ID: 934942676

View in Genome Browser
Species Human (GRCh38)
Location 2:98513903-98513925
Sequence CCAGCAAATAAGAGAACAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 213}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934942676_934942680 -9 Left 934942676 2:98513903-98513925 CCCGTTGTTCTCTTATTTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 213
Right 934942680 2:98513917-98513939 ATTTGCTGGGCTTCAAGAATTGG 0: 1
1: 0
2: 1
3: 15
4: 153
934942676_934942686 19 Left 934942676 2:98513903-98513925 CCCGTTGTTCTCTTATTTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 213
Right 934942686 2:98513945-98513967 CTGAAGCCCCCAAGGGTCCCAGG 0: 1
1: 0
2: 2
3: 26
4: 206
934942676_934942681 -6 Left 934942676 2:98513903-98513925 CCCGTTGTTCTCTTATTTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 213
Right 934942681 2:98513920-98513942 TGCTGGGCTTCAAGAATTGGTGG 0: 1
1: 0
2: 0
3: 13
4: 142
934942676_934942682 11 Left 934942676 2:98513903-98513925 CCCGTTGTTCTCTTATTTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 213
Right 934942682 2:98513937-98513959 TGGTGGCCCTGAAGCCCCCAAGG 0: 1
1: 0
2: 1
3: 20
4: 265
934942676_934942683 12 Left 934942676 2:98513903-98513925 CCCGTTGTTCTCTTATTTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 213
Right 934942683 2:98513938-98513960 GGTGGCCCTGAAGCCCCCAAGGG 0: 1
1: 0
2: 0
3: 26
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934942676 Original CRISPR CCAGCAAATAAGAGAACAAC GGG (reversed) Intronic
902992988 1:20202666-20202688 CCAACAAATAAGATAATTACAGG - Intergenic
904749663 1:32733729-32733751 CCCACAGATAGGAGAACAACTGG - Intergenic
911830433 1:102543984-102544006 GCAGCAAGTAAGAAAAAAACCGG - Intergenic
913099817 1:115552650-115552672 CCAGCAAATAAATAAACAATGGG - Intergenic
913570812 1:120118504-120118526 CCAGCAACTCAGAGAAGAATTGG - Intergenic
914291617 1:146279480-146279502 CCAGCAACTCAGAGAAGAAATGG - Intergenic
914552661 1:148730263-148730285 CCAGCAACTCAGAGAAGAAATGG - Intergenic
915688840 1:157666195-157666217 ACAGCAAAAAAGAAAACTACAGG - Intergenic
916471156 1:165124109-165124131 CCACTAAATAAGAGAAAAAATGG + Intergenic
919245397 1:194976718-194976740 GCTGCAAATAAGGAAACAACAGG - Intergenic
919401062 1:197117540-197117562 GCAACAAAGAAGAGAGCAACAGG + Intronic
923850605 1:237790210-237790232 TCAGCAACTAAGGGAACAGCTGG - Intronic
1064584499 10:16826090-16826112 CTAGCAAATGAGAGAATAACGGG - Intronic
1065098685 10:22310797-22310819 CCAGCAAAAAATGGAACAAATGG - Intergenic
1066168130 10:32810153-32810175 CCAGAAAATAAGAAAACAATAGG + Intronic
1066236939 10:33494134-33494156 ACAGCAAACCAGAAAACAACGGG + Intergenic
1067753652 10:48987699-48987721 ACATCCAATAAGAGAACAATTGG - Intergenic
1067858063 10:49814630-49814652 GAAGAAAAAAAGAGAACAACCGG - Intergenic
1070245203 10:74724566-74724588 ACATCAAATACCAGAACAACAGG + Intergenic
1070806036 10:79271265-79271287 TCAGTAGAGAAGAGAACAACAGG - Intronic
1071843388 10:89496494-89496516 CCAGAAACTAAGAAAACAAGGGG + Intronic
1073985386 10:109202514-109202536 CCAGAAAATAAGAGGACATAAGG + Intergenic
1074209208 10:111313289-111313311 GCAGCAAAAAAGAAAACTACAGG + Intergenic
1074341399 10:112633761-112633783 CCATAAAATAAGAGAAGAACTGG - Intronic
1075413652 10:122247261-122247283 TCTGGAAATAACAGAACAACGGG - Intronic
1075936589 10:126347767-126347789 CAAATAAATAAGAGAAAAACAGG - Intronic
1076027092 10:127124525-127124547 TCAGAAAATAACAGAGCAACAGG - Intronic
1077451234 11:2647445-2647467 ACAGCAAAAAAGAAAACTACAGG - Intronic
1078845642 11:15116451-15116473 CCAGAAAAAAAGATAACCACTGG - Intronic
1078961957 11:16286110-16286132 GCAAGAAATAAGACAACAACTGG - Intronic
1081022525 11:37965208-37965230 CAAGCAAAATAGAGAAAAACAGG + Intergenic
1082217524 11:49591417-49591439 CCAGCAAATGAGATAACACCTGG - Intergenic
1083042020 11:59697880-59697902 CCACCAAAAAAGAAAACTACAGG - Intergenic
1085853203 11:80145768-80145790 ACAGCAAAGATGAGAAAAACAGG + Intergenic
1086632051 11:89032737-89032759 CCAGCAAATAAGATAACACCTGG + Intronic
1086984428 11:93232822-93232844 CCAGCACATAGGAGGACAAGAGG + Intergenic
1090178632 11:124673899-124673921 CCAGCAACTAGAAAAACAACCGG + Exonic
1091058827 11:132443204-132443226 CCACCAAGGAAAAGAACAACAGG + Intronic
1092719263 12:11424792-11424814 CCAGCAAATAAATAAAAAACAGG + Intronic
1092849323 12:12612341-12612363 CCAGGAAATCAGGGAACACCGGG + Intronic
1093606753 12:21100516-21100538 CCAGGAAATAAGGAAACTACAGG - Intronic
1097082727 12:56444758-56444780 ACAGCCAATAAGAGATCAAAGGG - Intronic
1099368843 12:81804742-81804764 TCAGCCAATGAAAGAACAACTGG + Intergenic
1102358102 12:112257535-112257557 ACAGCAAATAAGTGATCACCTGG - Intronic
1104495302 12:129231522-129231544 CCAACCAATAAAAGAACAATTGG - Intronic
1106937470 13:34738972-34738994 CCACCAAATAACAAAACAAAAGG + Intergenic
1107582838 13:41810105-41810127 CCAGCAAGTAAGTGAAGAAAAGG + Intronic
1108068491 13:46603489-46603511 CCAGTAATTAAGTGGACAACAGG + Intronic
1108643304 13:52403443-52403465 CCAACAAATAACTGAACCACAGG - Intronic
1108971646 13:56382853-56382875 GCAGCAGATAAGAGAATAAGGGG + Intergenic
1109068316 13:57730275-57730297 CAAGCAAATAAATGAACAAAAGG - Intergenic
1110142268 13:72145049-72145071 CCAGAAAAAAAAAGAAAAACTGG + Intergenic
1110267271 13:73552595-73552617 CAAGCAAAGAAGAGACCAAGTGG - Intergenic
1111229531 13:85325715-85325737 CCATGAAATGAGAGCACAACTGG + Intergenic
1111472355 13:88699675-88699697 ACAGTAAAAAAGAGAACTACAGG - Intergenic
1111602594 13:90494045-90494067 CCAGGAAAAAAGAGAATAAGAGG - Intergenic
1112655226 13:101445265-101445287 AAAGCAAACAAGTGAACAACAGG + Intergenic
1112696162 13:101950787-101950809 CAAGCTAATAGGAGAAGAACAGG + Intronic
1114660939 14:24344266-24344288 CCAGCAACAATGATAACAACTGG + Intergenic
1114998617 14:28392549-28392571 CCAGAAACTCAGAGAACAAGTGG - Intergenic
1115266110 14:31501923-31501945 CCAGCAAGGAAGAGAAACACCGG + Intronic
1116401945 14:44518034-44518056 ACAGCAAAAAAGAAAACTACAGG - Intergenic
1117929749 14:60828780-60828802 CCAGCAAATAATTGAACCACAGG - Intronic
1118912536 14:70073610-70073632 CCAGCACTGAAGAGAACAAGTGG + Intronic
1122759802 14:104014638-104014660 CTAGAAAATAAGTGCACAACGGG - Intronic
1125266258 15:37884894-37884916 CCAGCAAAAAAGAGAAGAAATGG + Intergenic
1125399725 15:39288090-39288112 CCAGGAAAGAAGAAAACAAGGGG + Intergenic
1125418859 15:39482547-39482569 CCAACAATAAAGAGAAAAACTGG + Intergenic
1125907375 15:43405640-43405662 CCACCAAGTAAGAAAGCAACAGG + Exonic
1130026119 15:80271855-80271877 TCTGCAAATAAGAAAACAGCTGG - Intergenic
1132359027 15:101196921-101196943 CCAGCAATTCAGTGAACTACTGG + Intronic
1135880953 16:26256205-26256227 CCAACAAACAAAACAACAACAGG + Intergenic
1137592776 16:49703886-49703908 CCGGCACATAAGAGATGAACAGG + Intronic
1139062210 16:63265860-63265882 TCAGAAACTAAGAGAAAAACAGG + Intergenic
1141053076 16:80790394-80790416 ACAGCAATTAAGAGAAAAAAAGG + Intronic
1142752230 17:1995905-1995927 CCAGCAAATATGAGCCCAACAGG - Intronic
1143656203 17:8295201-8295223 CCAGCAAGTGAGAGAAGAAAAGG + Intronic
1144023896 17:11260874-11260896 CCAGCATCTGAGAGAACAACAGG - Intronic
1146760873 17:35476907-35476929 CTAGAAAATAAGAGAAAAACTGG + Intronic
1149856774 17:60089370-60089392 CCTGCAAAAAAAAAAACAACGGG - Intergenic
1150499189 17:65633798-65633820 CCAGCAGATAAAAGAACAGATGG + Intronic
1150504723 17:65686861-65686883 CTAGCAAATAAAAAAAAAACTGG - Intronic
1150621120 17:66808319-66808341 CCAGCAAAAAAAAAAAAAACAGG - Exonic
1150930846 17:69583437-69583459 CCTCTAAAGAAGAGAACAACAGG + Intergenic
1151194374 17:72421183-72421205 CCAGCAACTAAGAGTTCAAGGGG + Intergenic
1151262587 17:72928401-72928423 CCAGCAAACAAGAAAACAAAGGG + Intronic
1151832725 17:76564567-76564589 GCAGCAGATAAGAGAAAAAAAGG - Intronic
1158385317 18:56982940-56982962 TCAGCCAATAAGAGAAAAATAGG + Intronic
1161732659 19:5971041-5971063 CCAGGAAATTTGAGAACCACTGG - Intronic
1163709766 19:18839721-18839743 CCAGGAAGTAAGAAAACAGCAGG - Intronic
926213927 2:10891956-10891978 ACAGCAAATGAGAGGAAAACTGG + Intergenic
926666848 2:15534512-15534534 CCACTAAATATGAGAACAAATGG + Intronic
927831733 2:26357380-26357402 CCAAAAAAGAAGAGAACAAGTGG - Intronic
930083242 2:47471882-47471904 GCAGCAAAAAAGAAATCAACAGG + Intronic
931263775 2:60642408-60642430 CCAGGAAATAAAAGGAAAACTGG - Intergenic
931511749 2:63004598-63004620 CAATAAAATAAGAGAACAAATGG + Intronic
932001668 2:67890784-67890806 CCAGGAAAAATGACAACAACTGG - Intergenic
932350771 2:71029663-71029685 CCATAAAATAAGCAAACAACTGG - Intergenic
934526735 2:95056748-95056770 CCAGCAGAGAAGAGAACAGAGGG + Intergenic
934942676 2:98513903-98513925 CCAGCAAATAAGAGAACAACGGG - Intronic
935489881 2:103705658-103705680 ATAGCAAATAAGAAAATAACTGG + Intergenic
937426571 2:121804630-121804652 CCACCAAATGTGTGAACAACTGG - Intergenic
937753763 2:125511146-125511168 ACACAAAATAAGAGAACAGCAGG + Intergenic
938105949 2:128529922-128529944 CCAGGAAATAGAAGAACAAAGGG - Intergenic
938730027 2:134140185-134140207 CCTGGAAATAGGAGAACCACTGG + Intronic
941029968 2:160499848-160499870 TCAGTAAATAAGAACACAACTGG + Intergenic
941218049 2:162738563-162738585 CCAGAAAACAAGAGACCCACAGG + Intronic
941466497 2:165833949-165833971 ACTGCAAATAATAGAAAAACTGG - Intergenic
942561417 2:177223928-177223950 CCAGTAAGTAATAAAACAACAGG + Intronic
943608179 2:190000913-190000935 CCCGCAAAAAAGAGAACAGGAGG - Intronic
943716375 2:191156701-191156723 CCAGCTATTAAAAGAATAACTGG - Intergenic
944137371 2:196414077-196414099 GCAGCAAAGAAGAGAAAATCAGG - Intronic
944297857 2:198087610-198087632 CCAGTATTTAATAGAACAACAGG + Intronic
944990834 2:205232926-205232948 TCACCAAATGAGAGAAAAACAGG + Intronic
945276932 2:207997528-207997550 CCAGCAAGTAAGAGAATGACAGG + Intronic
945438423 2:209847887-209847909 GCAACAAATAATAAAACAACTGG + Intronic
945740762 2:213658213-213658235 CCAGCCAGTGAGAGAAGAACAGG - Intronic
946972508 2:225110760-225110782 CCAGCAAGTAAAAGAATAAAAGG - Intergenic
1170718204 20:18850548-18850570 TCAGCAAATATTAGAACAAGTGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1180918122 22:19503836-19503858 CCAGCAAATCAGAGGAGAAAAGG + Intronic
1185083290 22:48721509-48721531 CCAACCAATAGGAGAAAAACAGG - Intronic
949730449 3:7106337-7106359 CCAGAAAATAAGAAAAAAAAAGG - Intronic
949964099 3:9340657-9340679 CCAGCAAGTAAAAAAACTACTGG - Intronic
952940031 3:38436609-38436631 ACAGCAAAAAAGAAAACTACAGG + Intergenic
953533093 3:43755768-43755790 ACTGCAGAAAAGAGAACAACAGG + Intergenic
953642705 3:44724641-44724663 CCAGCAACTGAGAGAAAATCGGG - Intergenic
955094378 3:55782627-55782649 CAAGCAAACAAAAGAACACCAGG + Intronic
957852983 3:85834690-85834712 CCAGCAAATGAGACTACAATTGG - Intronic
959330678 3:105000820-105000842 ACAACAAAAAAGAAAACAACAGG + Intergenic
960828964 3:121824258-121824280 CCAGCTACTAAGTGACCAACTGG + Intronic
961485557 3:127213425-127213447 CCAGCAAATCAGAAAACATGAGG + Intergenic
962700453 3:137993559-137993581 ATAGCAAATAAAAAAACAACTGG - Intergenic
964149274 3:153504766-153504788 CCAGCATATAGGAAAATAACTGG - Intergenic
964518636 3:157540476-157540498 CTAGCAAATGAGGGAAGAACAGG + Intergenic
964635549 3:158854486-158854508 CCACCAAAAAAGTGGACAACGGG - Intergenic
969804031 4:9592473-9592495 CCAGGAAAAAAGATAATAACTGG + Intergenic
971930708 4:33078930-33078952 CCAGAACAGAAGAAAACAACTGG + Intergenic
971955182 4:33408230-33408252 ACAGTAAATAAGAGAAACACAGG - Intergenic
972121513 4:35710080-35710102 CCAGCTACTAAGAGAGCAACGGG - Intergenic
975190098 4:71450627-71450649 CCTGAAAATATTAGAACAACAGG - Intronic
975290293 4:72670514-72670536 CCAGGAAATAAGAGCAAACCTGG - Intergenic
975472558 4:74786989-74787011 CCAGCCAGTAAAATAACAACAGG - Intronic
975592624 4:76016004-76016026 ACATCAAAAAAGAAAACAACAGG - Intronic
976717535 4:88138624-88138646 CCAGCAGATAGGAGAAAGACTGG + Intronic
976853158 4:89572502-89572524 AAAGCAAATAAGACAACAAAAGG + Intergenic
979277954 4:118834799-118834821 GTAGCAAATAAAAGAACAAAAGG - Intronic
979914883 4:126419141-126419163 CCAGAAAACAAGAAAATAACAGG - Intergenic
980586132 4:134817746-134817768 CCAAAAAATTAGAGAACAAAGGG + Intergenic
980751068 4:137089333-137089355 ACAGCAAACAATAAAACAACAGG + Intergenic
980787768 4:137576827-137576849 CATGCAAATAAGAGAAAGACTGG + Intergenic
981094889 4:140768817-140768839 CCAACAAATAAGACAGCACCTGG + Intergenic
984004361 4:174291215-174291237 ACAACAAACAAGAGAAAAACAGG - Intronic
984513436 4:180708590-180708612 CCAGCAAGCAAGAAAGCAACAGG - Intergenic
986588490 5:9344457-9344479 CCAGCAAAGGAGAGAAAAATTGG + Intronic
987153588 5:15064872-15064894 GCAGCCAAAAAGAGAACAAAAGG - Intergenic
988114390 5:26866174-26866196 CCAGTAGATAAGAGAGCAAATGG + Intergenic
989174926 5:38514995-38515017 TGAGGAAATAAGAGAACGACTGG + Intronic
989555166 5:42786063-42786085 CCAGTAAAAAATAAAACAACAGG - Intronic
992412996 5:76525599-76525621 ACAGAAAATATGAGAACTACTGG - Intronic
993413461 5:87599012-87599034 CCAGTTAATAACACAACAACAGG - Intergenic
994631263 5:102291000-102291022 ACAGCAAATAAAAGTACAAAAGG + Intronic
995546188 5:113234067-113234089 CTAGCAAATAAAAGAATCACAGG + Intronic
996914834 5:128699929-128699951 CTAGCAAATAAAAGCACAGCTGG + Intronic
996919454 5:128750523-128750545 CCAGCAAAGCAGAGGACCACAGG - Intronic
999960567 5:156751787-156751809 TCAGCAAGAAAGTGAACAACTGG + Intronic
1000183119 5:158831953-158831975 AAAGCAAATAAGAGAAAAAGTGG + Intronic
1000437300 5:161228847-161228869 CCAGCAAATAAGAGGCAAAAAGG - Intergenic
1002069267 5:176669622-176669644 TCAGCAACAAAAAGAACAACAGG - Intergenic
1003784939 6:9474986-9475008 TCAGCAAAAAAGAAAACAAATGG - Intergenic
1005290448 6:24374239-24374261 CCAGCAAAGAAGAGAGTAATGGG + Intergenic
1007178956 6:39914862-39914884 CCAGGAAATAAGAGACAAAAAGG + Intronic
1010012474 6:71064897-71064919 ACAACAAAAAAGAGAACTACAGG - Intergenic
1010359205 6:74973152-74973174 TAATCAAAAAAGAGAACAACAGG + Intergenic
1010564712 6:77396137-77396159 CCAGAAAATAATAGAAAAACTGG - Intergenic
1010618888 6:78048857-78048879 CCACCAAAAAAGAAAACTACAGG - Intergenic
1012765324 6:103360047-103360069 ACACCAAATAAGAAAACTACAGG + Intergenic
1015012149 6:128362589-128362611 CCAACAAATAAGAGAATTATTGG + Intronic
1015210512 6:130692784-130692806 ACAACAAAAAAGAGAACTACAGG + Intergenic
1015238593 6:130998715-130998737 CCAGTAAATAAGTTAGCAACAGG + Intronic
1016061840 6:139638559-139638581 TCAGCAAATAAGAAAAACACTGG - Intergenic
1017452762 6:154569597-154569619 CCAGCAATTAACAGACCAGCTGG + Intergenic
1017988772 6:159468322-159468344 GCACCAAATAAAAGTACAACAGG + Intergenic
1018531881 6:164773816-164773838 GCAGGAAACAAGAGAACATCAGG - Intergenic
1020218416 7:6214072-6214094 CACACAAATAAGAGAAAAACAGG + Intronic
1022011550 7:26311905-26311927 CGAGGAGATAAGAGAACAGCTGG + Intronic
1022961699 7:35432384-35432406 CCAGCAAATAACACCAAAACAGG + Intergenic
1023546954 7:41328126-41328148 CCATCAAATGAGAGATGAACAGG + Intergenic
1023860886 7:44217159-44217181 ACTGCAAATAAAAGAAAAACAGG - Exonic
1024148721 7:46544708-46544730 CAAACAAAAAAGAGAACCACTGG - Intergenic
1024889866 7:54187336-54187358 CCAGAAAATAAAAAAAAAACAGG + Intergenic
1025951946 7:66152349-66152371 CCAGCATAGAAGAGCACAGCTGG + Exonic
1027843760 7:83346104-83346126 CAAGGAAATAAGAGGACAAATGG + Intergenic
1028448990 7:90958843-90958865 CAAGCAACTAAGACAAAAACTGG - Intronic
1028490276 7:91403742-91403764 TCAGCATATAAGCAAACAACAGG + Intergenic
1028900434 7:96093341-96093363 CCAGCAACCAAGATAAGAACAGG + Intronic
1030354871 7:108530825-108530847 ACAGTAAATATGACAACAACAGG - Intronic
1031151039 7:118054376-118054398 CTAGCAATTAAAAGAACAACAGG + Intergenic
1032910358 7:136422128-136422150 ACAGCAAATAAAAGAACCTCAGG + Intergenic
1033910422 7:146257255-146257277 CCAGCAACAAAAAGTACAACTGG + Intronic
1037064547 8:14560817-14560839 CAAGCAAATGAGATAACAAGAGG + Intronic
1037357936 8:18042496-18042518 CCAAATAATAAGAAAACAACCGG - Intergenic
1037388562 8:18368061-18368083 CCAGCTAACAACACAACAACAGG + Intergenic
1044151496 8:88782329-88782351 CCATCTAATCAGAGAATAACTGG - Intergenic
1044755281 8:95455224-95455246 CCAGAAAAAAAGAGAACTAGAGG - Intergenic
1045796105 8:106046305-106046327 GCAGTAAATAACAGAACATCTGG - Intergenic
1046431986 8:114138543-114138565 GCAGCAAATAACATAACATCTGG - Intergenic
1046528697 8:115415460-115415482 CCAGCATATAAGAGTAACACAGG + Intronic
1046642193 8:116744424-116744446 CAAGCATATAAGAGAAAAATTGG - Intronic
1046783341 8:118239548-118239570 CCAGCAAATATGAGCACAGATGG + Intronic
1048053281 8:130839508-130839530 CCAGGAAATGGGAGAACAACAGG + Intronic
1049022552 8:139967676-139967698 CCAGGAAGAAAGAGCACAACTGG + Intronic
1052203757 9:25813279-25813301 TCAGCAATTAAGAGAATAAAAGG + Intergenic
1052459046 9:28739519-28739541 CCAGCAAATAATAATACAACAGG + Intergenic
1055206359 9:73735478-73735500 CTAGGAAATAAGAAAACAGCAGG + Intergenic
1055219809 9:73915151-73915173 TCTGGAAATAAGAGAACTACAGG + Intergenic
1056187259 9:84147571-84147593 TCAGGAAGTAAGAAAACAACTGG + Intergenic
1058558437 9:106197092-106197114 ACAACAAATAAGAAAACCACAGG - Intergenic
1185466071 X:354870-354892 CCAGCAAACAAGAAACCAAAAGG + Intronic
1185960088 X:4539557-4539579 CCAACAGATAAGAAAACAAGTGG - Intergenic
1186581427 X:10823726-10823748 CCAGTAAATAAAACAAGAACTGG + Intronic
1187101749 X:16199930-16199952 CCAGCAAATATGAGACAAAAAGG + Intergenic
1187349580 X:18500426-18500448 CCAGAAAATGAGAGAAAAACAGG - Intronic
1191017451 X:55825169-55825191 TCAGCAAAAAAGAGCAAAACTGG - Intergenic
1193859885 X:86652127-86652149 ACAGAAAAAAAGGGAACAACAGG - Intronic
1194529816 X:95032246-95032268 ACAACAAAAAAGAGAACTACAGG - Intergenic
1194890158 X:99368956-99368978 CCAGCTAATATGAATACAACAGG - Intergenic
1196237236 X:113296932-113296954 TCAGCAAACAAGACAAAAACTGG + Intergenic
1196865483 X:120066800-120066822 GGAGAAAATAAGAGAACAAGAGG + Intergenic
1196877610 X:120169480-120169502 GGAGAAAATAAGAGAACAAGAGG - Intergenic
1197553226 X:127920772-127920794 ACAGCAAAAAAGAGAACTTCAGG + Intergenic
1198437444 X:136630838-136630860 CCAGTGAATGAGAGAACAATAGG + Intergenic