ID: 934945610

View in Genome Browser
Species Human (GRCh38)
Location 2:98539097-98539119
Sequence CACAATGATAAGCAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934945610 Original CRISPR CACAATGATAAGCAGCAGAG AGG (reversed) Intronic
900700614 1:4046624-4046646 CACACTGATGAGGAGTAGAGAGG + Intergenic
901315630 1:8305838-8305860 TACAATGGTTAGCAGCAGAGTGG + Intergenic
902046411 1:13528020-13528042 CACGTTGGTAAGCAGGAGAGAGG - Intergenic
902601491 1:17542569-17542591 CACACTGAGAAGGAACAGAGTGG + Intronic
904590627 1:31613510-31613532 CCCAGTAGTAAGCAGCAGAGTGG + Intergenic
905267580 1:36765276-36765298 CACAGTGAGGAGAAGCAGAGGGG - Intergenic
906132407 1:43468579-43468601 CCCAATGACCAGCTGCAGAGAGG - Intergenic
906635809 1:47409772-47409794 CCCTATGATAGGCTGCAGAGGGG - Intergenic
907803073 1:57790607-57790629 CACAATTCTAGGCAGCACAGAGG + Intronic
908802702 1:67896934-67896956 CTCAATGATAGGGGGCAGAGTGG - Intergenic
908979926 1:69943411-69943433 CACAATGACAAACAGTAGATTGG + Intronic
909080127 1:71100578-71100600 CCCAAAGGTATGCAGCAGAGGGG - Intergenic
909837581 1:80276450-80276472 CAAAAAGAAGAGCAGCAGAGTGG + Intergenic
910048940 1:82954559-82954581 CACAGTGATCAGCAACAGAATGG - Intergenic
912583972 1:110745083-110745105 CACTATGTTATGGAGCAGAGAGG + Intergenic
915886726 1:159730398-159730420 CACAATAAAAAGCAGCAGTTTGG + Intergenic
916206295 1:162319215-162319237 CACAAATGTAAGCAGCAGAATGG + Intronic
917315992 1:173726169-173726191 CACACTGTAAAGCAGCAGCGAGG + Intronic
918374728 1:183897742-183897764 CACAATGGTAAGAAGTAAAGAGG - Intronic
919564838 1:199171741-199171763 CACAAATATAAGCAGGAAAGGGG - Intergenic
919998993 1:202780937-202780959 CACAATAATAAGGAGAAAAGAGG + Intronic
920060936 1:203226472-203226494 CAAACAGATAAGTAGCAGAGAGG + Intronic
920707014 1:208258967-208258989 CACCATCTCAAGCAGCAGAGGGG + Intergenic
920834159 1:209492491-209492513 CACTATGCTAAGCACCAGTGAGG + Intergenic
921097831 1:211902049-211902071 CAGGATGATCAGCTGCAGAGAGG + Intergenic
922201691 1:223408354-223408376 TAAAATGACAAGCTGCAGAGTGG + Intergenic
923603487 1:235423411-235423433 CATAATGGGAAGCAGCAGTGAGG + Intronic
1065479283 10:26176336-26176358 CACAATCAAAGGCAGCAGAGGGG + Intronic
1066223887 10:33363148-33363170 AAAAATGATAAGCAGAAGAGGGG - Intergenic
1066273506 10:33846251-33846273 CACTAGGCAAAGCAGCAGAGAGG + Intergenic
1067775305 10:49160462-49160484 CATAAGGATAAAAAGCAGAGGGG + Intronic
1068279858 10:54854599-54854621 CAGGATGATCAGCTGCAGAGAGG - Intronic
1068624198 10:59223053-59223075 CACAATGATTAGTTACAGAGTGG - Intronic
1068739470 10:60452162-60452184 CACAGTGCAAACCAGCAGAGTGG + Intronic
1069198299 10:65581736-65581758 CACAACAAGAAGCAGCAGTGGGG + Intergenic
1069998569 10:72358964-72358986 GACCAAGATGAGCAGCAGAGGGG - Intergenic
1071044880 10:81361538-81361560 CACAATGATATCTAGAAGAGTGG + Intergenic
1075940914 10:126389264-126389286 GACCATGAAAAGCAGCAGCGAGG + Intergenic
1077813777 11:5665607-5665629 AATAATGATAAGCCGCAGGGTGG + Intronic
1079674126 11:23203244-23203266 CACAATGGGAAGCAACAGTGGGG + Intergenic
1079854760 11:25588656-25588678 CGCTATGATCAGAAGCAGAGTGG - Intergenic
1080070399 11:28077282-28077304 CTCAATGATAAACAGCAAATAGG + Intronic
1080240480 11:30121832-30121854 CACAGTGATACCCAGCAGGGTGG + Intergenic
1086001246 11:81988152-81988174 CACAATGGCAAGAAGCATAGTGG - Intergenic
1086549351 11:88037287-88037309 CAAAATGAAATGCTGCAGAGGGG - Intergenic
1088422177 11:109660386-109660408 CAGAATGATAGGCAGGAGAGGGG + Intergenic
1090124873 11:124075399-124075421 CAGGATGATCAGCAGCAGAGAGG - Intergenic
1090717338 11:129442031-129442053 CACCATGATTAGCAGTAGAATGG + Intronic
1092276003 12:7061368-7061390 CGCAATGATAAACAGCAGACAGG + Intronic
1094761874 12:33542929-33542951 CACTATGAAAAGCAGTATAGAGG + Intergenic
1095587805 12:43867442-43867464 GACAAGGATAAACAGCAAAGTGG + Intronic
1098082595 12:66804827-66804849 CATATTAATAAGCAGCAAAGTGG + Intergenic
1098465606 12:70783433-70783455 CAGAATGATCAGCTACAGAGAGG - Intronic
1101415312 12:104503691-104503713 CACCATCATAATCAGGAGAGCGG - Intronic
1102499380 12:113340906-113340928 CAGCATGATGGGCAGCAGAGGGG + Intronic
1103434542 12:120914773-120914795 CTCAATGATAATCTGCAGAAGGG + Intergenic
1104212729 12:126705374-126705396 CACATGAATAAGCAGCAAAGGGG - Intergenic
1104965134 12:132505526-132505548 CACCATGACAGGCAGCAGCGTGG - Intronic
1108146322 13:47480956-47480978 CACAAAGTTTGGCAGCAGAGTGG - Intergenic
1109776458 13:67047553-67047575 CAAATTCATAGGCAGCAGAGTGG - Intronic
1111122840 13:83877901-83877923 CACCAACAAAAGCAGCAGAGAGG + Exonic
1112299956 13:98221004-98221026 CTCAATGATAAGAAACGGAGGGG + Intronic
1114069585 14:19096928-19096950 CACAATGACAAGATCCAGAGAGG - Intergenic
1114092675 14:19303075-19303097 CACAATGACAAGATCCAGAGAGG + Intergenic
1115102822 14:29723575-29723597 CACAATGCTAAGCAATAGAGTGG + Intronic
1115152794 14:30304569-30304591 TACAATGATAATCCACAGAGAGG - Intergenic
1116075739 14:40108487-40108509 CTGCAGGATAAGCAGCAGAGAGG - Intergenic
1116301325 14:43187653-43187675 CACAATAATAAAAAGAAGAGGGG + Intergenic
1117097790 14:52315153-52315175 GACAATGAGAAGCAGCAGCAGGG - Exonic
1118464074 14:66014936-66014958 CACAAAGGTAAGGAGCAGAATGG - Intergenic
1119615518 14:76096333-76096355 AATAATGATAAGCAGGAGAGTGG - Intergenic
1122190400 14:100038055-100038077 CTCACTGAAAAGCAGCAGAATGG - Intronic
1122997970 14:105275902-105275924 CACAGTGAGAAGGAGCTGAGAGG + Intronic
1122997981 14:105275955-105275977 CACAGTGAGAAGGAGCTGAGAGG + Intronic
1122997994 14:105276008-105276030 CACAGTGAGAAGGAGCTGAGAGG + Intronic
1122998005 14:105276061-105276083 CACAGTGAGAAGGAGCTGAGAGG + Intronic
1122998018 14:105276114-105276136 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998030 14:105276167-105276189 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998042 14:105276220-105276242 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998056 14:105276273-105276295 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998068 14:105276326-105276348 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998080 14:105276379-105276401 CACAGTGAGAAGGAGCTGAGAGG + Intronic
1122998093 14:105276432-105276454 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998105 14:105276485-105276507 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998119 14:105276538-105276560 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998131 14:105276591-105276613 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998145 14:105276644-105276666 CACAGTGAGAAGGAGCTGAGAGG + Intronic
1122998156 14:105276697-105276719 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998168 14:105276750-105276772 CACAGTGAGAAGGAGCTGAGAGG + Intronic
1122998179 14:105276803-105276825 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998191 14:105276856-105276878 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998203 14:105276909-105276931 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998219 14:105276962-105276984 CACAGTGAGAAGGAGCTGAGAGG + Intronic
1122998232 14:105277015-105277037 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998244 14:105277068-105277090 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998256 14:105277121-105277143 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998272 14:105277174-105277196 CACAGTGAGAAGGAGCTGAGAGG + Intronic
1122998285 14:105277227-105277249 CACAGTGAGAAGGAGCTGAGAGG + Intronic
1122998298 14:105277280-105277302 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998310 14:105277333-105277355 CACAGTGAGAAGGAGCTGAGAGG + Intronic
1122998323 14:105277386-105277408 CACAGTGAGAAGGAGCCGAGAGG + Intronic
1122998335 14:105277439-105277461 CACAGTGAGAAGGAGCTGAGAGG + Intronic
1122998348 14:105277492-105277514 CACAGTGAGAAGGAGCTGAGAGG + Intronic
1122998359 14:105277545-105277567 CACAGTGAGAAGGAGCTGAGAGG + Intronic
1128128147 15:65207887-65207909 CACAGCAATAAGTAGCAGAGTGG - Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128706752 15:69842414-69842436 CACAAGTATGAGGAGCAGAGAGG + Intergenic
1128918790 15:71592189-71592211 CACCATGGGAAGAAGCAGAGAGG + Intronic
1129086534 15:73099058-73099080 GAAAATGATATGCAGCAGTGTGG + Intronic
1129977237 15:79832517-79832539 CACATTGACAAAGAGCAGAGTGG - Intergenic
1131382997 15:91980045-91980067 CAAAAGGAAAAGCAACAGAGAGG + Intronic
1133121857 16:3613629-3613651 AAGAATGATAAGCAGCCCAGAGG + Intronic
1133126354 16:3648925-3648947 CAAAATGAAAAGAAGAAGAGAGG - Intronic
1134261669 16:12655870-12655892 CACAATGAAACACAGCACAGAGG + Intergenic
1136644999 16:31606163-31606185 CACAATCAGAAGCAACAAAGGGG + Intergenic
1137256424 16:46778624-46778646 CAGGATGATCAGCTGCAGAGAGG + Intronic
1138382941 16:56616417-56616439 AACAATTGTAAGCAGCACAGTGG + Intergenic
1138406359 16:56797582-56797604 GACAATGAACAGCAGCAAAGAGG + Intronic
1140561461 16:75987050-75987072 CACAATGACAATCTGCAGAATGG + Intergenic
1141321410 16:83012960-83012982 CACAAAGACAATCAGCAGAGTGG - Intronic
1141828468 16:86496841-86496863 GAAAATGAAAAGGAGCAGAGCGG + Intergenic
1141949218 16:87330034-87330056 CACAAGGACAAGCGGCAGAGAGG + Exonic
1145067066 17:19768766-19768788 ACCAATGGTGAGCAGCAGAGGGG - Intergenic
1147476200 17:40713921-40713943 CACTATGATGAACAGCTGAGAGG + Intergenic
1149482890 17:57017894-57017916 CAGGATGATCAGCTGCAGAGAGG - Intergenic
1152946069 17:83198110-83198132 TAAAATAATAAGCAGCAGACTGG - Intergenic
1153729419 18:7993867-7993889 CTCAAAGATAAACATCAGAGAGG + Intronic
1155561665 18:27084497-27084519 CACAATCAGAAGCAACAAAGGGG - Intronic
1155885607 18:31204928-31204950 TACAATGATAAACAGGAGAGGGG + Intergenic
1156908084 18:42378851-42378873 CACAATTAAAAGAACCAGAGAGG - Intergenic
1157392220 18:47312395-47312417 CAGAATGACAAGCAGCAGCCTGG + Intergenic
1157887642 18:51384154-51384176 AAGAATCATAACCAGCAGAGAGG - Intergenic
1159039075 18:63306246-63306268 CACAATGATTAGGACTAGAGTGG - Intronic
1159419276 18:68195627-68195649 CACAATGGCAGGCAGGAGAGTGG + Intergenic
1159450499 18:68595544-68595566 CACAGTGACAAGTAGCACAGGGG + Intergenic
1159801436 18:72905499-72905521 AACAATGATAAGGAGAAGAAAGG - Intergenic
1160606204 18:80051343-80051365 CACAATGATGAGCTGAAGAAAGG + Intronic
1163347368 19:16752013-16752035 AAAAATAACAAGCAGCAGAGAGG + Intronic
1164395074 19:27855740-27855762 CACAATGAAAATAACCAGAGAGG + Intergenic
1165311694 19:35032421-35032443 CTCAATGATTACCAGCAGACAGG - Intronic
1167621635 19:50564043-50564065 CACAAAGAGATGGAGCAGAGAGG + Intronic
925870073 2:8262739-8262761 CCCAGACATAAGCAGCAGAGTGG - Intergenic
926277529 2:11416051-11416073 CACAGTGATGTTCAGCAGAGGGG + Intergenic
927890674 2:26746225-26746247 CAAAATGATAAGCAGAATAAAGG - Intergenic
928351130 2:30556325-30556347 TACAAAGACAGGCAGCAGAGTGG + Intronic
928789399 2:34932879-34932901 GACAATGATAAGCATTACAGGGG - Intergenic
928986979 2:37191463-37191485 CACAATGGAAAGCAGCAGCCAGG - Intronic
932052535 2:68413029-68413051 CACCATGTTAAGCATCAGAAAGG - Intergenic
932393653 2:71421755-71421777 TATAATGAGAAGCAGCAGATTGG - Intronic
932859105 2:75270041-75270063 CACTATGAAAAGCAGCATGGAGG - Intergenic
934153869 2:89176378-89176400 CACACTGAAAATCAGCAGGGTGG - Intergenic
934158074 2:89221748-89221770 TACACTGAAAATCAGCAGAGTGG - Intergenic
934160491 2:89244831-89244853 CACACTGAAAATCAGCAGGGTGG - Intergenic
934169683 2:89330166-89330188 CACACTGAAAATCAGCAGGGTGG - Intergenic
934197609 2:89852419-89852441 CACACTGAAAATCAGCAGGGTGG + Intergenic
934206785 2:89937607-89937629 CACACTGAAAATCAGCAGGGTGG + Intergenic
934209190 2:89960676-89960698 TACACTGAAAATCAGCAGAGTGG + Intergenic
934213366 2:90005557-90005579 CACACTGAAAATCAGCAGGGTGG + Intergenic
934945610 2:98539097-98539119 CACAATGATAAGCAGCAGAGAGG - Intronic
937679235 2:124626420-124626442 GAGAATGAGAAGAAGCAGAGTGG + Intronic
938909632 2:135874976-135874998 CATAATGAAAGGAAGCAGAGTGG + Intronic
941039545 2:160605076-160605098 CACAAGGGGAAGCACCAGAGTGG - Intergenic
941738998 2:169012883-169012905 CACAAAGCTAAGGGGCAGAGGGG + Intronic
942977272 2:182033106-182033128 AACAATGTTAAGTAGTAGAGAGG - Intronic
944211108 2:197207470-197207492 CAGAATGATAAAAATCAGAGGGG - Intronic
946648376 2:221865188-221865210 CACACTGAAAAGCAGGGGAGTGG - Intergenic
946847110 2:223869151-223869173 CACAAACATAAGCTGCAAAGTGG + Intronic
947217147 2:227759817-227759839 CAGAAAGAGAAGCAGCGGAGGGG - Intergenic
948721088 2:239900458-239900480 GACAAAGATAAGCAGAGGAGTGG - Intronic
1169523765 20:6401017-6401039 CACAATGATGAGGAGAAGTGGGG + Intergenic
1169901692 20:10559245-10559267 CAACATGAAAAGCAGGAGAGAGG + Intronic
1170129959 20:13008803-13008825 CACAATTACATGCAGGAGAGAGG + Intergenic
1172782033 20:37442532-37442554 CACAATGATGACCAGCAAAGTGG + Intergenic
1173209604 20:41021929-41021951 AACAATCACAGGCAGCAGAGGGG - Intergenic
1175303663 20:57961005-57961027 CACAGGGAAAAGCAGCACAGAGG + Intergenic
1175581279 20:60101866-60101888 AACAATCATAAGTATCAGAGCGG - Intergenic
1180488054 22:15819491-15819513 CACAATGACAAGATCCAGAGAGG - Intergenic
1180820177 22:18821671-18821693 GACAAGGATAAGGAGCAGAAGGG + Intergenic
1181206400 22:21256143-21256165 GACAAGGATAAGGAGCAGAAGGG + Intergenic
1181488605 22:23247359-23247381 CACAGAGATCATCAGCAGAGTGG - Intronic
1181509749 22:23383858-23383880 CACAAGGTCAGGCAGCAGAGCGG + Intergenic
1182781226 22:32869591-32869613 CAAAAAGATACGCTGCAGAGAGG + Intronic
1184544203 22:45155119-45155141 CACAAGGAGAGGCAGCATAGAGG - Intergenic
1203220520 22_KI270731v1_random:39280-39302 GACAAGGATAAGGAGCAGAAGGG - Intergenic
1203270304 22_KI270734v1_random:47542-47564 GACAAGGATAAGGAGCAGAAGGG + Intergenic
949119640 3:370670-370692 CACAATTAAAAGAACCAGAGAGG - Intronic
949884566 3:8683020-8683042 CGCAATGATTAGAAGCAGAGTGG + Intronic
951088935 3:18549398-18549420 CAAAAAGACAAGCAGCAGACTGG - Intergenic
951886954 3:27533802-27533824 CACAATTAAAACAAGCAGAGGGG + Intergenic
951914862 3:27789659-27789681 CACAGAGAGAAGCAGCAGAATGG - Intergenic
952836978 3:37611330-37611352 CAGAAGGATAAGGAGCAGTGGGG + Intronic
954480257 3:50793255-50793277 CACAATTAGAAACAGCAAAGGGG - Intronic
955467344 3:59250903-59250925 CACAAAGAAAAGAAGGAGAGAGG + Intergenic
958636283 3:96750778-96750800 TGGAATGATCAGCAGCAGAGAGG + Intergenic
959572040 3:107895235-107895257 CACAACGATACCCAGCAGAGGGG + Intergenic
959582678 3:107997939-107997961 ACCAATGATAAGCAACTGAGTGG - Intergenic
963048218 3:141119979-141120001 CACAATGAAAAGAACTAGAGAGG - Intronic
966572701 3:181464103-181464125 GACAATGCAAAGCATCAGAGAGG + Intergenic
967782220 3:193452152-193452174 GACAATGAGAAGCAGCAGCATGG + Intronic
968460067 4:720383-720405 CACAAGGGAGAGCAGCAGAGTGG + Intronic
969387370 4:6863374-6863396 CAGAATGATCAGCCGAAGAGTGG + Exonic
970042343 4:11810348-11810370 CACAATGAAAAGGAGATGAGAGG - Intergenic
970354805 4:15241071-15241093 CACAATGATGTACAACAGAGAGG + Intergenic
972896964 4:43634357-43634379 CACAACTATCAGCAGCAGATGGG + Intergenic
974295525 4:59994284-59994306 CACCATGAGAAGCAACAGTGTGG - Intergenic
975026333 4:69553411-69553433 CACAATTACAAACAACAGAGGGG + Intergenic
976407543 4:84677302-84677324 CCCAGTGATCAGCAGCAGAACGG + Exonic
976975606 4:91162996-91163018 CACAATAAAAAGAAGTAGAGAGG - Intronic
978317725 4:107458261-107458283 CACAAGGTATAGCAGCAGAGAGG + Intergenic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
979873653 4:125858964-125858986 CAGAATGATAAGTACAAGAGTGG - Intergenic
981767481 4:148267516-148267538 AACAATGGTAAGCAGAAGAAAGG + Intronic
983220347 4:165038086-165038108 CAGATTGATGAGCAGCAGATAGG + Intronic
984612899 4:181860645-181860667 CACATTTATAATCAGCAGACAGG - Intergenic
987448326 5:18049667-18049689 CACTATGATCGGAAGCAGAGTGG + Intergenic
987626987 5:20414908-20414930 CACAATGGAAAACAGCATAGAGG + Intronic
988709720 5:33761399-33761421 CACAATGATTTGTGGCAGAGGGG + Intronic
990885473 5:60586995-60587017 GACCATGATAAGAAGCACAGAGG - Intergenic
991246851 5:64517649-64517671 CACACTGAAAAGCAGAACAGGGG + Intronic
993292027 5:86085327-86085349 CACAATGATAATTAGCATACTGG - Intergenic
994503636 5:100611912-100611934 CACAATTAGAAACAGCAAAGGGG - Intergenic
996217457 5:120887086-120887108 CACAATGGGAAGCAGCAGTGGGG - Intergenic
997001892 5:129771459-129771481 CACCATGATAAAGAGCAGAAGGG + Intergenic
1000697282 5:164403292-164403314 CACAAAGAGAAGCAGCAGCATGG + Intergenic
1001348064 5:170926591-170926613 TAAAATGATATGCAGCAGACAGG - Intronic
1003460527 6:6324077-6324099 CACAATTAGCAACAGCAGAGAGG + Intergenic
1003688059 6:8324026-8324048 CATACTGGAAAGCAGCAGAGTGG - Intergenic
1004804296 6:19185169-19185191 CATAATCATAAACAGCAAAGAGG + Intergenic
1007119611 6:39369132-39369154 CACAATGGTCAGCAGCTCAGAGG + Intronic
1008131944 6:47728883-47728905 CACAAAGAAAAACTGCAGAGAGG + Intergenic
1008690556 6:53973921-53973943 CACAATGCTGGGCAGCAGAAGGG + Intronic
1011044417 6:83066015-83066037 CACGCTCATAAGAAGCAGAGTGG - Intergenic
1011478647 6:87772640-87772662 CACAATGAAAACCAGCAGTGTGG + Intergenic
1014984554 6:127986953-127986975 CACAATGATAAGCATCACCATGG + Intronic
1015450212 6:133358853-133358875 CACTATGAGAAGAAACAGAGGGG + Intronic
1015522477 6:134145641-134145663 CACAGGGACAAGAAGCAGAGGGG - Intergenic
1016686316 6:146886278-146886300 CACAATGAAGAGAAGAAGAGGGG - Intergenic
1016893871 6:149033616-149033638 CACACTGATGAGAAGAAGAGAGG + Intronic
1018263237 6:161991380-161991402 CACAATGATAAACAACAAAAGGG + Intronic
1019411456 7:908537-908559 CACAGTGAGAAGCAGGAGAAGGG - Intronic
1022044312 7:26611078-26611100 CACAATGAGGAGGAGAAGAGGGG - Intergenic
1022073125 7:26937461-26937483 CATAATCAGAAGCAGCAGAATGG + Intronic
1023964499 7:44955896-44955918 GACCAAGATAAGCAGCAGGGTGG - Intergenic
1024360887 7:48466941-48466963 CACAATGAACAGCAGCAGTGGGG + Exonic
1024657750 7:51466181-51466203 CATAAAGAAAAGCATCAGAGAGG - Intergenic
1025030904 7:55556044-55556066 CTCATAGGTAAGCAGCAGAGGGG - Intronic
1026500838 7:70942153-70942175 GACAATAATAAACAGCACAGTGG + Intergenic
1029045899 7:97628176-97628198 TACAATGATAAGCAACAGAGAGG - Intergenic
1031878339 7:127167230-127167252 CATGATGATAAGGAGCAGACTGG - Intronic
1033469353 7:141630791-141630813 GACACTGACAAGCAACAGAGGGG + Intronic
1033548221 7:142421580-142421602 CACATAAAGAAGCAGCAGAGGGG - Intergenic
1035724210 8:1814423-1814445 AAAAAAGAGAAGCAGCAGAGAGG - Intergenic
1042015890 8:64310712-64310734 CACAATGAGAAACCGCAGAATGG + Intergenic
1043346057 8:79299091-79299113 CATAATGATAAGCATGAGAGAGG + Intergenic
1043712790 8:83443439-83443461 CACAATTATCAGCTGCAGAGTGG + Intergenic
1043968411 8:86504836-86504858 CTAAATAATAAGCAGCAGAGGGG - Intronic
1046515201 8:115250459-115250481 GACAAAGATAAGCTGCAGAAAGG - Intergenic
1046791821 8:118330723-118330745 CTCAATGAAAAGCAGTAAAGAGG + Intronic
1046957150 8:120073436-120073458 CACAATCACAAGCAGCAGGAGGG + Intronic
1046972995 8:120243509-120243531 AAAAATGATAAGCAGCAGGCTGG + Intronic
1047618087 8:126579891-126579913 CTCAATGAGATGCAGCAGAAAGG - Intergenic
1047924756 8:129671878-129671900 CCCAAGGACAAGCAGCAGTGGGG + Intergenic
1048421680 8:134283954-134283976 CAGAATGATCAACTGCAGAGAGG - Intergenic
1049158180 8:141079927-141079949 CACAATGACAAGTATCATAGAGG - Intergenic
1049362209 8:142217443-142217465 CACCATGGACAGCAGCAGAGGGG - Intronic
1051389656 9:16550735-16550757 CAGAAGTATAAGCAGCATAGTGG + Intronic
1051994492 9:23198602-23198624 CATAATGATAATCAACAGAAAGG + Intergenic
1052789481 9:32861527-32861549 CACAGTGATGAGTGGCAGAGTGG - Intergenic
1055231494 9:74072278-74072300 CCCAATGATAAGGCACAGAGTGG - Intergenic
1056295752 9:85191457-85191479 CACAATGGTATTCAGCAGAATGG + Intergenic
1057861868 9:98647020-98647042 CACAATGAGAAGAGGCAGGGAGG + Intronic
1058871001 9:109201692-109201714 CACAAAGATGAGAGGCAGAGTGG + Intronic
1059560466 9:115329765-115329787 CACAGTTTTAAGCAACAGAGTGG + Intronic
1060105768 9:120872356-120872378 CACAGTGATCAGCTGAAGAGTGG - Intronic
1060259290 9:122059938-122059960 CACTATGACAAGCAGCTGTGGGG - Intronic
1060409098 9:123388397-123388419 AAAAATAAAAAGCAGCAGAGGGG - Intronic
1061720167 9:132546518-132546540 CACACTGAAAAGCAGCAGGCAGG + Intronic
1188119244 X:26284365-26284387 CACAATGAAAAGAACTAGAGAGG - Intergenic
1188708351 X:33363243-33363265 AAAAATAATAAGCAGAAGAGAGG + Intergenic
1189060499 X:37747959-37747981 CACAATTAAAAGAACCAGAGGGG + Intronic
1189209651 X:39274128-39274150 CACAATTAAAAGAAGTAGAGAGG - Intergenic
1190217902 X:48492477-48492499 CACCATGATAGGAAGCAGAAGGG + Intergenic
1191035543 X:56022696-56022718 CACAGTGAAAAGCAGCAACGTGG + Intergenic
1192887551 X:75351499-75351521 CACAATGAAAAGAACTAGAGAGG - Intergenic
1193467612 X:81867960-81867982 TAGGATGATCAGCAGCAGAGAGG - Intergenic
1194524536 X:94962599-94962621 CGCAATGTTAATCATCAGAGTGG + Intergenic
1195837623 X:109135757-109135779 CTCAATGAAAAGCAGTAAAGTGG + Intergenic
1197023730 X:121721583-121721605 CAAAATGAAGAGCAGCAGAAAGG - Intergenic
1197464486 X:126785846-126785868 AACAAGTATAAGCAGCTGAGTGG - Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1200669159 Y:6065909-6065931 AACAAACATAAGCAGTAGAGTGG - Intergenic
1200836204 Y:7734272-7734294 CACCATGATAAACATCAGACTGG - Intergenic