ID: 934938946

View in Genome Browser
Species Human (GRCh38)
Location 2:98485942-98485964
Sequence CTGCTTGTTCAAATAAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934938942_934938946 -6 Left 934938942 2:98485925-98485947 CCAGACACTCTTCTTTACTGCTT 0: 1
1: 0
2: 1
3: 28
4: 286
Right 934938946 2:98485942-98485964 CTGCTTGTTCAAATAAGGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934938946 Original CRISPR CTGCTTGTTCAAATAAGGGG AGG Intronic
902557192 1:17253944-17253966 CTGCTTTGTCAAATCAGGGAGGG - Intronic
907904708 1:58773705-58773727 CTTCTTGGTCATATAAGGGCTGG - Intergenic
913443059 1:118919769-118919791 TTGATTGCTCAAATAATGGGAGG - Intronic
914813067 1:151043639-151043661 CTGCTTGTTCATTTGAGTGGAGG + Exonic
916075294 1:161197093-161197115 CAGCTGGTTCTAAGAAGGGGAGG + Intronic
917209586 1:172617837-172617859 CTGCGGGTTCAAAAAAGTGGTGG + Intergenic
919213799 1:194523872-194523894 GTGGTTGTTCAAATAACTGGTGG - Intergenic
920729955 1:208474089-208474111 GTGCCTGTTCAAGGAAGGGGAGG - Intergenic
1063632961 10:7751339-7751361 TTGCTTTTTCAAATATGGGTTGG - Exonic
1076290156 10:129339880-129339902 CTGTTTTTTCAAGAAAGGGGAGG - Intergenic
1082677546 11:56125966-56125988 CTGCTTGAACAAGTAAAGGGTGG - Intergenic
1085236141 11:75017100-75017122 CAGCATCTTCATATAAGGGGTGG - Intronic
1086038794 11:82449589-82449611 CTGTTTTTTCAAATGAGGGTTGG - Intergenic
1095344346 12:41132079-41132101 CTTTTTTCTCAAATAAGGGGAGG + Intergenic
1098231288 12:68374264-68374286 CTACTTCTTCAAATGAGGGAGGG - Intergenic
1098817013 12:75178857-75178879 CTCCTTGTTCAAAGAGGTGGGGG + Intronic
1099438914 12:82676967-82676989 CAGCTTCTTGAAATAAGGGTTGG + Intergenic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1102324206 12:111965145-111965167 CGGCTTGTATAAATAAGGGAAGG + Intronic
1102394942 12:112577330-112577352 CTACTTGGTCTAAAAAGGGGAGG - Intronic
1107812133 13:44210567-44210589 CTGCTTCTTCAAACAAGTGTAGG - Intergenic
1109389057 13:61669899-61669921 CTGAAGGTTCAAATAAGTGGTGG - Intergenic
1110241109 13:73268343-73268365 ATGGTTGTTCAAATATGGGTGGG - Intergenic
1110255547 13:73429881-73429903 CTGCATGTTCAGACAAGGAGTGG - Intergenic
1110391455 13:74979820-74979842 CGGATTGTTCAAAGAAGGGCAGG + Intergenic
1115465467 14:33709773-33709795 CTGCTTCACCAAATAAGAGGAGG + Intronic
1121260929 14:92565518-92565540 TTTCTTGATCAAACAAGGGGTGG + Intronic
1126785255 15:52173381-52173403 CTGCTTTTTATAATAAGGGAAGG + Intronic
1131022796 15:89113858-89113880 CTGCTTCCTAACATAAGGGGAGG - Intronic
1132251332 15:100337613-100337635 CAGCTTTTTCCAAGAAGGGGTGG + Intronic
1132266692 15:100479384-100479406 CTTGGTGTTCAAGTAAGGGGAGG + Intronic
1133673269 16:8045177-8045199 CTACTTGGTCCAAAAAGGGGAGG + Intergenic
1135787186 16:25360725-25360747 ATGCTTTTTCTAAAAAGGGGAGG - Intergenic
1140602221 16:76490909-76490931 CTGCTTGTCCTAAGAAGGGCTGG + Intronic
1144810872 17:17998115-17998137 CTGCTTGCTCAGGTGAGGGGTGG - Intronic
1145760722 17:27424249-27424271 TTTCTTGTTCCAAGAAGGGGTGG - Intergenic
1159784172 18:72694087-72694109 CTGAAGGTTCAAACAAGGGGAGG + Intergenic
1161814755 19:6493236-6493258 CTACATGTTCTAAAAAGGGGAGG + Intergenic
1162700072 19:12507856-12507878 CTGCTTGTTCATTTAATTGGAGG + Intronic
1165304883 19:34997532-34997554 CTGCTTGTTCTATTCAGGGTCGG - Intronic
1167350303 19:48969994-48970016 CTGCTTATCTACATAAGGGGTGG - Intronic
928956902 2:36878606-36878628 CTACTTGTTGACCTAAGGGGTGG + Intronic
930957535 2:57220629-57220651 CTGCCTGTTCAAATATGTAGTGG - Intergenic
931085065 2:58820765-58820787 CTCATTGTTCAAATAAGAGAGGG - Intergenic
931762726 2:65431790-65431812 CTGCTTGTTGAAGTGAGGAGAGG - Intronic
933503993 2:83154751-83154773 CCAATAGTTCAAATAAGGGGAGG - Intergenic
933891978 2:86780498-86780520 CTGCTTCTCTAAATAATGGGAGG - Intergenic
934888588 2:98046459-98046481 CTGTATGGTCTAATAAGGGGAGG + Intergenic
934938946 2:98485942-98485964 CTGCTTGTTCAAATAAGGGGAGG + Intronic
936429656 2:112451182-112451204 CTGCATGGTCTAAAAAGGGGAGG - Intergenic
942931743 2:181502134-181502156 CAGCTTGATCAAATAAGATGAGG + Intronic
947102282 2:226634022-226634044 CCGATAGGTCAAATAAGGGGAGG - Intergenic
1170304422 20:14922372-14922394 ATGCTTGTCTAAATTAGGGGTGG - Intronic
1171447533 20:25215393-25215415 CTGCTTCTTCCAAAAAGAGGAGG + Intronic
1172388078 20:34547919-34547941 CTGATTGTTCAGATAGGCGGGGG + Intronic
949507455 3:4740765-4740787 CTCCTTGTTCCCATAAGCGGAGG - Intronic
952715868 3:36480518-36480540 CTGGATGATAAAATAAGGGGGGG - Intronic
955863630 3:63358428-63358450 CTGCTTCTTCTAATAAGGACAGG + Intronic
957574300 3:81988236-81988258 CTGAAGGTTCAAAGAAGGGGTGG + Intergenic
957625035 3:82645068-82645090 ATGCTTGTCCAAACAAGTGGGGG - Intergenic
958519079 3:95160392-95160414 CTGCTTATTCCAATAGAGGGTGG + Intergenic
959185776 3:103046055-103046077 CTGTTTGTTCAAATCAGAGTAGG + Intergenic
960472021 3:118077202-118077224 CTTCTTGTTTAAATAAGGTATGG - Intergenic
960674390 3:120180609-120180631 CTGCTTTTTACAATAAGGAGAGG - Intronic
962608380 3:137051502-137051524 CTGATTCCTCAAATAATGGGTGG + Intergenic
964386900 3:156157087-156157109 CTGCTAGGTCAAGTAAGGTGAGG + Intronic
964817097 3:160728864-160728886 TTGCTTGACCAAATGAGGGGAGG + Intergenic
967884475 3:194323754-194323776 CTGCTTGTATAAATAGGAGGGGG + Intergenic
969495082 4:7521896-7521918 CTGCGTCTTCAAGCAAGGGGTGG + Intronic
977892284 4:102326228-102326250 CTGCTTCTTCAACTCAGGGCTGG + Intronic
978436983 4:108696025-108696047 CTGCTAGGTCAAGTAAGGTGAGG + Intergenic
979093295 4:116515648-116515670 GGGCTTGTTCAAATAAGTGTGGG + Intergenic
981525978 4:145707462-145707484 GTGCTTGTCCAAATAAGTGTGGG + Intronic
983064767 4:163195456-163195478 CTGCATGTGCTAAAAAGGGGAGG + Intergenic
984118726 4:175715058-175715080 CTGCTTGTTCAGATAATGTCTGG + Intronic
992973789 5:82090581-82090603 CTGGTTGTCTAAATAAGGGGTGG + Intronic
999864322 5:155684319-155684341 CTGCTTGACCAGATCAGGGGTGG + Intergenic
1001651836 5:173321213-173321235 CTTCTTCTTAAATTAAGGGGAGG + Intronic
1003962204 6:11219268-11219290 CTGCTTTTCCAAATACGGAGAGG + Intronic
1006261220 6:32873001-32873023 CTGCATGTTCTCATAAGTGGGGG - Intergenic
1013099864 6:106976996-106977018 CTGCTTGTTGAACTAACTGGTGG + Intergenic
1013612163 6:111805696-111805718 CAGCTTGTTCAACCAAGGGAAGG - Intronic
1019564264 7:1671742-1671764 ATGCTTGTTCAATTAAAAGGTGG - Intergenic
1021116498 7:16751284-16751306 CTGCTTGTTCTTATTAGGGTGGG + Intergenic
1022193921 7:28045137-28045159 TTGCTTCTTCAAAGAAGGTGAGG + Intronic
1023359056 7:39397163-39397185 CTGCCTGTGCAACTAAGAGGAGG + Intronic
1023550649 7:41366822-41366844 CTGCATGTTCTCATAAGTGGGGG + Intergenic
1025115969 7:56258402-56258424 CTTCTTGTTCCAAAAAAGGGAGG - Intergenic
1030092427 7:105869251-105869273 CTGCTTGTTAGCAAAAGGGGAGG + Intronic
1031315115 7:120247008-120247030 CTGCTTGTTCCAAGATGGAGAGG + Intergenic
1034921724 7:155088580-155088602 CCACTGGTGCAAATAAGGGGAGG + Intergenic
1043957556 8:86378947-86378969 CTGATTTTTCAAGTAAGGGATGG + Intronic
1044002293 8:86898051-86898073 CTATTTGTTCAAATATGGGCAGG + Intronic
1045808629 8:106195180-106195202 ATGCGAGTTCAAATAAAGGGAGG - Intergenic
1047762365 8:127963579-127963601 CTGCTGCTTCAAAAAAAGGGTGG - Intergenic
1047904728 8:129460544-129460566 GCACTTGTTCAATTAAGGGGTGG + Intergenic
1051170209 9:14313927-14313949 ATGCTTTTTCAAAAAAGGCGGGG + Intronic
1053396835 9:37783035-37783057 CAGCATGTGCAAATAAGGGCAGG + Intronic
1054705761 9:68460399-68460421 CTGTTTGATCACATAAGGGTAGG + Intronic
1056105594 9:83343415-83343437 CTGCTTGTTCTACAAAGGGCTGG - Intronic
1185769566 X:2755328-2755350 CTGCATGGTCTAAAAAGGGGAGG - Intronic
1188390012 X:29608521-29608543 CAGCTTCTTAAAATAAGAGGAGG + Intronic
1196391472 X:115211319-115211341 CTGCTGGTTTTAAAAAGGGGAGG + Intronic
1200697335 Y:6372506-6372528 CTGCTTGTTCAATTCAGGGAAGG + Intergenic
1201036778 Y:9792193-9792215 CTGCTTGTTCAATTCAGGGAAGG - Intergenic
1201300945 Y:12504301-12504323 CTGCATGGTCTAAAAAGGGGAGG + Intergenic