ID: 934943299

View in Genome Browser
Species Human (GRCh38)
Location 2:98518292-98518314
Sequence GGTCCCTGGGCACCCCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934943289_934943299 19 Left 934943289 2:98518250-98518272 CCACCAGGCCACTGCCGTGTCTG 0: 1
1: 0
2: 2
3: 32
4: 313
Right 934943299 2:98518292-98518314 GGTCCCTGGGCACCCCTAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 96
934943286_934943299 22 Left 934943286 2:98518247-98518269 CCCCCACCAGGCCACTGCCGTGT 0: 1
1: 0
2: 2
3: 23
4: 225
Right 934943299 2:98518292-98518314 GGTCCCTGGGCACCCCTAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 96
934943292_934943299 5 Left 934943292 2:98518264-98518286 CCGTGTCTGCAGAGATGCCCAGA 0: 1
1: 1
2: 2
3: 27
4: 294
Right 934943299 2:98518292-98518314 GGTCCCTGGGCACCCCTAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 96
934943288_934943299 20 Left 934943288 2:98518249-98518271 CCCACCAGGCCACTGCCGTGTCT 0: 1
1: 0
2: 1
3: 9
4: 174
Right 934943299 2:98518292-98518314 GGTCCCTGGGCACCCCTAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 96
934943290_934943299 16 Left 934943290 2:98518253-98518275 CCAGGCCACTGCCGTGTCTGCAG 0: 1
1: 0
2: 2
3: 26
4: 261
Right 934943299 2:98518292-98518314 GGTCCCTGGGCACCCCTAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 96
934943287_934943299 21 Left 934943287 2:98518248-98518270 CCCCACCAGGCCACTGCCGTGTC 0: 1
1: 0
2: 1
3: 23
4: 266
Right 934943299 2:98518292-98518314 GGTCCCTGGGCACCCCTAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 96
934943291_934943299 11 Left 934943291 2:98518258-98518280 CCACTGCCGTGTCTGCAGAGATG 0: 1
1: 0
2: 2
3: 29
4: 204
Right 934943299 2:98518292-98518314 GGTCCCTGGGCACCCCTAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934943299 Original CRISPR GGTCCCTGGGCACCCCTAGT GGG Intronic
901613246 1:10516405-10516427 GGTCCCACGGCAAACCTAGTGGG - Intronic
901820253 1:11824577-11824599 GGCCTCTGGGCAGGCCTAGTGGG + Intronic
902644743 1:17790580-17790602 GGTCCATGGGCACCCATGGGCGG + Intronic
906641093 1:47440788-47440810 GGCCCCTGGGCAGCCCAAGCAGG + Intergenic
911703576 1:100984343-100984365 GTTCCCTGGGCTCCCCTTCTTGG - Intergenic
917259189 1:173148626-173148648 GATCTCTAGCCACCCCTAGTGGG - Intergenic
919931623 1:202224905-202224927 TGTCCCTGGGCTCCCCTTGGGGG - Intronic
923298928 1:232622617-232622639 GGAGCCTGGGCACCCTTAGGTGG - Intergenic
923739551 1:236642986-236643008 TGTGCCTTGGCACCCCTAGAGGG + Intergenic
1062799532 10:368937-368959 GGTGCCTGGGCGCTCCTCGTGGG + Intronic
1063120936 10:3105326-3105348 GGTGCCTGGGCTGCCCTCGTGGG + Intronic
1069575988 10:69528888-69528910 GGTCCATGGGCAGCCATAGGCGG + Intergenic
1071886051 10:89951807-89951829 GGTCCATGGGCACCCATGGAAGG + Intergenic
1075230497 10:120671937-120671959 GGTGCCTGGCAACCCCTATTGGG - Intergenic
1076999692 11:316344-316366 GGTCCCCCGGCACCCCGCGTAGG - Intergenic
1077573147 11:3356133-3356155 TGCCCCTGGGCAGCCCGAGTAGG + Intronic
1078827574 11:14944771-14944793 CCTCACTGAGCACCCCTAGTTGG - Intronic
1081997257 11:47373774-47373796 GATGCCTGGGCACCCCATGTTGG - Intronic
1084068920 11:66721280-66721302 GGTCCCTGGACACCCCTCACTGG - Intronic
1090828831 11:130406716-130406738 GGTGCCTGGGCACTCCCAGAAGG - Intronic
1100362381 12:93890577-93890599 GGTCCCTGGGCAGGACTTGTGGG + Intronic
1101400387 12:104382001-104382023 GGGCCCTGGGTACCACTAGGTGG + Intergenic
1106303818 13:28493973-28493995 GGGCCCTGGGCTGCCCTTGTGGG + Intronic
1107943307 13:45394168-45394190 TCTCCCTGGGCAACCCTAGAGGG - Exonic
1108046916 13:46391892-46391914 GGGCCCTGGGCACCCCTAAATGG - Intronic
1113618395 13:111696855-111696877 GGTACCTGGGCACCGCTATTTGG - Intergenic
1113623927 13:111782116-111782138 GGTACCTGGGCACCGCTATTTGG - Intergenic
1118417878 14:65563163-65563185 GTTCCCTGAGTACCCCAAGTAGG - Intronic
1123018492 14:105386692-105386714 GGTCCCTGGGGCCCCCTTGCTGG + Intronic
1129688339 15:77698907-77698929 GGCCCCTGGACTGCCCTAGTGGG + Intronic
1133325739 16:4941110-4941132 GTTCCCTGGGAACCCCTCTTGGG - Intronic
1141751521 16:85961550-85961572 GATCCCTGAGCACCCCTTGATGG - Intergenic
1145270279 17:21401177-21401199 GGTCCTTGGGCAGCCCTCCTGGG + Intronic
1148862150 17:50610034-50610056 GGTCCCTGGGGCCCCCAAGAGGG + Intronic
1151227555 17:72658186-72658208 ACTCCCTTGGCACCCCTTGTGGG - Intronic
1155376584 18:25164738-25164760 CCTCCCTGGGCACCCCCAGGAGG + Intronic
1158583632 18:58708330-58708352 GATGGCTGGTCACCCCTAGTGGG - Intronic
1160802682 19:977521-977543 GGTTCCTGGGCTCGCCTAGGAGG - Intergenic
1161221087 19:3118597-3118619 GGTCCCTGGGCACCCATCGCAGG + Intronic
1161976693 19:7611465-7611487 GGACCCTGGGAACCCTGAGTGGG - Intronic
1165073875 19:33270131-33270153 GGTCACTGGGTCCCCCTAGCTGG + Intergenic
1166720918 19:44995350-44995372 GGTCACTGTGCACCCACAGTAGG - Intergenic
925995433 2:9288832-9288854 GGTCTCAGAGCACCCCTAGGAGG + Intronic
926832033 2:16973909-16973931 AGTCCCTTGGCACACCTAGCTGG - Intergenic
927211415 2:20641244-20641266 GGGCCTTGGGAACCCCTGGTCGG - Intronic
932003649 2:67906931-67906953 GGCCCCTGGACTGCCCTAGTTGG - Intergenic
934943299 2:98518292-98518314 GGTCCCTGGGCACCCCTAGTGGG + Intronic
935635686 2:105248125-105248147 GGTGGCTGGGGACCCCTAGGTGG - Intergenic
936008939 2:108912465-108912487 GGTCCCAGGACACCCATAGAGGG + Intronic
945905515 2:215588444-215588466 GGTCCATAGGCTCCCCTAGATGG - Intergenic
946689773 2:222301403-222301425 GGTCCCTGGACACCCGGAGAGGG + Intronic
1171861540 20:30405761-30405783 TCTCCCTGGCCACCCCTACTGGG + Intergenic
1172177881 20:32983665-32983687 GGTGCCTGGGCACCCGGAATGGG + Intergenic
1172201910 20:33132596-33132618 GGGCCCTGGGTGCCCCTGGTGGG + Intergenic
1178276725 21:31245538-31245560 GGTGCCTGAGCACCCCAAGAAGG - Exonic
1179156750 21:38857658-38857680 GGTCCCTGGGCATCCCTGGGAGG + Intergenic
1180842444 22:18965659-18965681 GGTCCCTGGGCACCCCACTCTGG - Intergenic
1183418498 22:37696787-37696809 GCTCCCTGGGGACCCCCAGCGGG + Intronic
1185322708 22:50209251-50209273 GGTCCCCCGGAACCCCTACTTGG - Intronic
950110111 3:10413340-10413362 CATCCCTGGGCTCCCCCAGTGGG - Intronic
950211165 3:11124598-11124620 GGTCCCTGTGCAGCCCTGGTGGG - Intergenic
952886916 3:38017751-38017773 GGCCCCTGGGCACTCAGAGTGGG - Intronic
953766572 3:45747517-45747539 GGTCCGTGGGCAGCCATAGGTGG - Intergenic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
954093183 3:48301428-48301450 GCTCCCTGGGCAGCCCTGCTCGG + Intronic
956894852 3:73649026-73649048 GGCCCCTGGGGCCCCCTAATTGG + Intergenic
961525829 3:127496742-127496764 GGTCCGTGGGCAGCCATGGTCGG - Intergenic
961673481 3:128550867-128550889 GGTCCCTGCCCACCCATACTGGG + Intergenic
963268697 3:143264936-143264958 GAACCCTGGTCATCCCTAGTGGG + Intergenic
964443163 3:156732870-156732892 GGTCTGTGGGCACCCAGAGTAGG + Intergenic
967877194 3:194275588-194275610 GGTCCCTGGACTCCCCTTGCTGG - Intergenic
967888024 3:194346330-194346352 GTGCCCTTGGCACCCCTTGTGGG + Intronic
968231076 3:197004929-197004951 GGTCCCTGGGCTTCCCTAGGGGG - Intronic
970676728 4:18459040-18459062 GGACCCTGGGCATCCCCTGTTGG - Intergenic
976030775 4:80751258-80751280 GGTGGCTGGGGACCCCTATTGGG + Intronic
981311190 4:143299563-143299585 TGTCCCTGGGGACTCCTTGTTGG - Intergenic
984734604 4:183098425-183098447 GGTCCCTGGCCTCCCCTGCTTGG - Intergenic
985759366 5:1737276-1737298 GGTCCCAGGGACCCCCTAGTGGG + Intergenic
986236278 5:5913888-5913910 GGTCCCTGGGGCCTCCCAGTGGG + Intergenic
988730699 5:33970028-33970050 GCTCCCTGGTCACCACTAGGAGG - Intronic
993843110 5:92905719-92905741 GGTGCCTTGGCAGCACTAGTGGG + Intergenic
994242770 5:97444199-97444221 GGTCTCTGGCCACCCCTTGCTGG - Intergenic
995421523 5:111972753-111972775 GATCCCTTGGCTCCCCTAGTGGG - Intronic
997260786 5:132464271-132464293 GCTCCCTGGGCACCCTCAGAGGG - Exonic
997512091 5:134460878-134460900 GATCCCTGGGCAGCCCTAAGTGG - Intergenic
1001638996 5:173232290-173232312 AGTCCATGGGCACCCCCGGTTGG - Exonic
1003349817 6:5305651-5305673 GGTGACTGGGGACCCCAAGTTGG + Intronic
1022423431 7:30245947-30245969 GGTCCATGGGCAGCCATAGGTGG + Intergenic
1023856381 7:44186719-44186741 GGGCCCTGGGCATCCCTCTTGGG - Intronic
1027052142 7:75027313-75027335 GATCCCTGGGCGCCCTTATTTGG + Intronic
1029347323 7:99987927-99987949 GGTTCCTGGGCACCCTGACTTGG + Intergenic
1031372749 7:120987762-120987784 GCTAGCTGGGCACCCCTAGGGGG + Intergenic
1033151552 7:138919061-138919083 CTTCCCTGGGCAGCCCTGGTGGG + Exonic
1035699533 8:1627382-1627404 GGTCCCTGGGCACCACGGGAGGG + Intronic
1050947951 9:11549865-11549887 GGTCAGTGGGCAGCCATAGTGGG - Intergenic
1051374278 9:16388229-16388251 GGTCCCTCAGCTGCCCTAGTGGG - Intergenic
1057466955 9:95323075-95323097 AGTTGCTGGCCACCCCTAGTCGG - Intergenic
1059092057 9:111370066-111370088 AGTTCCTGGGCACCGCTAGATGG - Intronic
1061122297 9:128651069-128651091 GGTGCTTGGGCACTCCTTGTAGG - Intronic
1061145722 9:128797222-128797244 AGTCCCTGGGGACCCCAGGTTGG - Intronic
1061277593 9:129578415-129578437 GTTCCTAGTGCACCCCTAGTAGG - Intergenic
1061475549 9:130863481-130863503 GTGCCCTGGGCATCCCCAGTGGG + Intronic
1062427213 9:136511553-136511575 TGTTCCTGGGCACGCCTGGTGGG - Intronic
1062501869 9:136855180-136855202 GGTCCCTGTCCACCCGCAGTGGG - Intronic
1190651237 X:52570749-52570771 AGTCCCTGTGCACTCATAGTAGG + Intergenic
1192213171 X:69140484-69140506 AGTCCTTGGGCACCACTAGTGGG + Intergenic
1192338336 X:70240247-70240269 GGTCTCTGAGCAGCCATAGTGGG - Exonic