ID: 934941042

View in Genome Browser
Species Human (GRCh38)
Location 2:98502189-98502211
Sequence AAGGAATGCTCTCTCTCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934941042_934941045 1 Left 934941042 2:98502189-98502211 CCAGATGAGAGAGAGCATTCCTT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 934941045 2:98502213-98502235 TGCCAGAGGCCTGCCCACAGTGG 0: 1
1: 0
2: 15
3: 63
4: 415
934941042_934941050 21 Left 934941042 2:98502189-98502211 CCAGATGAGAGAGAGCATTCCTT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 934941050 2:98502233-98502255 TGGCTCCACTGTCAGTGTCCTGG 0: 1
1: 0
2: 4
3: 21
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934941042 Original CRISPR AAGGAATGCTCTCTCTCATC TGG (reversed) Intronic
902146453 1:14404872-14404894 AAGGAATGCTATCTAACACCTGG + Intergenic
902193872 1:14783559-14783581 AAGATATGCTCTCTGTCCTCAGG + Intronic
902629600 1:17696851-17696873 AAGGCATGGTCTCACTCAACGGG + Exonic
906025906 1:42673497-42673519 AAGGAAAGCTCTCTACCATTTGG - Intronic
911653945 1:100421966-100421988 CAGTAATGCACTCACTCATCAGG + Intronic
912211940 1:107566078-107566100 AAGGAATTCTGTCTCTCGTTCGG - Intergenic
912396806 1:109351635-109351657 AAGGAAGGCTCTCTGTGAGCTGG - Intronic
912420433 1:109539071-109539093 CAGGAATGCTCACACTGATCTGG - Intergenic
912763872 1:112391323-112391345 AAGAAATGCTTTCTTTCTTCTGG - Intergenic
913019263 1:114770627-114770649 AAGAAATGCTCTGCCTCATTAGG + Exonic
922076081 1:222246086-222246108 AAGGTATACTCTCTATTATCAGG - Intergenic
922576944 1:226667205-226667227 AAGGAATGCTCACTCTAGTGGGG - Intronic
923645248 1:235813974-235813996 AAGTCATCATCTCTCTCATCTGG - Intronic
924234738 1:241991158-241991180 AACAAATGCTCTCTCTCAGCGGG + Intergenic
924920261 1:248621538-248621560 GAGGAATGATTTGTCTCATCCGG + Intergenic
1063666986 10:8068344-8068366 AAGGAATGTTGCCACTCATCAGG - Intronic
1065700881 10:28424252-28424274 AAGGAAGCATCTCTCTCCTCAGG - Intergenic
1065897869 10:30180355-30180377 AAGGGATGCTCTTACACATCCGG + Intergenic
1068939281 10:62664923-62664945 AGGGAATACTCTCTCTCTTTGGG - Intronic
1072830687 10:98655187-98655209 GGGGAATGCCCTTTCTCATCTGG + Intronic
1078022577 11:7668138-7668160 AAAGACTGCTCTCTTTCTTCAGG + Intronic
1080000924 11:27348478-27348500 AATAAATGTTCTATCTCATCTGG - Intronic
1080021658 11:27566901-27566923 CAGATATGCTCTCTCTAATCAGG - Intergenic
1080500086 11:32862361-32862383 ATGGGATGTTGTCTCTCATCTGG + Intergenic
1081226231 11:40526029-40526051 AAGGAATGTTTTCTTTCATATGG - Intronic
1083940955 11:65895552-65895574 GTGAAATGGTCTCTCTCATCTGG - Intronic
1085937197 11:81161890-81161912 TAGGAATGCTCTCTGACATTGGG + Intergenic
1087151841 11:94866806-94866828 AAGAAGTGCTCTCTCGCATAAGG + Intronic
1089167670 11:116489585-116489607 CAGGAATGCTCTGTCTGATTAGG - Intergenic
1090309041 11:125718562-125718584 AAGGAATGCTCTGTGACATTAGG + Intergenic
1092802797 12:12187380-12187402 AAGCAGTGCTCTCTCTCTGCCGG - Intronic
1093803837 12:23408172-23408194 AAAGCCTTCTCTCTCTCATCAGG - Intergenic
1095262437 12:40111958-40111980 AAGGAATGCTCTCATTAAGCAGG + Intergenic
1097102066 12:56596936-56596958 AAGGAATGCTCCACCTCACCTGG + Exonic
1098384716 12:69906798-69906820 AGGGAAGGCTATCTGTCATCTGG - Intronic
1099959027 12:89379207-89379229 AATCAAGGCTCTCTCTCCTCAGG - Intergenic
1102255975 12:111415246-111415268 AAGAAATGCTCTCCCTACTCAGG - Intronic
1102279577 12:111608376-111608398 AAGGATTGCTCTAGCTCAGCGGG - Intergenic
1104248839 12:127070080-127070102 AAGCAATCATCTCTCTCATCAGG - Intergenic
1104529347 12:129554218-129554240 GAGGACTGCCCTTTCTCATCTGG + Intronic
1104574282 12:129952583-129952605 AAACAATGGTCTCTTTCATCTGG - Intergenic
1104952004 12:132445372-132445394 AGTGAATGCTCTCTGTCAGCAGG - Intergenic
1106873071 13:34042857-34042879 TTGGAATGCTCTTTCTCATGAGG - Intergenic
1109475497 13:62876041-62876063 AAGAAATGCTCATTCTCCTCAGG + Intergenic
1110620421 13:77588155-77588177 AAGGAAGGCTCTCTGTGAGCTGG - Intronic
1110703845 13:78581265-78581287 AAGGACTGGTCTTTCTCTTCAGG - Intergenic
1111644504 13:91014316-91014338 AGTGAATGCTCTCTCACAGCTGG - Intergenic
1112149756 13:96745417-96745439 AAGTGATGACCTCTCTCATCTGG + Intronic
1113550263 13:111187365-111187387 CAGGAACGGTCTCCCTCATCAGG - Intronic
1113898228 13:113779343-113779365 AAGGACCACTCTCTCTCAGCAGG - Intronic
1114203407 14:20544423-20544445 AAGGAATGCTCATACTCAGCTGG - Intergenic
1117993888 14:61460770-61460792 ATGGCATGCTCTCTGTCATTTGG + Intronic
1118082978 14:62382975-62382997 AAGGTGTGCTTTCTCTCTTCCGG + Intergenic
1118153641 14:63216550-63216572 AGGCTATGCTCTCTCTCCTCAGG + Intronic
1119954912 14:78787257-78787279 AAGGATTTATCTCTCTGATCTGG + Intronic
1120349105 14:83330037-83330059 AAGGGATACTCTCTCTCCTTTGG + Intergenic
1124422301 15:29533525-29533547 AAGAAATGCTATTTCTCACCAGG - Intronic
1124915770 15:33971881-33971903 AAAGATTGTTCTCTCTCAGCAGG - Intronic
1129482877 15:75842378-75842400 ATTGAATGCTCGCTCTTATCTGG - Intergenic
1130096622 15:80860951-80860973 GAGGAAAGCTCTCTCTGATAAGG - Intronic
1130100102 15:80886892-80886914 AAGGAAGGCCCTCTCACATAAGG + Intronic
1130878289 15:88032822-88032844 ATGGAATGCTCTCCCTCCTGGGG - Intronic
1135648586 16:24185724-24185746 AAAAAAAGCTCTCTCTCCTCCGG - Intronic
1137291397 16:47054450-47054472 AAGCCATGCCCTCGCTCATCCGG + Intergenic
1137518169 16:49168451-49168473 AAGGTAAGCTCTCTTTCTTCTGG - Intergenic
1137934211 16:52618217-52618239 AGTGAATGCTCTCTCTCTTCTGG + Intergenic
1138303951 16:55957282-55957304 AATGAATGCACTTTGTCATCTGG + Intergenic
1141327296 16:83073290-83073312 AAGGAATGGGCTCTCTCTTTGGG + Intronic
1145178808 17:20726623-20726645 AAGAAATGCTGCTTCTCATCTGG + Intergenic
1145774254 17:27516421-27516443 ATGGATTGATCTCTCTCATCAGG - Intronic
1146175456 17:30663491-30663513 AAAGAATGCTGTCTGTCATTTGG - Intergenic
1146348907 17:32079537-32079559 AAAGAATGCTGTCTGTCATTTGG - Intergenic
1150585822 17:66516849-66516871 AAGAAATGCTAGCTCTGATCTGG + Intronic
1152628043 17:81397166-81397188 AAGAAAAGCTCTCTCCAATCCGG + Intronic
1153979506 18:10297166-10297188 AAGGGATCCTCTTTCTCATTGGG - Intergenic
1154158396 18:11961101-11961123 ATGGAAAGCTCTTTCTCTTCTGG - Intergenic
1156498106 18:37539044-37539066 AAGCAATCCTCGGTCTCATCAGG + Intronic
1157421013 18:47547525-47547547 AAGGAACGGTGTCCCTCATCTGG + Intergenic
1157976362 18:52332044-52332066 AATGAAGGCTCTCTCTGAACAGG + Intergenic
1158002690 18:52637055-52637077 AGTGATTGCTCTCTCTCTTCTGG - Intronic
1159032426 18:63245048-63245070 AAGGAATGCACCCACTCTTCGGG + Intronic
1166432752 19:42740950-42740972 AAGGAAGGTTCCCTCTCATCAGG - Intronic
1166435861 19:42766178-42766200 AAGGAAGGGTCCCTCTCACCAGG - Intronic
1166448724 19:42880166-42880188 AAGGAAGGGTCCCTCTCACCAGG - Intronic
1166453131 19:42918354-42918376 AAGGAAGGGTCCCTCTCACCAGG - Intronic
1166455614 19:42937665-42937687 AAGGAAGGGTCCCTCTCACCAGG - Intronic
1166471538 19:43083145-43083167 AAGGAAGGGTCCCTCTCACCAGG - Intronic
1166482677 19:43186960-43186982 AAGGAAGGGTCCCTCTCACCAGG - Intronic
1166492303 19:43270012-43270034 AAGGAAGGGTCCCTCTCACCAGG - Intergenic
1167127277 19:47558693-47558715 AAGCAATTCTCTGTCTCAGCCGG + Intergenic
1167935157 19:52899754-52899776 AAGAAATGCTATCTATCACCGGG - Intergenic
925067217 2:937821-937843 GAGGAATCCTCTCCCTGATCGGG - Intergenic
925705782 2:6683615-6683637 AAACAATGCTCTCTATCATCAGG - Intergenic
926358945 2:12067210-12067232 AAGGAAAGCACCCTCTCTTCTGG - Intergenic
927804196 2:26131086-26131108 AAGGAAAGCTCTATCTCACTGGG - Intronic
928235301 2:29534091-29534113 AAGCAATGCTCTCTGTGGTCTGG - Intronic
930087779 2:47510111-47510133 AAAAAATGCTCTCTCCCAACAGG - Intronic
930197245 2:48522145-48522167 AAAGAATTCTCTCTCTTGTCTGG + Intergenic
934941042 2:98502189-98502211 AAGGAATGCTCTCTCTCATCTGG - Intronic
934979129 2:98825862-98825884 AAGGAAAACTCACTCTCTTCAGG + Intronic
937424397 2:121786365-121786387 AAGGAATTCGCTGTCTGATCAGG + Intergenic
940428481 2:153557981-153558003 AAGGAATCCTTTCTCTAGTCTGG - Intergenic
943231484 2:185258520-185258542 AAGCATTGTTTTCTCTCATCAGG - Intergenic
1171409182 20:24934664-24934686 CAGGAATGCTGTGTCACATCAGG + Intergenic
1175658573 20:60792917-60792939 TAGCAATGCTCTTTATCATCGGG - Intergenic
1177323592 21:19554441-19554463 GAGAAAAGCTCTCACTCATCAGG + Intergenic
1179111316 21:38448146-38448168 AAGGAATCCATTCTCACATCTGG + Intronic
1181838205 22:25628709-25628731 AGGGAATGTTCTTTCTCATTTGG + Intronic
1183465929 22:37980411-37980433 TTGGAATCCTCTCTCTCTTCTGG - Intronic
949354828 3:3169204-3169226 AAGGAATGCTCTCCTTTACCTGG + Intronic
950804737 3:15590081-15590103 AAGGAAAGTTCTCTCATATCAGG - Intronic
951464884 3:22990699-22990721 CAGGAGTGCCCTCTCCCATCCGG - Intergenic
954266172 3:49471910-49471932 CAGGAATTCCCTCTCTCCTCAGG - Intronic
955827296 3:62962082-62962104 AAGGATTGCTCTCTTGCCTCAGG + Intergenic
959586490 3:108030045-108030067 ATGAAATGCTCTCTAACATCTGG + Intergenic
960044328 3:113181421-113181443 AGGGAATGCTCTTCCTCATGTGG - Intergenic
960395111 3:117127820-117127842 AAGGAATGCTTTCTCTAATGAGG - Intronic
962412993 3:135157589-135157611 AAGGAAAGCATTCTCTCCTCTGG - Intronic
963531240 3:146475830-146475852 AAGAAATAATCTCTCTCGTCTGG - Intronic
965521811 3:169675533-169675555 AAGGAAGATTCTATCTCATCTGG - Intergenic
979281304 4:118871182-118871204 AAGGAAAGCTATCTGTCATGTGG - Intronic
979754691 4:124326212-124326234 AAGGAATGCTGTGTCTCACATGG - Intergenic
985170377 4:187142641-187142663 TTGGAATTCTCTCTCTCATCTGG - Intergenic
987629406 5:20448371-20448393 ATGGCATGATCTCTTTCATCAGG + Intronic
989308372 5:39983348-39983370 AAGAAATGGTCTCTCAAATCAGG - Intergenic
990822296 5:59855759-59855781 AAGAAATGCTCTTTCTTTTCAGG - Intronic
993930986 5:93938699-93938721 CAGGCATGCTCTCTCTCTCCAGG - Intronic
995472930 5:112522870-112522892 AATGATTGCTGTCTCTCTTCTGG + Intergenic
1001735206 5:173992043-173992065 AAGGAATTATCTGTCTCATCTGG + Intronic
1004842177 6:19599608-19599630 AAGTAATAGTCTCTCTCACCTGG - Intergenic
1009836366 6:69006456-69006478 AAAGAATGGTCTGTCTCCTCTGG + Intronic
1010067876 6:71707316-71707338 ATGGAATGCTCAGTCCCATCAGG + Intergenic
1012720818 6:102741727-102741749 AAGAGATGTTCTCTCTCATGGGG - Intergenic
1014251070 6:119116131-119116153 AAGCCATGCTCTCTCTCCTTTGG - Intronic
1015911049 6:138167970-138167992 AAGGACCCCTCTCTCTCATGAGG - Intronic
1017891910 6:158645656-158645678 AAAGATTGATATCTCTCATCTGG + Intergenic
1019952041 7:4381392-4381414 AAATAATGCTCTTTCTCATTAGG - Intergenic
1020516528 7:9128039-9128061 AATGAATGTTCTCACTCATATGG + Intergenic
1023354146 7:39350374-39350396 AAGGAAAGCTCTCTGGAATCTGG + Intronic
1026144839 7:67737721-67737743 AAGGGGTGCTCTCTCTGAGCCGG + Intergenic
1032482394 7:132257380-132257402 AAATAAGGCTCTCTATCATCTGG + Intronic
1033830981 7:145252181-145252203 AAGGCATGCTCTTTCTCTTTTGG - Intergenic
1034694887 7:153044412-153044434 ACGGAAGGCCCTCTCACATCAGG - Intergenic
1037752802 8:21693601-21693623 AGGGAATGCTCTGTCCCTTCTGG + Intronic
1039725648 8:40213126-40213148 AGGGAAAGGTCTCTCTCTTCAGG + Intergenic
1041497224 8:58499635-58499657 AAGGATTGCTTTCTCTCACATGG - Intronic
1041876026 8:62688142-62688164 AAGGAATGCACTCTCTTATGAGG - Intronic
1048406832 8:134131454-134131476 CAGAAATTCTCTCTCTCTTCTGG + Intergenic
1049549754 8:143251684-143251706 CAGGACTGCTCTCCATCATCCGG - Intronic
1049953296 9:666969-666991 AAGGAATGCTCAAACTCATCCGG - Intronic
1050201997 9:3155560-3155582 ACTGAATGCTCTCACTCATGTGG - Intergenic
1051220432 9:14843133-14843155 GGGGAATGCTCTGTCTCTTCTGG + Intronic
1052389164 9:27857875-27857897 AAAAAATGCTCTCTGTCCTCAGG + Intergenic
1053656145 9:40219903-40219925 CAGGAATGCTGTCCCTCATTGGG - Intergenic
1053906492 9:42849104-42849126 CAGGAATGCTGTCCCTCATTGGG - Intergenic
1054368251 9:64366117-64366139 CAGGAATGCTGTCCCTCATTGGG - Intergenic
1054528471 9:66156391-66156413 CAGGAATGCTGTCCCTCATTGGG + Intergenic
1054675871 9:67855871-67855893 CAGGAATGCTGTCCCTCATTGGG - Intergenic
1055478554 9:76687510-76687532 ATTGAATGCTCTCTCTCTCCAGG + Intronic
1055789040 9:79901586-79901608 TAGAACTGCTCTCTCTCACCAGG - Intergenic
1055848681 9:80598339-80598361 GAGGGATGCTCTCTTACATCGGG - Intergenic
1056790120 9:89619902-89619924 AAGGAAAGCTCTCTCTGGTCTGG - Intergenic
1058191871 9:101927061-101927083 AAGAAATTCTCACTCTCAGCTGG + Intergenic
1186574312 X:10749381-10749403 AAGGCATGCTCTGACTCAGCAGG - Intronic
1186626135 X:11295796-11295818 AAGGTTTATTCTCTCTCATCTGG - Intronic
1188993957 X:36859354-36859376 AAGGTATGTTTTCTCTCCTCTGG + Intergenic
1191605504 X:63057883-63057905 AAGGGCTGGTCTCTCTCAGCAGG + Intergenic
1192203921 X:69083620-69083642 AAGGAATGGACTCTCTCCTGGGG + Intergenic
1193032665 X:76916160-76916182 AACGATTGCTCTCTCTCTGCTGG + Intergenic
1193121182 X:77824254-77824276 AGGGAAATCTCTCTCTCATTAGG + Intergenic
1194162546 X:90471937-90471959 AAAGAATTCTGTTTCTCATCTGG + Intergenic
1196531748 X:116796016-116796038 AAGGAATTCCCTCTCTCAGGAGG - Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1196890664 X:120287905-120287927 CATGAGAGCTCTCTCTCATCAGG - Intronic
1197845149 X:130793529-130793551 CAGGAATGCTCTGTTCCATCTGG + Intronic
1198221612 X:134607739-134607761 AGGAAATGCTGTCTCTCTTCAGG - Intronic
1198952253 X:142084513-142084535 AATGAATGATCTGGCTCATCTGG - Intergenic
1199445410 X:147914602-147914624 AAGGACAGCTCTCTATCTTCTGG + Intronic
1199526703 X:148800927-148800949 AAGGAATGATTTCTCTCAGGAGG + Intronic
1199950749 X:152703940-152703962 AAGGAATGCTCCCTGTCAGGAGG - Intergenic
1199953070 X:152720529-152720551 AAGGAATGCTCCCTGTCAGGAGG - Intergenic
1199956613 X:152747917-152747939 AAGGAATGCTCCCTGTCAGGAGG + Intergenic
1199958933 X:152764521-152764543 AAGGAATGCTCCCTGTCAGGAGG + Intergenic
1200421444 Y:2973584-2973606 AAGTAATGTTCTCTCTGTTCTGG - Intronic
1200508823 Y:4049671-4049693 AAAGAATTCTGTTTCTCATCTGG + Intergenic