934937947 2:98478674-98478696 TAGGGTGAATGGGAGTAGGAAGG 0: 1
1: 0
2: 1
3: 28
4: 342
934937933_934937944 9 Left 934937933 2:98478631-98478653 CCAATGTGGCTGTGAAGAGGGTC 0: 1
1: 0
2: 0
3: 30
4: 132
Right 934937944 2:98478663-98478685 GCTGGGGAGAATAGGGTGAATGG 0: 1
1: 0
2: 8
3: 59
4: 554
934937933_934937940 2 Left 934937933 2:98478631-98478653 CCAATGTGGCTGTGAAGAGGGTC 0: 1
1: 0
2: 0
3: 30
4: 132
Right 934937940 2:98478656-98478678 TGCCCCAGCTGGGGAGAATAGGG 0: 1
1: 0
2: 0
3: 12
4: 227
934937933_934937951 29 Left 934937933 2:98478631-98478653 CCAATGTGGCTGTGAAGAGGGTC 0: 1
1: 0
2: 0
3: 30
4: 132
Right 934937951 2:98478683-98478705 TGGGAGTAGGAAGGTTGAGGGGG 0: 1
1: 0
2: 4
3: 50
4: 546
934937933_934937948 26 Left 934937933 2:98478631-98478653 CCAATGTGGCTGTGAAGAGGGTC 0: 1
1: 0
2: 0
3: 30
4: 132
Right 934937948 2:98478680-98478702 GAATGGGAGTAGGAAGGTTGAGG 0: 1
1: 0
2: 4
3: 41
4: 384
934937933_934937946 16 Left 934937933 2:98478631-98478653 CCAATGTGGCTGTGAAGAGGGTC 0: 1
1: 0
2: 0
3: 30
4: 132
Right 934937946 2:98478670-98478692 AGAATAGGGTGAATGGGAGTAGG 0: 1
1: 0
2: 2
3: 24
4: 339
934937933_934937939 1 Left 934937933 2:98478631-98478653 CCAATGTGGCTGTGAAGAGGGTC 0: 1
1: 0
2: 0
3: 30
4: 132
Right 934937939 2:98478655-98478677 CTGCCCCAGCTGGGGAGAATAGG 0: 1
1: 0
2: 2
3: 26
4: 313
934937933_934937950 28 Left 934937933 2:98478631-98478653 CCAATGTGGCTGTGAAGAGGGTC 0: 1
1: 0
2: 0
3: 30
4: 132
Right 934937950 2:98478682-98478704 ATGGGAGTAGGAAGGTTGAGGGG 0: 1
1: 0
2: 0
3: 32
4: 340
934937933_934937936 -7 Left 934937933 2:98478631-98478653 CCAATGTGGCTGTGAAGAGGGTC 0: 1
1: 0
2: 0
3: 30
4: 132
Right 934937936 2:98478647-98478669 GAGGGTCCCTGCCCCAGCTGGGG 0: 1
1: 0
2: 4
3: 36
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934937933 Original CRISPR GACCCTCTTCACAGCCACAT TGG (reversed) Intronic
901880512 1:12191259-12191281 AAGCCTCTTCACAGCCCCACGGG + Intronic
902552719 1:17228962-17228984 GACCCTCTTCACAGACACTGTGG + Exonic
903016510 1:20365526-20365548 GACCCTCTGCTGAGCCACACTGG - Intergenic
907626859 1:56039038-56039060 GACCCAATTCCCAGCCAGATGGG + Intergenic
910514773 1:88047757-88047779 TTCCCTCTTCACAGGCACACAGG + Intergenic
915021159 1:152779604-152779626 GACAATCTTCTCAGCCACCTTGG + Intronic
915281649 1:154826652-154826674 CACCCTCTGCACAGCCTCAGGGG - Intronic
915716349 1:157948634-157948656 GCCCTTCTTCACAGCCAGAGGGG - Intergenic
915766561 1:158368273-158368295 TACCCTGTTCACAGCAATATAGG + Intergenic
921302590 1:213765059-213765081 CACCCTCTCCACAGCCACCGAGG + Intergenic
921605955 1:217155090-217155112 GACCCTCTTCTCTTCCACCTTGG + Intergenic
1065490157 10:26274692-26274714 CACCCTCTGCACAGCCACTCTGG - Intronic
1072690976 10:97572295-97572317 GACCCTCCTCACAGCCAGCAGGG + Intergenic
1075456978 10:122591233-122591255 TACCCTCTTCTCAGCTACAAAGG - Intronic
1076250642 10:128981344-128981366 GAAGCTCCTCACAGCCACCTTGG - Intergenic
1078727955 11:13949018-13949040 AACCTGCTTCACAGCCTCATTGG - Intergenic
1079433617 11:20422104-20422126 GAATCTCTTCACAGCCACTTGGG + Intronic
1080931724 11:36818351-36818373 AACCCTTTTTGCAGCCACATTGG + Intergenic
1086138339 11:83465528-83465550 GGCCCTCATGACAGACACATTGG + Intronic
1087159876 11:94938226-94938248 AACCCTCTTGACTGCCACATTGG + Intergenic
1087612142 11:100447425-100447447 CACTCTCTTCACAGCCATCTTGG - Intergenic
1090654232 11:128830600-128830622 GATCTTCTCAACAGCCACATGGG + Intergenic
1091267383 11:134281825-134281847 GAGCCTCTGCACAGCCCCATCGG - Intronic
1091275144 11:134344834-134344856 GAGCCTCTGCACAGCCCCATCGG - Intronic
1092110805 12:5962921-5962943 GACCCACTGGATAGCCACATGGG + Intronic
1092819385 12:12339113-12339135 GAGCCTCTTCACAGCCTCTTTGG - Intronic
1094275240 12:28668304-28668326 GGCCCACTTGAAAGCCACATGGG + Intergenic
1094288833 12:28823066-28823088 CACCCACTCCACTGCCACATAGG - Intergenic
1095656267 12:44672717-44672739 GACCCTATTTACAGCCACAATGG + Intronic
1095981190 12:47975691-47975713 GTCCCTCTTCCCAGCCCCATGGG + Intronic
1096713125 12:53472465-53472487 GACACTGTTCACAGTCAAATGGG + Intronic
1097283740 12:57862080-57862102 GACCCCCTCCTCAGCCACAGGGG + Intergenic
1099049410 12:77765219-77765241 GACCCTTTTGCCAGCCACTTTGG + Intergenic
1100129686 12:91476005-91476027 GACCCTCTTCCCACCTTCATTGG - Intergenic
1100807711 12:98304811-98304833 GATCCTCTTCCCATCCTCATGGG + Intergenic
1102686845 12:114731621-114731643 AACCCTATGCTCAGCCACATCGG - Intergenic
1103868989 12:124077482-124077504 GACCCACTTCTCAGCCTCTTTGG - Intronic
1105534924 13:21257139-21257161 AGCCCTCTTCACATCCATATTGG - Intergenic
1106307093 13:28522357-28522379 GACACTCTTCACAGCCTTGTGGG - Intergenic
1108058938 13:46514097-46514119 AACCCTGTTCTCAGCCACAATGG - Intergenic
1110669686 13:78162496-78162518 GATCCCCTGCACAGCCACATCGG - Intergenic
1111824815 13:93254216-93254238 GATCCTCTTCTCAGCCTCTTCGG - Intronic
1119652351 14:76392738-76392760 GACCCTCTCCACAGCCATACTGG - Intronic
1120443079 14:84562746-84562768 AACCCTCTTCCCAGCTACAGTGG - Intergenic
1121060196 14:90900660-90900682 GACCCTCTTCAGTTTCACATGGG - Exonic
1122694868 14:103547602-103547624 GACCACCTGCATAGCCACATTGG + Intergenic
1123783657 15:23647817-23647839 GAGCCTCTGAACAGCCACGTAGG - Exonic
1126102770 15:45129719-45129741 CACCCTCTCCCCAGCCCCATGGG + Intronic
1126170087 15:45688081-45688103 GTCCCTCCTTACAGCCACACTGG + Intronic
1128245183 15:66127990-66128012 GTCCCTGTCCACAGCCAGATGGG - Intronic
1131404665 15:92154586-92154608 GACCCTCTTTCCAGACACTTGGG + Intronic
1131642688 15:94309533-94309555 GACCCTTCAGACAGCCACATGGG + Intronic
1132496659 16:266607-266629 GCCCCGCTTCAGAGCCACACAGG + Intronic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1133403489 16:5505493-5505515 GACTCTCTGCCCACCCACATAGG - Intergenic
1142009891 16:87708605-87708627 GACCCCCTTCAGATCCACAAAGG + Intronic
1142354087 16:89593878-89593900 GACCCGCTTCCCAGCCACACAGG - Intronic
1143172994 17:4940771-4940793 GTCCCACTTCCCAGCTACATGGG - Exonic
1145977483 17:28992745-28992767 GCCCCTGGTCACAGCCTCATGGG - Intronic
1146446573 17:32937124-32937146 GACCCTCTGCTCAGGCACGTCGG - Intronic
1152879123 17:82805366-82805388 AGCCCTCTTCACACCCACATGGG - Intronic
1153974361 18:10254429-10254451 GACCCTCTTCACCACCATATAGG + Intergenic
1155403558 18:25463760-25463782 GACTCTCTTCCCAACCACACTGG - Intergenic
1155520892 18:26667974-26667996 GAACATCTTCACAGCCTAATTGG + Intergenic
1159184371 18:64949743-64949765 GACCCTCCTCGCATCAACATTGG - Intergenic
1161901886 19:7125364-7125386 GACCGTCTTCACCGCCACGCGGG + Exonic
1163653670 19:18533096-18533118 GACCCTCATGACGGCCACACAGG - Intronic
1163821325 19:19498113-19498135 GAACCTGGTGACAGCCACATGGG + Intronic
1163831676 19:19550061-19550083 CACCCTCAGGACAGCCACATAGG + Intergenic
925033305 2:668420-668442 GTCCCACTTCTCAGCCACAAAGG + Exonic
925225544 2:2181301-2181323 GTCTCACTTCACAGACACATAGG - Intronic
927809861 2:26174890-26174912 CCCCATCTTCACAGCCACATGGG - Intronic
929660585 2:43780350-43780372 AATCTTCTTCACACCCACATGGG - Intronic
933237676 2:79882954-79882976 GGCCCACCTCAGAGCCACATGGG - Intronic
933523938 2:83411749-83411771 GAACCTCTTCAAAGCCACTTAGG + Intergenic
934937933 2:98478631-98478653 GACCCTCTTCACAGCCACATTGG - Intronic
940592486 2:155747983-155748005 GGCCCACCTGACAGCCACATGGG + Intergenic
944020164 2:195093438-195093460 AACCATTTTCACAGCCACAGTGG - Intergenic
946202732 2:218080389-218080411 GTCCGTTTTCACAGCCCCATGGG - Intronic
946527851 2:220539849-220539871 GACCCACTTCACGGCTAGATAGG + Intergenic
1172290363 20:33771640-33771662 GACCCTCTTCATGACCACAATGG - Intronic
1172397239 20:34617206-34617228 GACCCTCTTCTCAGCTCCACTGG - Intronic
1174076444 20:47940850-47940872 GATCCTCTCAACAGCCTCATCGG - Intergenic
1174677384 20:52371632-52371654 GACCCTCATCACTGCAACAGAGG + Intergenic
1175964572 20:62654110-62654132 GACCCTCCTCAGAGCCCCAGGGG - Intronic
1178315858 21:31566299-31566321 GAGCCTGTTCACAGCCAAGTGGG - Intergenic
1179177749 21:39021360-39021382 GACTCTCTTCACAGCAATCTGGG + Intergenic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1182089385 22:27583738-27583760 GACCTTCTTCCCAGCCAGGTAGG - Intergenic
1183293728 22:37018261-37018283 GGCCGTCTTCAAAGCCACACTGG - Exonic
1183571453 22:38656438-38656460 CACCCTCTCCACTGACACATTGG - Intronic
1183675200 22:39295205-39295227 GACCATCCTCACAGCCTCAGGGG - Intergenic
1183714342 22:39525047-39525069 GACCCTCCTCACAGCCTCTCAGG - Intergenic
1184490230 22:44804093-44804115 CACCCTCCTCAAAGCCACATGGG + Intronic
1184858306 22:47158539-47158561 CACCCTCTGCACAGCCCCGTGGG + Intronic
949490294 3:4582477-4582499 GTCCATCTTCACACCCACACCGG - Intronic
950448338 3:13051271-13051293 GTCCCACTTCACAGCCTCCTGGG + Intronic
953840277 3:46384577-46384599 GACACTGTTCACAGTAACATAGG - Intergenic
954801648 3:53190496-53190518 CACCCTCTTCTCTGCCACCTGGG - Intronic
957034976 3:75285625-75285647 TTTCCTCTTCCCAGCCACATCGG - Intergenic
957247566 3:77733780-77733802 GACCCACTTTACAGCTAGATGGG + Intergenic
957401384 3:79719544-79719566 GACCATCTTCCCACCAACATTGG - Intronic
962142647 3:132806494-132806516 GACCCTCTTCTCGGCAACACTGG + Intergenic
962906765 3:139810668-139810690 GACTTTCTCCACAGCCACAGAGG + Intergenic
965263231 3:166510335-166510357 GACCCACCTGAGAGCCACATGGG + Intergenic
969282344 4:6179199-6179221 CACCCTCTCTCCAGCCACATAGG - Intronic
977836160 4:101648064-101648086 GACACTCTTCCCAGCTCCATGGG - Intronic
986826019 5:11523849-11523871 CACCCGCTTCACAGCAACATGGG - Intronic
988059411 5:26148447-26148469 GACCCACCTGAGAGCCACATGGG + Intergenic
990129611 5:52564922-52564944 GTCCCTGCTCACAGCCACAGTGG - Intergenic
995594310 5:113731460-113731482 GGCCCACCTGACAGCCACATGGG - Intergenic
997426292 5:133804981-133805003 GACCCTCTTCACAGCCCCTCAGG + Intergenic
998398213 5:141833336-141833358 GCCACTGTGCACAGCCACATGGG - Intergenic
998764660 5:145472324-145472346 GATGCTCTCCACAGCCCCATAGG + Intronic
999384894 5:151147120-151147142 GAACCTAGTCTCAGCCACATGGG + Intronic
1001065572 5:168532689-168532711 GCCCCTCCTCAGAGCCAGATGGG + Intergenic
1001517478 5:172366037-172366059 CACCCACTTCACAGCCAGGTTGG + Intronic
1001691496 5:173636026-173636048 GTCTCTCTTCTCAGCCAGATTGG + Intergenic
1003372173 6:5539078-5539100 GTCCCTACTGACAGCCACATGGG + Intronic
1003376301 6:5580793-5580815 AGCCCTCTTCACGTCCACATTGG + Intronic
1005151482 6:22756833-22756855 GACACTCCTCACAGACACATGGG + Intergenic
1005170520 6:22980197-22980219 GTCCCACTTCAGAGCCACATGGG + Intergenic
1006366117 6:33616372-33616394 TACCCTCTTGCCAGCTACATGGG - Intergenic
1006408339 6:33857784-33857806 GACCCCCTTCCCAGGCACCTTGG - Intergenic
1010088416 6:71949570-71949592 TACCCTCTTCACAGACATATAGG + Intronic
1011475097 6:87743885-87743907 CACCCTCTAAACTGCCACATAGG - Intergenic
1014633944 6:123821666-123821688 GTCCCTCTACACACCCACAGTGG - Intronic
1018650899 6:165990366-165990388 CACTCTATTCTCAGCCACATGGG + Intergenic
1020028701 7:4918015-4918037 GGCTGTCTTCACAGCCACATGGG - Intronic
1021613160 7:22477007-22477029 CACTTTCTTCAAAGCCACATAGG + Intronic
1022593829 7:31692502-31692524 GACCCTCGTTGCAGCCACTTAGG + Exonic
1024762753 7:52619778-52619800 GTCCATCTTCACAGCCAAATTGG - Intergenic
1026878578 7:73893926-73893948 GACCCTCTTCACAGACTCCTTGG + Intergenic
1027169004 7:75856883-75856905 GAACCTCTTCCTAGCCCCATGGG + Intronic
1030036749 7:105414299-105414321 GAGCATGTTCACAGACACATAGG - Intergenic
1031282240 7:119818930-119818952 GGCCCTCTTCACAGCTCCACTGG - Intergenic
1031947527 7:127857656-127857678 GAACCTCTCCACAGCCCCTTTGG - Intronic
1032667579 7:134052105-134052127 GACCCTTTTCATAGACACATTGG + Intronic
1034443786 7:151101483-151101505 CAGCCTCTTCCCAGCCACCTGGG - Intronic
1037453654 8:19041861-19041883 AACCCTCTGTAAAGCCACATAGG - Intronic
1037508768 8:19560567-19560589 GACCCACTTCACACACACAAGGG + Intronic
1037943899 8:22974565-22974587 GACCTTAGTCACTGCCACATTGG + Intronic
1039547048 8:38417874-38417896 CAACATCTTCACAGCCACTTTGG + Exonic
1042367859 8:67957037-67957059 GACCCTCTTATGAGCCAGATGGG - Intronic
1044466330 8:92511172-92511194 GACCCTCTTCATGCCCACATAGG + Intergenic
1049560403 8:143307362-143307384 CACCCTCTTCTCTGCCACGTGGG - Intronic
1049619684 8:143592440-143592462 GACCCTGCTCACGGCCACACAGG + Intronic
1050176383 9:2873447-2873469 GGCACTCTTTACAGCCACCTAGG + Intergenic
1055536272 9:77248611-77248633 TACCCACTTCCCAGCCACATGGG + Intronic
1058036974 9:100263460-100263482 CTCCATCTTCAAAGCCACATTGG + Intronic
1058162839 9:101588428-101588450 AAGCATCTTCACAGCAACATGGG - Intronic
1058839530 9:108892570-108892592 GATCCTCTTAACAGCCTCATAGG - Intronic
1060031900 9:120221912-120221934 GACCCTCTCCACTGCTACAGTGG + Intergenic
1061890837 9:133618284-133618306 GACCCTCCTCCCACCCACGTGGG + Intergenic
1185596228 X:1308597-1308619 CGCCCTCTTCTCTGCCACATAGG + Intronic
1187922901 X:24223147-24223169 TACACTCTTCACAGCAAAATTGG + Intergenic
1189848631 X:45158107-45158129 GCCCCTCTTCCCAGCCACAGGGG - Intronic
1190032110 X:46983820-46983842 GACCCTCTTCCCAGCAAAATTGG - Intronic
1194375295 X:93125165-93125187 GCCTCTCATCATAGCCACATTGG - Intergenic
1194445796 X:93986289-93986311 GACCCACCTGAGAGCCACATGGG + Intergenic
1196284600 X:113864274-113864296 GACCCACCTGAGAGCCACATGGG - Intergenic
1198153288 X:133932369-133932391 GTCCCTCTTAAAAGCAACATAGG + Intronic
1198948657 X:142043650-142043672 GACCCTATGCACAGCCAGAATGG - Intergenic