ID: 934947367

View in Genome Browser
Species Human (GRCh38)
Location 2:98551563-98551585
Sequence TTCCCAGGGAAGTCCCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934947367_934947381 30 Left 934947367 2:98551563-98551585 CCACTTTGGGACTTCCCTGGGAA 0: 1
1: 0
2: 2
3: 15
4: 247
Right 934947381 2:98551616-98551638 CCAAGGTGACTGTCATCTCCAGG 0: 1
1: 0
2: 1
3: 16
4: 187
934947367_934947377 13 Left 934947367 2:98551563-98551585 CCACTTTGGGACTTCCCTGGGAA 0: 1
1: 0
2: 2
3: 15
4: 247
Right 934947377 2:98551599-98551621 AAGATTCTCAGCCCTGACCAAGG 0: 1
1: 0
2: 1
3: 14
4: 174
934947367_934947373 -10 Left 934947367 2:98551563-98551585 CCACTTTGGGACTTCCCTGGGAA 0: 1
1: 0
2: 2
3: 15
4: 247
Right 934947373 2:98551576-98551598 TCCCTGGGAAGGGGCCAATGGGG 0: 1
1: 0
2: 5
3: 38
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934947367 Original CRISPR TTCCCAGGGAAGTCCCAAAG TGG (reversed) Intronic
900785887 1:4650229-4650251 ACACCAGGGAAGCCCCAAAGGGG - Intergenic
901061231 1:6472886-6472908 TTCCATGGGACGCCCCAAAGAGG - Intronic
902087581 1:13875149-13875171 TTCCCAGAGAACTCCTAAAATGG + Intergenic
902557585 1:17256094-17256116 TCCCCAGGGAAGGCACCAAGAGG - Intronic
903845455 1:26277382-26277404 TTCCCAGAGAGGTCTCAGAGGGG + Exonic
904081945 1:27877745-27877767 GGCCCAGGGAGGTCCCAGAGAGG - Intronic
904163536 1:28538173-28538195 GTCCCAGGAAAATTCCAAAGAGG - Intronic
905013054 1:34759917-34759939 TCCCCAGGGAAGTGCCAAGGAGG + Intronic
905329369 1:37181577-37181599 TCCCCAGGGGAGCCCCAAAGAGG - Intergenic
906824434 1:48963583-48963605 TTCCTGGGGAACTCCCATAGGGG + Intronic
906976657 1:50581642-50581664 TTCACTGGGAAGTGCTAAAGGGG + Intronic
908518433 1:64917080-64917102 TTCCCAGGAATGCCCCAAACAGG - Intronic
909026564 1:70487990-70488012 GACCCAGGGAAGACCCAAGGAGG - Intergenic
910773379 1:90851552-90851574 TTCCCAGCGAAGTCCCCGCGCGG - Intergenic
913733967 1:121753083-121753105 TTCCAAGGAAAGCCTCAAAGAGG - Intergenic
913734090 1:121755457-121755479 TTCCAAGGAAAGCCTCAAAGAGG - Intergenic
913734442 1:121761002-121761024 TTCCAAGGAAAGCCTCAAAGAGG - Intergenic
913751088 1:121967411-121967433 TTCCAAGGAAAGCCTCAAAGAGG - Intergenic
913795409 1:122605381-122605403 TTCCAAGGAAAGCCTCAAAGAGG - Intergenic
913799150 1:122672352-122672374 TTCCAACGGAAGCCTCAAAGAGG - Intergenic
913833335 1:123286234-123286256 TTCCAAGGAAGGTCTCAAAGAGG - Intergenic
913840229 1:123409098-123409120 TTCCAAGGAAAGCCTCAAAGAGG - Intergenic
913845840 1:123509867-123509889 TTCCAAAGGAGGTCTCAAAGAGG - Intergenic
914316281 1:146515004-146515026 TTCACAGTGAAGCCCCAGAGGGG + Intergenic
914498074 1:148218357-148218379 TTCACAGTGAAGCCCCAGAGGGG - Intergenic
916747111 1:167693157-167693179 TTCTCTGTGAAGTCTCAAAGAGG + Intronic
920556849 1:206910125-206910147 TTCCCATGGAAGTTCAAAAGGGG + Intronic
921148064 1:212378129-212378151 CTCCCATGGAAGGCCCAAAGAGG + Intronic
922448258 1:225716112-225716134 ATCCAAGGCAATTCCCAAAGAGG - Intergenic
923906615 1:238392024-238392046 TTCCCAAAAGAGTCCCAAAGGGG - Intergenic
924043826 1:240008976-240008998 TTCCCAGGGATGTCCCTTGGAGG + Intergenic
924094893 1:240541099-240541121 ATCCCAGGGAAGTTTCAAAAGGG - Intronic
924300484 1:242632820-242632842 TTCCCCGGGGATTCCCAAGGAGG - Intergenic
924728204 1:246689589-246689611 TTCACAGAGTAGTCCAAAAGGGG - Intergenic
1065036153 10:21640843-21640865 TTCACAGCTAAGTCCAAAAGAGG + Intronic
1066746223 10:38605428-38605450 TTCCCAGCTCAGTACCAAAGAGG + Intergenic
1066842220 10:39939173-39939195 TTCCAAGGAAGGTCTCAAAGAGG - Intergenic
1066921576 10:41506989-41507011 TTCCAAGGAAGGTCTCAAAGAGG - Intergenic
1069305199 10:66960788-66960810 TTCTAAGGGCAGTCACAAAGTGG - Intronic
1073190733 10:101649076-101649098 AGCCCAGGGAATCCCCAAAGAGG + Intronic
1074190986 10:111137203-111137225 TTCACAGGGAAGGCACAGAGTGG - Intergenic
1074887532 10:117705764-117705786 TTCCCAAAGAAAGCCCAAAGAGG + Intergenic
1075564462 10:123493472-123493494 TTCCCAGTGACTTCCCAAAGTGG - Intergenic
1075570043 10:123534954-123534976 TTTCTAGGGAAGTCACAAGGGGG + Intergenic
1077831932 11:5882278-5882300 TTCCCAGGGAGATGGCAAAGAGG - Intronic
1078770034 11:14340724-14340746 TTCCTAGGTAATTCCCAAAAAGG + Intronic
1079016102 11:16870235-16870257 CTCCCAGGGAAGCCTCAAATAGG - Intronic
1079993725 11:27273648-27273670 TTTCCAGGCAAGTTCCAAAGAGG - Intergenic
1080122950 11:28698286-28698308 TTCCCAGCAAAATCTCAAAGTGG + Intergenic
1080125249 11:28726051-28726073 TTCCCATGAAATTGCCAAAGAGG - Intergenic
1080446377 11:32341496-32341518 ATCCCAGGGAAGACCCTAATTGG + Intergenic
1082347620 11:51457654-51457676 TTCCAAGGAAAGCCACAAAGTGG - Intergenic
1082784769 11:57310965-57310987 TTGCAAGGGAAGTCGCAGAGAGG - Intronic
1083014887 11:59443255-59443277 TGCCCAGGAAGGTCACAAAGAGG - Exonic
1083307410 11:61768585-61768607 TGCCCAGGGAACTGCCAGAGAGG - Intronic
1085023614 11:73224005-73224027 ATCCTAGGGGGGTCCCAAAGAGG + Intronic
1086466073 11:87054686-87054708 TTTCAAGGAAACTCCCAAAGTGG - Intronic
1088192014 11:107236986-107237008 TTGCCAGGCAACTGCCAAAGGGG + Intergenic
1090665971 11:128915081-128915103 CTCCCAGAGAAAGCCCAAAGTGG + Intronic
1091899946 12:4136599-4136621 TTCCCAGGGTGGTCCTTAAGGGG + Intergenic
1091937921 12:4448038-4448060 CTCCTAAGGCAGTCCCAAAGTGG - Intergenic
1092915478 12:13185444-13185466 TTCTCAGTGAAGTCCCATGGTGG + Intergenic
1094693070 12:32788643-32788665 TTCACAGGGGACTCCCAGAGAGG + Intergenic
1094878699 12:34686192-34686214 TTCCCAGGAAGGCCTCAAAGAGG - Intergenic
1094880512 12:34771220-34771242 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094881153 12:34782425-34782447 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094881321 12:34785482-34785504 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094881497 12:34788879-34788901 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094881664 12:34791936-34791958 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094881827 12:34794993-34795015 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094881938 12:34797030-34797052 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094882066 12:34799234-34799256 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094882116 12:34800253-34800275 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094882173 12:34801272-34801294 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094882239 12:34802630-34802652 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094882289 12:34803650-34803672 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094882420 12:34806029-34806051 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094882470 12:34807049-34807071 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094882653 12:34810447-34810469 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094882811 12:34813503-34813525 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094882974 12:34816559-34816581 TTCTAAGGAAAGTCTCAAAGAGG - Intergenic
1094887548 12:34898267-34898289 TTTCCAACGAAGGCCCAAAGAGG - Intergenic
1094939606 12:35741800-35741822 TTCCAACGAAGGTCCCAAAGAGG - Intergenic
1094953539 12:35967707-35967729 TTTCCAACGAAGGCCCAAAGAGG - Intergenic
1095007248 12:36836076-36836098 TTTCCAACGAAGGCCCAAAGAGG - Intergenic
1095010406 12:36887352-36887374 TTCCAACGAAGGTCCCAAAGAGG - Intergenic
1095017213 12:36997196-36997218 TTTCCAACGAAGGCCCAAAGAGG - Intergenic
1095939190 12:47715050-47715072 TTCAAAGGGAAGTCCCAGAGAGG + Intronic
1097592202 12:61587993-61588015 CTCCCAGGGAAGTGGAAAAGGGG - Intergenic
1098887638 12:75976436-75976458 TTCCCAGGGAAATCAGAGAGAGG + Intergenic
1098907768 12:76179437-76179459 ATGCCAGGGAAGTCCCCAAAGGG - Intergenic
1104494789 12:129226775-129226797 TTCCTAATGAAGTCACAAAGGGG - Intronic
1104789683 12:131473665-131473687 TTCCCACTGAAGACCCCAAGGGG + Intergenic
1104880252 12:132065692-132065714 CTCCCAGGGAAGACCCAAAGTGG - Intronic
1106312408 13:28565276-28565298 TTCCCATGGCAGTCCAAAACTGG - Intergenic
1107341136 13:39407471-39407493 TTCCCAGGTAAGTGCCAAATGGG + Intronic
1108413807 13:50177342-50177364 TTCCAAGGGAAGTCTCTAGGTGG + Intronic
1109918736 13:69027312-69027334 TGCCCAAAGAAGTCCTAAAGTGG + Intergenic
1116446601 14:45019270-45019292 TACCCAGGGAAGTGGTAAAGAGG - Intronic
1117076375 14:52109127-52109149 TTGCCATGTAATTCCCAAAGAGG + Intergenic
1118737710 14:68714074-68714096 CTCCCAGAAAAATCCCAAAGAGG + Intronic
1119992931 14:79219653-79219675 TTCCCTTAGAAGTCCCAAACCGG - Intronic
1121336445 14:93080486-93080508 TTCCAAGTGCTGTCCCAAAGAGG + Intronic
1121435952 14:93919665-93919687 TCCCCAGGGAAGTCCCACGTGGG + Intronic
1124421749 15:29529081-29529103 ATCCCAGGGAAGACTCAAATAGG - Intronic
1124647867 15:31452747-31452769 TTCCCAGGGGAGCCTCAAACTGG + Intergenic
1125182635 15:36895113-36895135 TTCCCAGGGAAGCCCAGAGGCGG + Intronic
1127324443 15:57881859-57881881 TTCCCTGGGAAGTGTCAGAGAGG - Intergenic
1128658317 15:69478858-69478880 TTTGCAGGGTAGTCCCAAAGAGG + Intergenic
1130788145 15:87123108-87123130 TACCCAAGCAAGGCCCAAAGGGG - Intergenic
1131858001 15:96619328-96619350 TTACGAGGGAAGTCACACAGAGG + Intergenic
1135771154 16:25219596-25219618 TTCCCAGGGGAGCCCCAAAGGGG - Intronic
1136178161 16:28532749-28532771 TTCCCAGGCATGTAGCAAAGGGG + Intronic
1136411575 16:30080831-30080853 TGCCCAGGGCAGGCCCACAGTGG - Intronic
1136736833 16:32474213-32474235 TTCCCAGCTCAGTGCCAAAGAGG - Intergenic
1138588925 16:57988859-57988881 TCCCAAGTGCAGTCCCAAAGTGG - Intergenic
1203016236 16_KI270728v1_random:355364-355386 TTCCCAGCTCAGTGCCAAAGAGG + Intergenic
1203034571 16_KI270728v1_random:628522-628544 TTCCCAGCTCAGTGCCAAAGAGG + Intergenic
1143911462 17:10253320-10253342 TTTCCAGGGAAGACCCAGAAAGG + Intergenic
1143957361 17:10682042-10682064 TTCCCAGCAAAGTCCTAAAATGG + Intronic
1144014688 17:11182690-11182712 TTCTCAGGCATGTCCCAAACTGG + Intergenic
1144125088 17:12195912-12195934 TTCCCAGTGAAGACCCCAAAGGG - Intergenic
1144818484 17:18053755-18053777 TTCCAAGGTTAGACCCAAAGAGG - Intronic
1146005764 17:29159679-29159701 TTCCAAGGGAAGACTCAAAATGG - Intronic
1146521484 17:33528868-33528890 TGCCCAGGGAATTCACAAGGTGG - Intronic
1149754928 17:59178702-59178724 TTCTCAGGGGAGTCTCAGAGCGG - Intronic
1150229018 17:63539741-63539763 TTTCCAGGAAGGACCCAAAGAGG - Intronic
1152351453 17:79785991-79786013 GTCCCAAGGAAAACCCAAAGTGG + Exonic
1155932281 18:31720338-31720360 TTCCCTGGGAAGGGGCAAAGAGG + Intergenic
1158907340 18:62026779-62026801 TTCCCAGGGAAGTAGGAAGGAGG + Intergenic
1159305598 18:66638249-66638271 TGCCCTGTGCAGTCCCAAAGGGG + Intergenic
1161554160 19:4931029-4931051 TCCCCAGGCTAGTCCCCAAGTGG - Intronic
1161591928 19:5132866-5132888 AGCCCAGGGAAGGCCCTAAGCGG - Intronic
1161723583 19:5916414-5916436 TTTCCTCTGAAGTCCCAAAGAGG + Exonic
1162382682 19:10340734-10340756 TTCCAAGGGAAGGCGCCAAGGGG + Intergenic
1163003046 19:14381079-14381101 TTCCCTGGGCAGGCGCAAAGGGG - Intronic
1166310496 19:41959647-41959669 CTCCCAGGGAAGGCACAATGGGG + Intergenic
1166520244 19:43475287-43475309 TTCCCGGGAGAGTTCCAAAGCGG + Exonic
1166758739 19:45211780-45211802 TTCCCTGAGAAGTCAGAAAGAGG - Intronic
925422482 2:3724336-3724358 ATCCCAGGGAGGTGCCAGAGTGG + Intronic
925783688 2:7407546-7407568 TTCTGAGGGAAATGCCAAAGAGG - Intergenic
925953369 2:8937069-8937091 TTCCCAGGGAAGAAGCAGAGGGG - Intronic
926562609 2:14434534-14434556 TTGTCAGGGATGACCCAAAGAGG + Intergenic
926904361 2:17792231-17792253 ATTCCAGGAAAGTCCCACAGAGG - Intronic
929898641 2:45983115-45983137 TTCCCAGGCAAGACCTCAAGTGG + Intronic
929903647 2:46027374-46027396 TTACCAGGGAAGTCCAAATAGGG + Intronic
933054858 2:77649039-77649061 TTCCCAGAGAACTGCCAAACAGG + Intergenic
933533109 2:83535528-83535550 TTCTCAGTGGAGTCTCAAAGGGG - Intergenic
933941107 2:87245875-87245897 GTCCCAGGGAAGACCCCTAGGGG + Intergenic
934947367 2:98551563-98551585 TTCCCAGGGAAGTCCCAAAGTGG - Intronic
935425063 2:102911027-102911049 ATCACAGGGAATTCCCAATGAGG + Intergenic
936352034 2:111720137-111720159 GTCCCAGGGAAGACCCCTAGGGG - Intergenic
936774326 2:115954683-115954705 TTTTCAGGAAAGTCCCAAAAAGG - Intergenic
937067681 2:119030250-119030272 TGCCAAGGCAACTCCCAAAGAGG - Intergenic
938084960 2:128393519-128393541 TGCCCAGGGAAGCCTCGAAGAGG - Intergenic
942197706 2:173538081-173538103 CTCTCAGGGAAGTCAAAAAGGGG - Intergenic
942198636 2:173548662-173548684 TTCCCAAGGCATTCCCAAAAGGG + Intergenic
942314996 2:174689902-174689924 TTCCCAGGAAAGTCCCATTAGGG - Intergenic
943373349 2:187044524-187044546 TCACCAGGGCAGTACCAAAGGGG - Intergenic
944599155 2:201285515-201285537 TTCCCAGGTCAGTTACAAAGTGG + Intronic
946383243 2:219363955-219363977 TCCCCAGGCCAGCCCCAAAGGGG - Intergenic
948759692 2:240182992-240183014 TTCCCAGGGCAGCCCCAGATTGG - Intergenic
948960874 2:241335809-241335831 ATCCCAGAGAAGTCAGAAAGGGG - Intronic
1172199145 20:33113081-33113103 TGCCCAGGGAAGGGCTAAAGGGG + Intergenic
1172317136 20:33964615-33964637 TGCCAAGGAAATTCCCAAAGAGG + Intergenic
1174297970 20:49562368-49562390 TCCCCAGAAAAGTCCCAAGGAGG + Intronic
1174983559 20:55423910-55423932 TTCTCAGGGAAGTCCCCAACTGG - Intergenic
1180069845 21:45430801-45430823 TTCCCAGGGCAGCCCCACAAAGG - Intronic
1180836885 22:18934394-18934416 TGCCCTGGGAAGTCCCTCAGTGG - Intronic
1183277000 22:36904809-36904831 TTCCCAGGTAAGACCCATAGAGG + Intergenic
1185097273 22:48817619-48817641 TTCCCAGGAAGGACCCATAGGGG + Intronic
1203286978 22_KI270734v1_random:159693-159715 TGCCCTGGGAAGTCCCTCAGTGG - Intergenic
950962263 3:17119057-17119079 TACCCAGGGAAGTCCCAGGCAGG + Intergenic
952377216 3:32777884-32777906 TTACCAGGGAAGATACAAAGGGG - Intergenic
952716039 3:36482081-36482103 TTCCCAGGCAAGTCTCAAAAAGG - Intronic
955542945 3:59997330-59997352 TTGCCAGAGAAGTCTGAAAGAGG + Intronic
956051241 3:65250802-65250824 TTCCCTGGGAAGTGACACAGAGG - Intergenic
958045621 3:88280574-88280596 TCCCCAGGGACCTCCCCAAGTGG + Intergenic
958108448 3:89107561-89107583 GACCCAGGGAAGTCCCCGAGCGG + Exonic
958217528 3:90608388-90608410 TTCCCACGAAAGCCTCAAAGAGG + Intergenic
958379967 3:93285318-93285340 TTCCAACGGAAGCCTCAAAGAGG - Intergenic
959024068 3:101220184-101220206 TTCCCAGGGTTTTCCCTAAGGGG - Intergenic
961146717 3:124599941-124599963 TTCCCAGTGAATTCCCAGTGAGG + Intronic
962887668 3:139642512-139642534 TTCCCAGGGCAGCGCCACAGTGG - Intronic
964351718 3:155809817-155809839 TTGCCAGGCAAGTGCAAAAGAGG - Intergenic
964458416 3:156894168-156894190 TTTCCTGGTGAGTCCCAAAGAGG - Intronic
966152886 3:176884227-176884249 TCCCCAGGGAAGCACTAAAGTGG + Intergenic
968690555 4:1987727-1987749 CTCCCAGGGAGCTCCCCAAGGGG + Intronic
969258894 4:6021479-6021501 TTGCCAGGGATGTGCCAAATTGG - Intergenic
969269404 4:6088930-6088952 TTCCCAGGGCAGTCCCCAATTGG + Intronic
969595052 4:8144024-8144046 TGACCTGGGAAGTCCCCAAGGGG - Intronic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
974850580 4:67400658-67400680 TTCTAAGGAAAGTCTCAAAGAGG + Intergenic
981168204 4:141588398-141588420 TACCTAGGGAAGACCCAAAAAGG + Intergenic
981547348 4:145907652-145907674 TTCCCGGGGAAGCCTCTAAGTGG + Intronic
981569289 4:146134472-146134494 TTCCCAGGTAAGTCACAACAGGG - Intergenic
985732360 5:1556439-1556461 CTCCCAGGCATCTCCCAAAGAGG - Intergenic
986550328 5:8946925-8946947 TTCCCATGGAAGTGCCTAGGTGG + Intergenic
986831338 5:11582286-11582308 TTCCCTGGAATGTCCCAAATGGG - Intronic
987120900 5:14765489-14765511 TTCCCAGGGAAGTGTCTGAGTGG + Intronic
989908724 5:47307028-47307050 TTTCCAACGAAGGCCCAAAGAGG - Intergenic
995758560 5:115539549-115539571 TTCCCATGGCATTCCAAAAGGGG - Intronic
997689867 5:135821175-135821197 TGCCCAGGGAAGTTCCCATGTGG - Intergenic
998218395 5:140254911-140254933 TTCCCAGGTAAGTGCAACAGAGG - Intronic
998254515 5:140574440-140574462 TTCCAAGGGACCTCCCACAGCGG + Intronic
998440406 5:142156144-142156166 TACACTGGGAATTCCCAAAGGGG + Intergenic
999842844 5:155448014-155448036 TTCCCAGGAATCTTCCAAAGGGG - Intergenic
1000026858 5:157366797-157366819 TTCCCTGGGAAATCAGAAAGTGG + Intronic
1000165373 5:158643105-158643127 TTCCCTGGGACATTCCAAAGTGG + Intergenic
1003629278 6:7772119-7772141 TTCCCAAGGATGACCCTAAGAGG - Intronic
1005712818 6:28518453-28518475 TTCCCAGGGTGGTCTCGAAGTGG + Intronic
1006906696 6:37537773-37537795 ATCTCAGGCAGGTCCCAAAGTGG - Intergenic
1009255391 6:61386100-61386122 TTCCAAGGAAGGTCTCAAAGAGG - Intergenic
1009831157 6:68937553-68937575 TTTCCAGGGACCTCCAAAAGGGG + Intronic
1009932634 6:70194304-70194326 TCACCTGGGAAGCCCCAAAGGGG - Intronic
1016174872 6:141068791-141068813 ATCACAGGGAATTCCCAACGAGG + Intergenic
1016809685 6:148247845-148247867 TTCCCAGGGAGGGGCCAGAGTGG - Intergenic
1017549355 6:155488627-155488649 CTCCTGGGGAAGTCCCAAATCGG - Intergenic
1018807552 6:167273057-167273079 TTGCCTGGGCAGTCACAAAGGGG - Intronic
1019118589 6:169785354-169785376 ATCCTAGGGAAGTCCCCATGAGG + Intergenic
1020035457 7:4960501-4960523 TTCCCGGGCAGGTCCCATAGGGG - Intergenic
1022406225 7:30092765-30092787 GTCCCAGGGAAGTCCCATGATGG - Intronic
1025473048 7:60882227-60882249 TTCCAATGAAAGTCTCAAAGCGG + Intergenic
1025513957 7:61607639-61607661 TTCCAATGAAAGTCTCAAAGCGG - Intergenic
1025538301 7:62036479-62036501 TTCCAATGAAAGTCTCAAAGCGG - Intergenic
1026245735 7:68617870-68617892 TCTCAAGGGAAGTACCAAAGGGG - Intergenic
1027332077 7:77107655-77107677 TTGCTAGGTAATTCCCAAAGAGG - Intergenic
1028616860 7:92778044-92778066 TTCACAGAGAAGTCCAAATGTGG - Intronic
1029158963 7:98538150-98538172 TTCCCAGGTAAGTTTCAGAGAGG - Intergenic
1029753353 7:102556971-102556993 TTCTCAGGGGAGTCTCAGAGCGG + Intronic
1033526945 7:142225642-142225664 TGCCCAGAGAATTCCAAAAGTGG + Intergenic
1035082302 7:156226937-156226959 GTCCCAGGCAAGTGCCAGAGGGG + Intergenic
1036762528 8:11519224-11519246 CACCCAGGGGAGTCCCAGAGAGG - Intronic
1038170535 8:25127919-25127941 TTCAGAGGGAAGTCACAGAGTGG + Intergenic
1039595100 8:38784802-38784824 TTCTGGAGGAAGTCCCAAAGGGG + Intronic
1039715923 8:40109235-40109257 TTCCCAGGGATGTAGGAAAGTGG - Intergenic
1039902177 8:41760833-41760855 TTCCCACAGAAGACCCACAGTGG + Intronic
1040568547 8:48588364-48588386 TTCCAAGGCTAGTCCCCAAGAGG + Intergenic
1041713323 8:60912187-60912209 TTCACAGGGCAGTCTCAAAGGGG + Intergenic
1047127949 8:121983996-121984018 TTCACAGGGAAGTATCAGAGAGG - Intergenic
1049095269 8:140544864-140544886 CTCCCAGGGAAGTCCCCACTGGG - Intronic
1050752926 9:8962365-8962387 TTCATAGGAAAGTCCCAAGGTGG - Intronic
1053610872 9:39711848-39711870 TGTCCAGGGATGTCCCAGAGAGG - Intergenic
1053868909 9:42469870-42469892 TGTCCAGGGATGTCCCAGAGAGG - Intergenic
1054087382 9:60759310-60759332 TGTCCAGGGATGTCCCAGAGAGG + Intergenic
1054242650 9:62630547-62630569 TGTCCAGGGATGTCCCAGAGAGG + Intergenic
1054556774 9:66665065-66665087 TGTCCAGGGATGTCCCAGAGAGG + Intergenic
1055090388 9:72359320-72359342 TTCCCATTGAAGGACCAAAGAGG - Intronic
1055371680 9:75606493-75606515 TTCCCAGGGAAGCCCCAGGGTGG - Intergenic
1058600732 9:106667290-106667312 TTCCCCAGGAATTCCCAAATTGG - Intergenic
1058687542 9:107491173-107491195 TTCCCAGGGAAGTCCCTTTAGGG - Intergenic
1059282830 9:113149515-113149537 TTCCCATGTAAGGCCCAGAGAGG + Intergenic
1059367854 9:113800616-113800638 GCCCCAGGCAAATCCCAAAGAGG + Intergenic
1060992142 9:127855209-127855231 TAGGGAGGGAAGTCCCAAAGTGG + Intergenic
1061090086 9:128421324-128421346 CACCCAGGGAAGGCCCCAAGAGG - Intronic
1061849514 9:133406198-133406220 TTCCCAGGGGAGCCTCAAACTGG + Exonic
1061873318 9:133532001-133532023 TCCCCAGGGAACCTCCAAAGTGG + Intergenic
1188404239 X:29787003-29787025 CTCCCAGGCAAGTACCAATGAGG + Intronic
1189701525 X:43718950-43718972 CTTCCAGGGATGACCCAAAGGGG + Intronic
1190823082 X:53992867-53992889 TTCCCATGGGAGTCCCAGACAGG - Intronic
1192201926 X:69071607-69071629 TGCCGAGGGAAGGCCCAGAGAGG - Intergenic
1194604336 X:95961555-95961577 ATCCTAGGGAACTCCCCAAGAGG + Intergenic
1195871088 X:109486817-109486839 TTCCCAAGGATCTGCCAAAGGGG - Intergenic
1199693327 X:150325866-150325888 TTTACTGGGAGGTCCCAAAGGGG + Intergenic
1200111866 X:153744583-153744605 TTCCCAGCTCAGTGCCAAAGAGG + Exonic