ID: 934942895

View in Genome Browser
Species Human (GRCh38)
Location 2:98515274-98515296
Sequence TAAAGTAGCCTCTTTCTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934942891_934942895 -7 Left 934942891 2:98515258-98515280 CCTCTTTCTGCCCCTCTAAAGTA 0: 1
1: 0
2: 2
3: 19
4: 245
Right 934942895 2:98515274-98515296 TAAAGTAGCCTCTTTCTTAGAGG 0: 1
1: 0
2: 0
3: 14
4: 135
934942890_934942895 -2 Left 934942890 2:98515253-98515275 CCTTTCCTCTTTCTGCCCCTCTA 0: 1
1: 0
2: 10
3: 110
4: 1185
Right 934942895 2:98515274-98515296 TAAAGTAGCCTCTTTCTTAGAGG 0: 1
1: 0
2: 0
3: 14
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934942895 Original CRISPR TAAAGTAGCCTCTTTCTTAG AGG Intronic
902787417 1:18742130-18742152 AAAAGAAGCCTCATTCTTAGAGG - Intronic
903223555 1:21882286-21882308 TAAAGTAGCCTGCCTCCTAGAGG + Intronic
906963151 1:50431604-50431626 GAAAGAAGCCTCTTTCTTTAGGG + Intergenic
908434640 1:64093100-64093122 TAAAGTTGTCTCTTTCAAAGTGG - Intronic
911300436 1:96166387-96166409 TCAATTAGACTTTTTCTTAGGGG - Intergenic
911886889 1:103313015-103313037 TAAAATGGCCTACTTCTTAGTGG + Intergenic
916181492 1:162087816-162087838 TAAAGTGCCCTCTCTCTTTGAGG + Intronic
916181844 1:162091758-162091780 TAAAGTGCCCTCTCTCTTTGAGG - Intronic
917063266 1:171064051-171064073 TCAAGTTATCTCTTTCTTAGAGG - Intronic
919106803 1:193163509-193163531 TAAAGTAACTTCTTTTTTTGGGG - Intronic
920798618 1:209164898-209164920 TACAGCAGGCTCTTCCTTAGAGG - Intergenic
921783030 1:219191307-219191329 TAATGAAGCATATTTCTTAGTGG + Intronic
924314480 1:242781755-242781777 TAAAGTATGCTCTTTCTGAGAGG - Intergenic
924406123 1:243748464-243748486 TAAAGCTGCTTCTTTCTAAGTGG - Intronic
1065613045 10:27491368-27491390 CAAAGTAGCCTCATTCTTCTTGG - Intergenic
1070547546 10:77464473-77464495 TAAAGCAGCCTCTTGCTAATGGG + Intronic
1070970399 10:80561110-80561132 TGAACTAGCCTCTTTATTTGTGG + Intronic
1074280516 10:112047488-112047510 GAAGGTTGCCTGTTTCTTAGTGG - Intergenic
1074981566 10:118624121-118624143 TCAAGGAGCCTTTTTGTTAGGGG + Intergenic
1074997859 10:118773384-118773406 TGAAGTTGGCTCTTTCTAAGTGG + Intergenic
1088114014 11:106296016-106296038 TAAAGTAGCTTCTGCCTAAGGGG + Intergenic
1089404462 11:118186122-118186144 TAAAATAACCTATTTCTGAGTGG + Intergenic
1090621194 11:128562555-128562577 TCTGGTAGCCTCTTTCTAAGAGG - Intronic
1091821601 12:3479586-3479608 TACAGTAGCCGCTTCTTTAGGGG - Intronic
1094336786 12:29366423-29366445 TAAAGTAGTATCTTTCTAAGAGG - Intronic
1097119395 12:56719853-56719875 TACAGTAGGGTCTTTCTTGGTGG + Exonic
1097984992 12:65773486-65773508 TAAAATAGGCTCTATGTTAGAGG - Intergenic
1098796863 12:74899674-74899696 TAAAGCAGCCTTTGTCTCAGAGG - Intergenic
1100220009 12:92494726-92494748 TGTATTAGCCTCTTTCTTAAAGG - Intergenic
1108343881 13:49525171-49525193 TAAAGAAGTTTCTTTCTTAAGGG + Intronic
1109230673 13:59752973-59752995 AAAAGTAAACTCTTTATTAGTGG + Intronic
1110057494 13:70992619-70992641 TAAAGTGGCTTCTTTGTTAATGG + Intergenic
1110507650 13:76306965-76306987 TAAGGTAACCTCTTTCTTCTCGG + Intergenic
1112766632 13:102752669-102752691 TAAAATAGCCTATATATTAGAGG - Intronic
1115148822 14:30259537-30259559 TATGGTAGCCTATTTATTAGTGG - Intergenic
1115426441 14:33265550-33265572 TAAATTAGGCTCTGTCTTATGGG + Intronic
1118862244 14:69673521-69673543 TGCAGTAGCCTATTTCTGAGAGG - Intronic
1127638516 15:60893632-60893654 CTTAGGAGCCTCTTTCTTAGAGG - Intronic
1127787569 15:62369497-62369519 TAAAGTAAGCTTTTTGTTAGAGG - Intergenic
1131718663 15:95142747-95142769 TAAAGCAGCCTCTTGGTCAGTGG - Intergenic
1135735581 16:24929329-24929351 AAGAGTATCTTCTTTCTTAGGGG - Intronic
1137560860 16:49501384-49501406 TAAAATATCAGCTTTCTTAGAGG + Intronic
1138946337 16:61854837-61854859 TAAATTAGACTCTATCTTTGAGG - Intronic
1139841873 16:69888285-69888307 TAAAGGAGCCTCAGTCTTTGAGG - Intronic
1140197185 16:72865007-72865029 TAAAATAGCCTCATTGGTAGAGG - Intronic
1147209515 17:38864045-38864067 TAAACTCGCCCCTTTCTCAGTGG + Intergenic
1149463861 17:56858122-56858144 TTAATTATCCTCTTTCTCAGGGG - Intronic
1152324575 17:79628063-79628085 TAAAGCAGCCGCTTTCTCTGAGG - Intergenic
1155784111 18:29876247-29876269 TAAACTAACATCTTTCTGAGGGG - Intergenic
1156199959 18:34819616-34819638 ATAAGGAGCCTCTTTCTTAGGGG + Intronic
1157344480 18:46812635-46812657 TCAAGTAGCCTCTTCCTCATTGG - Intronic
1159500172 18:69258491-69258513 TAAAATAGTCTATTTCTTAGAGG + Intergenic
1164843075 19:31409128-31409150 TAAAGTAGCCTGTGTCTCAGAGG - Intergenic
928977400 2:37103070-37103092 AAAAGTATCCTCTTACTCAGAGG - Exonic
930901168 2:56509236-56509258 TAAAGTTGCCTCCGTCTTAAGGG - Intergenic
931496745 2:62815564-62815586 TAAAGTAGCCACTTTTTTCCTGG + Intronic
932536962 2:72608359-72608381 TAGAATAGCCTTTTTCTAAGTGG + Intronic
932908611 2:75782249-75782271 TGAAGTAGCCTCTTTTTATGTGG + Intergenic
934942895 2:98515274-98515296 TAAAGTAGCCTCTTTCTTAGAGG + Intronic
935188494 2:100756350-100756372 TGAGGCAGCCCCTTTCTTAGAGG - Intergenic
937584751 2:123532898-123532920 TAAAATAGCCTCTTTTTTTAAGG + Intergenic
938198339 2:129352504-129352526 TAAAGTGGGCTCTATCTTTGCGG - Intergenic
939227866 2:139386307-139386329 TAAAGAGGCCACTTTCTTAGCGG + Intergenic
940976061 2:159945815-159945837 TAAAGTTGCCTCTTTATTTTAGG + Intronic
941453281 2:165686053-165686075 TAGAGTAGCTTCTTTGTTAGAGG + Exonic
942741193 2:179180356-179180378 TAAGGTAGCCTCTTCCTAATAGG - Intronic
944211339 2:197209719-197209741 TAAACTATCCTAGTTCTTAGAGG - Intronic
945794152 2:214340838-214340860 TAAAGAAGACTGTTTCTGAGTGG - Intronic
946961348 2:224988971-224988993 CAAAGTAGCCTCTTTTCTGGGGG - Intronic
948829495 2:240591297-240591319 TAAAGAAGCATCTTTCTTGCTGG - Intronic
1168823753 20:794685-794707 TAATGTTGTCTCCTTCTTAGAGG + Intergenic
1169898085 20:10525572-10525594 TAGAGTTGCCTCTTTTTTGGCGG + Intronic
1170837321 20:19895438-19895460 TAGAGTACCCCCTTTCTAAGTGG + Intronic
1171961916 20:31500902-31500924 TAATGTAGCCTCGTGGTTAGGGG + Intergenic
1177077447 21:16594883-16594905 AAAAGTAGACTCTTTATTAATGG + Intergenic
1180948177 22:19708222-19708244 AAAAGCAGCCCCTGTCTTAGGGG + Intergenic
949353177 3:3146922-3146944 TAATGTAGCCTCTATCTAATAGG + Intronic
951260557 3:20503419-20503441 TAAGGAAGCCTCATTCCTAGGGG - Intergenic
951822294 3:26826725-26826747 TAAATCATCCTCTTTCTTTGAGG - Intergenic
952336976 3:32412026-32412048 TAAAGTAGGCTTTTTGGTAGTGG + Intronic
953023787 3:39133250-39133272 GAAAGCAGCCTCTTGCTTTGAGG - Intronic
955482777 3:59406205-59406227 CAAAATAACCTCTTCCTTAGGGG - Intergenic
957526876 3:81389381-81389403 TAAAGTAGTCTGTCTGTTAGAGG - Intergenic
958527402 3:95280885-95280907 TAAGGAAGCCTCATTCTTATTGG - Intergenic
964032844 3:152158270-152158292 TAAAATAGTCTCTATCTTGGAGG + Intergenic
966036090 3:175417873-175417895 AAAAGTAGCTCCTTTCTTATGGG + Intronic
966275422 3:178159994-178160016 TAATGAAATCTCTTTCTTAGTGG - Intergenic
966405479 3:179593055-179593077 TAAATAAACCTCTTTCTGAGGGG + Intronic
966472330 3:180304788-180304810 TGATGTTTCCTCTTTCTTAGTGG + Intergenic
966738226 3:183207329-183207351 AAAAGTACCCTCTTTCTTCCAGG - Intronic
977182487 4:93894044-93894066 TAAAGTAGCCACTTTGTGACAGG + Intergenic
979451160 4:120872492-120872514 TAAAGTAGCCAAATCCTTAGAGG + Intronic
980402547 4:132310293-132310315 TAAAGTAGGCTTTTTTTTGGGGG + Intergenic
983926464 4:173408345-173408367 TAAATAAGCCTCCTTCTTTGGGG + Intergenic
987735923 5:21843243-21843265 GAAAGTAGCATGTTTCTTAAAGG - Intronic
990011189 5:51000386-51000408 TAAAGTTGTTTGTTTCTTAGAGG + Intergenic
990041612 5:51383693-51383715 TAAAATAGCCTCTTACTTTTTGG - Exonic
990427158 5:55697732-55697754 TAAAATATCCACTTTCTTACAGG - Intronic
991567994 5:68024775-68024797 TAAAGAGGACTCTTTCTCAGGGG - Intergenic
996241007 5:121201407-121201429 TAAACTAGCCTCTTCCTAAAAGG + Intergenic
997420656 5:133764245-133764267 CAAAGTAGCCTCTTTCCTTCAGG + Intergenic
1005588497 6:27300507-27300529 TGAAGTCTCCTATTTCTTAGTGG + Intronic
1010703650 6:79080223-79080245 TAAAGTAGCCTATTTCTAGGTGG + Intergenic
1011097524 6:83682812-83682834 TAAATTAGCCTTTTTTTTTGAGG + Intronic
1011547122 6:88493682-88493704 AAAAATAGCCTCTTTGTCAGAGG - Intergenic
1012762783 6:103322984-103323006 TAAAGTAACCTCTTTAATATTGG - Intergenic
1013277530 6:108600123-108600145 TAAAGTAGTCTTTTTCCTCGCGG - Intronic
1013959851 6:115886633-115886655 TTAACTAGCCCCATTCTTAGTGG - Intergenic
1014054833 6:117001786-117001808 AAAAGTAGCCTCTGTTTGAGAGG - Intergenic
1014295925 6:119618051-119618073 TAAAGGAGCCTCTAGCTCAGGGG - Intergenic
1014481958 6:121950487-121950509 TCAGGGAGCCTCATTCTTAGGGG - Intergenic
1015055222 6:128894553-128894575 TAAACTAGCCACTTTTTTCGTGG - Intronic
1015412223 6:132906880-132906902 CAAAGTGGCCTCCTTTTTAGAGG + Intergenic
1015998352 6:139017454-139017476 TAATGTAGCCTCTCTCTTACTGG + Intergenic
1016261301 6:142173999-142174021 TAAAGTAGCGTCTTTGTTGGTGG + Intronic
1017759391 6:157556358-157556380 CACAGTAGCCTCTGGCTTAGAGG - Intronic
1022787075 7:33649070-33649092 TAAAGTTGCCTTTTCCTTATTGG + Intergenic
1023662558 7:42485486-42485508 TAAAGTACACTCTTTCCCAGTGG - Intergenic
1024251713 7:47510409-47510431 TAAACTAGCCACCTTCTCAGGGG + Intronic
1027491187 7:78828210-78828232 TACAGTAGCCTCTTTTTAAAAGG + Intronic
1028746791 7:94336496-94336518 TCAAAGAGCATCTTTCTTAGAGG + Intergenic
1031545172 7:123043842-123043864 AAAAGAAGCCTCTTTCTTTGAGG - Intergenic
1034168847 7:149047113-149047135 GAAAGCAGCCTCTTTCCTACTGG - Intergenic
1037188976 8:16099414-16099436 TAAACCAGCATCTTTCTGAGAGG - Intergenic
1037965259 8:23128928-23128950 CATAGTAGCTTCTTTCATAGTGG + Intergenic
1038985474 8:32804501-32804523 TAAAGTAAACCCTTTCCTAGAGG + Intergenic
1043193159 8:77252423-77252445 CAAAGTAGCATTTTTCTCAGTGG + Intergenic
1043281849 8:78478092-78478114 TAAAGTACTTTTTTTCTTAGTGG - Intergenic
1045893735 8:107188804-107188826 TAATTTAGCCTTTTTCTGAGAGG + Intergenic
1047377163 8:124310922-124310944 TAATATAACCTTTTTCTTAGTGG - Intergenic
1048592195 8:135831069-135831091 TAAAGTAGCTTCTTGCTGGGTGG + Intergenic
1049025599 8:139986351-139986373 TAAGGTAATTTCTTTCTTAGAGG - Intronic
1049854930 8:144855547-144855569 TTAGGTAGCATCTTTCTGAGGGG - Intergenic
1051589624 9:18763597-18763619 TGTAGTAGCCTCTTTGTTTGAGG + Intronic
1052156592 9:25200177-25200199 TAAAGTAAACTCCTTCTCAGTGG - Intergenic
1052648040 9:31263199-31263221 TAAGGTAGCCTCATTATTTGAGG + Intergenic
1052904032 9:33817910-33817932 TGAAGTAGCCGCCTTCGTAGAGG - Exonic
1057972325 9:99570049-99570071 GTAAGTTGCCTCTTTCTTATTGG + Intergenic
1060288744 9:122280291-122280313 TAATATAGGCTCTTTTTTAGTGG + Intronic
1060859420 9:126942002-126942024 AAGAGCAGCATCTTTCTTAGAGG - Intronic
1187038707 X:15570114-15570136 TAAAGTAACCTATTCCTTATTGG - Intronic
1191805064 X:65127219-65127241 TAAGGAAGCCCCTTTCCTAGGGG - Intergenic
1194594213 X:95837212-95837234 GAATTTAGCCTCTTTCTTAGGGG + Intergenic
1196024096 X:111021461-111021483 TCAGGAAGCCTCTTTCCTAGAGG + Intronic
1196581943 X:117390519-117390541 TGATTTAGCCTCTTTCCTAGGGG - Intergenic
1197032940 X:121840746-121840768 TAAACTAGTGTCATTCTTAGAGG + Intergenic
1197974579 X:132153126-132153148 TGAAGGAGCCTCTTGCTTAGTGG + Intergenic
1198125776 X:133642216-133642238 GAAAGCAACTTCTTTCTTAGTGG - Intronic
1198138621 X:133780344-133780366 TAAAGAAGCCTGTTTGTGAGAGG - Intronic
1198437877 X:136635101-136635123 AATAGAAGCCTCTTTATTAGAGG + Intergenic