ID: 934948273

View in Genome Browser
Species Human (GRCh38)
Location 2:98557912-98557934
Sequence CAGAGTGTACAGGAGGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 1, 2: 4, 3: 50, 4: 463}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934948273_934948281 29 Left 934948273 2:98557912-98557934 CCGCCTTCCTCCTGTACACTCTG 0: 1
1: 1
2: 4
3: 50
4: 463
Right 934948281 2:98557964-98557986 AGACCAAGTTTTTCTTAGTCTGG 0: 1
1: 0
2: 2
3: 6
4: 120
934948273_934948277 4 Left 934948273 2:98557912-98557934 CCGCCTTCCTCCTGTACACTCTG 0: 1
1: 1
2: 4
3: 50
4: 463
Right 934948277 2:98557939-98557961 TCTCCTCATACCCAAAGAGATGG 0: 1
1: 0
2: 7
3: 21
4: 183
934948273_934948282 30 Left 934948273 2:98557912-98557934 CCGCCTTCCTCCTGTACACTCTG 0: 1
1: 1
2: 4
3: 50
4: 463
Right 934948282 2:98557965-98557987 GACCAAGTTTTTCTTAGTCTGGG 0: 1
1: 0
2: 0
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934948273 Original CRISPR CAGAGTGTACAGGAGGAAGG CGG (reversed) Intronic
901057080 1:6453571-6453593 CTGACTGTCCTGGAGGAAGGGGG + Intronic
901079637 1:6576697-6576719 CACAGTGTACAGGGAGCAGGAGG + Intronic
902477289 1:16694922-16694944 CTGACTGTCCTGGAGGAAGGGGG - Intergenic
903291563 1:22317483-22317505 CAAAGGGGCCAGGAGGAAGGGGG + Intergenic
904276511 1:29388248-29388270 GTGGGTGTACAGGAGGGAGGAGG + Intergenic
904296993 1:29526230-29526252 CAGAATGTACAGGAGGAGAGTGG + Intergenic
904358026 1:29954097-29954119 CAGAAAGCAGAGGAGGAAGGTGG + Intergenic
904625611 1:31800225-31800247 CAGGGTGGACTGGAGGAGGGAGG - Intronic
904846557 1:33423038-33423060 GAGAGAGTACAGATGGAAGGCGG + Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906132527 1:43469108-43469130 CTGAGCCTGCAGGAGGAAGGGGG + Intergenic
907459509 1:54597109-54597131 CAGAGTGCACATGAGGCAGAGGG - Intronic
907676642 1:56523835-56523857 CATAGTGTACATGGAGAAGGAGG + Exonic
907934869 1:59033063-59033085 TAGAGTCTACAGAAGGCAGGAGG + Intergenic
908404954 1:63805536-63805558 CAGAGTGTAAGAGAGGAAAGAGG + Intronic
908926451 1:69260647-69260669 CAGAGGGTGGAGGGGGAAGGAGG + Intergenic
909559732 1:76996697-76996719 CAGTATGTACAGTTGGAAGGAGG + Intronic
909772184 1:79437701-79437723 GAGAGAGTGAAGGAGGAAGGAGG - Intergenic
909879097 1:80849776-80849798 TAGAGTGTATAGGAGGTAAGAGG + Intergenic
910901878 1:92130113-92130135 ATGAGTGTACAGCAAGAAGGCGG - Intronic
911304260 1:96213987-96214009 GAGTGTGTAAAGAAGGAAGGTGG + Intergenic
911445161 1:97983578-97983600 CTGAGTGTACAGTAGGTAGATGG + Intergenic
913481355 1:119292522-119292544 CATACTGTACAAGAGGAAGCTGG - Intergenic
914322520 1:146578870-146578892 AAGAGTGCACAGGTGGAATGTGG - Intergenic
915141528 1:153771339-153771361 CAGAGTGTCCTAGAGGAAGTGGG + Intronic
915294222 1:154908876-154908898 CAAAGTGTTCAGGAGTAAAGGGG + Intergenic
915480048 1:156178270-156178292 CAGAGGGTAGAGGAGGAAGGTGG - Intergenic
915981531 1:160423241-160423263 CACAGTGTTAAGGAGGAAGCAGG - Intronic
916742383 1:167657602-167657624 CAGAGGGGAGGGGAGGAAGGAGG - Intronic
918708840 1:187703256-187703278 CATAGTGCACAGGTGGATGGGGG - Intergenic
919425945 1:197430578-197430600 AAGAGAGTTCAGGAGGGAGGTGG - Intronic
920191602 1:204197334-204197356 CCAAGGGTACAGGGGGAAGGGGG - Intergenic
920929823 1:210376810-210376832 CAGTGTGTAAAGTAGAAAGGTGG + Intronic
921822564 1:219634286-219634308 CAGAGGGTACTGGATGTAGGTGG + Intergenic
921863693 1:220065908-220065930 CAGAGTGTCCAGAAGGGAAGTGG + Intronic
922353979 1:224758938-224758960 GAGAGTATTCTGGAGGAAGGGGG + Intergenic
922565323 1:226597819-226597841 CAGAGATCACAGGAGGAAGTGGG + Intronic
922707575 1:227797316-227797338 AAGAGGACACAGGAGGAAGGTGG + Intergenic
923790306 1:237106015-237106037 CAGAGTGTGCAGCAGGACTGGGG + Intronic
1063438333 10:6052551-6052573 TTGAGGGTACAGGAGGAAGAGGG - Intronic
1064225814 10:13483821-13483843 CTGGGGGTACGGGAGGAAGGGGG + Intronic
1065667875 10:28082469-28082491 CAGAGTCTAAAAGAAGAAGGAGG - Intronic
1066286454 10:33971176-33971198 CAGAGTGTACTGCTTGAAGGGGG - Intergenic
1067473544 10:46552199-46552221 CGGAGTGGGCAGGAGGAAAGAGG + Intronic
1067804362 10:49382808-49382830 GACAGTGTCCAGGAAGAAGGAGG - Intronic
1067804872 10:49385485-49385507 GACAGTGTCCAGGAAGAAGGAGG - Intronic
1069628009 10:69880296-69880318 CAGAGGGCACAGGGGCAAGGAGG - Intronic
1069679665 10:70274937-70274959 CAGAGGATCTAGGAGGAAGGAGG + Intronic
1070518051 10:77226023-77226045 CAGAATCTAGGGGAGGAAGGGGG + Intronic
1070652641 10:78249013-78249035 CACAGCACACAGGAGGAAGGAGG - Intergenic
1070766714 10:79061006-79061028 CTGTGTCCACAGGAGGAAGGGGG + Intergenic
1071154365 10:82672323-82672345 GAGACTGGAGAGGAGGAAGGGGG + Intronic
1071494744 10:86160491-86160513 CAGAGTGGAGGGGAAGAAGGAGG + Intronic
1071840520 10:89465935-89465957 CAGAATCTACAGGAAGAAGAGGG - Intronic
1072744691 10:97931919-97931941 GAGAGTGTGCAGGACGCAGGGGG - Intronic
1073098436 10:100994777-100994799 GAGAGGGTACAGGAGGGAGATGG - Intergenic
1073742820 10:106428917-106428939 TAGGGAGTACAGGAGTAAGGTGG + Intergenic
1073770670 10:106731905-106731927 CAGGGAGGACAAGAGGAAGGAGG + Intronic
1074018232 10:109557494-109557516 CAGAGCTTGCAGGAGGAAGTAGG - Intergenic
1076034127 10:127184784-127184806 CAGACTATCCATGAGGAAGGAGG - Intronic
1076064589 10:127439409-127439431 CAGAGAGACCTGGAGGAAGGTGG + Intronic
1076250430 10:128980153-128980175 CTCAGAGTGCAGGAGGAAGGGGG - Intergenic
1076946708 10:133656573-133656595 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
1077268958 11:1666211-1666233 CAGAGGGTCCAGGAGGACAGGGG - Intergenic
1078523934 11:12086353-12086375 CACAGTGGACAGGAGGGATGTGG + Intergenic
1079005461 11:16788746-16788768 CAGAGAGGAGAGGAGGAAGATGG - Exonic
1079032265 11:16994553-16994575 GAGGCTGTACGGGAGGAAGGTGG - Intronic
1079088665 11:17465207-17465229 CAGAGTGGAGTGGAGGCAGGGGG - Intronic
1079450929 11:20599241-20599263 CGGGCTGTAGAGGAGGAAGGAGG - Intergenic
1080384448 11:31802881-31802903 CAGAGTGAAGAGGAAGAAGAGGG + Intronic
1081522332 11:43894664-43894686 AAGAATGTAAAGGAGGAAGATGG - Intronic
1081675124 11:44964154-44964176 CAGAGTGGAGGGGAGGGAGGAGG - Intergenic
1081680199 11:44997128-44997150 CAGAGGGGAGAGGAGGGAGGGGG + Intergenic
1081732231 11:45379740-45379762 TGGAGTGTTCAGAAGGAAGGAGG - Intergenic
1081776879 11:45681727-45681749 GAGGGTGTGCAGGAGCAAGGGGG + Intergenic
1083625663 11:64070842-64070864 AAGAGGGGAGAGGAGGAAGGAGG + Intronic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1084702453 11:70796266-70796288 GATAGTGTGCAGGAGGAAGCAGG - Intronic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1085762616 11:79255239-79255261 CAGAGTGTAAAGGAGACAGAGGG - Intronic
1086158624 11:83695841-83695863 CAGAGAGCACAGGAGGAATTGGG + Intronic
1086542695 11:87931895-87931917 CAGGGAGTAAAGGAGAAAGGAGG + Intergenic
1086802774 11:91197637-91197659 CAGAATGCACAAGAGGAAAGTGG - Intergenic
1088404366 11:109456859-109456881 GAGAGTGTATGGGATGAAGGTGG + Intergenic
1088736850 11:112734784-112734806 GAGAATGTAAAGGAGGAAGCTGG + Intergenic
1089305401 11:117523296-117523318 GAGAGTGTAGAGCAGGAGGGTGG + Intronic
1089687907 11:120168782-120168804 CAGGGTGTGAAGGAGGGAGGTGG - Intronic
1090055730 11:123422850-123422872 CAGAGTGAACACGAGGGAGAAGG - Intergenic
1090475838 11:127019135-127019157 CAGTGTTTTCAGCAGGAAGGAGG + Intergenic
1091058226 11:132438706-132438728 TAGGGTGTGCAGCAGGAAGGTGG + Intronic
1091200012 11:133771282-133771304 CGGTGAGTACAGGAGGAAGGTGG + Intergenic
1091650603 12:2306287-2306309 CAGAGCGCACAGGCTGAAGGTGG - Intronic
1091754685 12:3043741-3043763 CAGAGTGAACAGGAGAGAGGAGG + Intergenic
1091951521 12:4596865-4596887 CAGAATGCCCAGGAGCAAGGAGG + Intronic
1092722423 12:11454933-11454955 CAGAGGGTGAAGGTGGAAGGAGG + Intronic
1092765601 12:11850201-11850223 CCGAGTGTGCAGGAGGAAGCAGG - Intronic
1093780142 12:23126058-23126080 CAGAGTCAACAGGAGGAATGTGG - Intergenic
1094096085 12:26706484-26706506 CAGCTTGTACACAAGGAAGGAGG - Intronic
1094136359 12:27131051-27131073 GAGAGAGTACAGGAGGAAAAAGG + Intergenic
1094185977 12:27643116-27643138 GAGAGAGTACAGGAGGAAAAAGG + Intronic
1094426885 12:30325223-30325245 CAGAGGGTATAGGTGGGAGGTGG + Intergenic
1095238752 12:39832015-39832037 AAGAGTTTACAGGAGGGAGAAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097194845 12:57237582-57237604 CACAGTGTAGTGGGGGAAGGAGG + Intronic
1097493103 12:60295416-60295438 TGGAGGGTACAGGAGGAAGTGGG - Intergenic
1099135172 12:78888794-78888816 GACAGTGAGCAGGAGGAAGGAGG - Intronic
1099596326 12:84671465-84671487 CAGAGACTACAGAAGGTAGGAGG + Intergenic
1100892575 12:99142117-99142139 CTGAGGGTACAGGCGGAAGCAGG + Intronic
1101477084 12:105061157-105061179 CTGAGTGTACAAGATGAAGAGGG - Intronic
1102910342 12:116708807-116708829 CGGAGGGTGCAGGAGGAAGAAGG + Intergenic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1103916194 12:124376832-124376854 CAGACGGGGCAGGAGGAAGGAGG + Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104188595 12:126456331-126456353 CAGAAGGTACTGGAGGAAGGAGG - Intergenic
1104391790 12:128397202-128397224 CACAGTATGCTGGAGGAAGGGGG - Intronic
1105472631 13:20706061-20706083 CAGAGTAGCCAGGAGGCAGGAGG - Intronic
1105610496 13:21965074-21965096 CAGGGTGCAAGGGAGGAAGGTGG + Intergenic
1105738334 13:23295715-23295737 CAGATTGGAGAGGAAGAAGGAGG - Intronic
1106555792 13:30807447-30807469 CAGAGTGTTAAGGTGGAAAGTGG + Intergenic
1106636430 13:31533578-31533600 CAGAGGGCACAGCAAGAAGGTGG - Intergenic
1107098294 13:36560308-36560330 CACAGTGTGAAGGAGGCAGGGGG - Intergenic
1108095318 13:46894519-46894541 GAGAATGTGAAGGAGGAAGGCGG - Intronic
1109173986 13:59132621-59132643 CAGATTGCAAAGCAGGAAGGTGG - Intergenic
1109209108 13:59514243-59514265 CAGAGATTAAAGGTGGAAGGAGG - Intergenic
1109280573 13:60350597-60350619 GAGAGTGTCCAGGAGGAATGAGG + Intergenic
1109416793 13:62051277-62051299 CAGCGTGTTCATGAGGAAGCAGG + Intergenic
1109561247 13:64052900-64052922 CAGTTTGTACAGGGAGAAGGAGG + Intergenic
1109621701 13:64916804-64916826 AAGAGTGAGGAGGAGGAAGGAGG - Intergenic
1109745028 13:66613557-66613579 CAGAGTGTAAAGCAAGATGGAGG - Intronic
1110681497 13:78319011-78319033 CAGAATCTACAGTAGGACGGTGG + Intergenic
1112004341 13:95241514-95241536 CAGGGGGGGCAGGAGGAAGGAGG - Intronic
1113025884 13:105940223-105940245 CAGGGTGTACAGGAAGCATGAGG - Intergenic
1113059325 13:106304666-106304688 CAGACTGTGGAGGAGGGAGGTGG + Intergenic
1113094757 13:106652060-106652082 CAGAGAGGACAGGAGCAATGTGG - Intergenic
1113248852 13:108428962-108428984 AAGTCTGTAGAGGAGGAAGGCGG - Intergenic
1116749550 14:48866150-48866172 CAGGGTGTACAGGAAGAACATGG - Intergenic
1117248738 14:53913954-53913976 CAGAGTGGGGAGCAGGAAGGTGG - Intergenic
1118550022 14:66939997-66940019 CAGTCTGTACAGGGAGAAGGGGG + Intronic
1119121223 14:72079692-72079714 CAGAGTCTAGAGGAGGTAAGGGG - Intronic
1119894380 14:78207311-78207333 TAGAGTGCGCAGGAAGAAGGTGG - Intergenic
1120723296 14:87910742-87910764 CTGAGGGTAGAGGAGGGAGGAGG - Intronic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121121380 14:91377845-91377867 CAGTGCGTGCAGCAGGAAGGAGG + Intronic
1121325407 14:93016856-93016878 CAGGGTGGACAAGAGGATGGGGG - Intronic
1121678676 14:95774982-95775004 CAGAGTCTAGTGGCGGAAGGAGG + Intergenic
1122014650 14:98784328-98784350 CAGAGTGGACAGGAAAAGGGAGG + Intergenic
1122405061 14:101495938-101495960 CAGAGGGTAAAAGAGAAAGGCGG - Intergenic
1122941020 14:104981418-104981440 CAGAGTGGGCAGGAGAAGGGAGG - Intergenic
1123538174 15:21260887-21260909 CAGAGATTGCAGGAGAAAGGGGG + Intergenic
1124872731 15:33559084-33559106 CAGAGGGTAAAGGAGGAGGTTGG + Intronic
1125154604 15:36571586-36571608 CAGAATGTACATGTGGTAGGAGG + Intergenic
1125323603 15:38514102-38514124 GAGATTGTACAGGAGGTGGGTGG + Intronic
1127280812 15:57490716-57490738 CAGAGTGTACAGGATGAAGTGGG + Intronic
1128154285 15:65383073-65383095 CTGAGTGAAGAGGAGGCAGGAGG + Exonic
1128307855 15:66611768-66611790 CAGAGTGTACAGGAAGGCAGAGG + Intronic
1129377816 15:75145258-75145280 CAGAGCCTGCAGGGGGAAGGGGG + Intergenic
1129825464 15:78631983-78632005 CAGTGTGTGCAGGAGCAAAGAGG - Intronic
1129867998 15:78923698-78923720 CAGAAGGTGCAGCAGGAAGGTGG - Intronic
1129882461 15:79016448-79016470 CAGAGTGTTATGGAGGCAGGAGG + Intronic
1131680712 15:94719814-94719836 CAGAAGGTACAAGAAGAAGGAGG - Intergenic
1132236283 15:100224303-100224325 CAGTGAGTACAGGAGGGTGGGGG + Intronic
1132403867 15:101530592-101530614 CAGAATGCCAAGGAGGAAGGGGG - Intergenic
1202967473 15_KI270727v1_random:194523-194545 CAGCATGTCCAGGAGGCAGGTGG + Intergenic
1133629281 16:7603911-7603933 CAGAATGGACAGGGGGAAGGAGG + Intronic
1133973774 16:10585482-10585504 CAGAGTGGCAAGGAGGATGGAGG + Intergenic
1135603147 16:23800548-23800570 GAGGCTGTACAGGAGTAAGGTGG + Intergenic
1135967134 16:27045434-27045456 AAGAGTGTGCAGGTGGGAGGTGG - Intergenic
1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG + Intronic
1136290468 16:29268448-29268470 CAGACAGGACGGGAGGAAGGGGG + Intergenic
1137863035 16:51865969-51865991 CAGAGTTGACAAGAGGAAGGAGG - Intergenic
1138261988 16:55630431-55630453 TAGAGGCTACAGGAGGAAGTGGG - Intergenic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1140011103 16:71132305-71132327 AAGAGTGCACAGGTGGAATGTGG + Intronic
1140241234 16:73202844-73202866 CAGAGTGTGCAGGAGGGCTGGGG - Intergenic
1141045517 16:80712942-80712964 CAGAAGGGACAAGAGGAAGGAGG + Intronic
1141149267 16:81552866-81552888 CAGAGTGCACAAGAGGAATGAGG + Intronic
1141562274 16:84877417-84877439 CACTGTGAACAGGAGCAAGGGGG - Exonic
1142062089 16:88036796-88036818 CAGAGTGTCCAGGAAGGAGCAGG + Intronic
1142368010 16:89660438-89660460 CAGAGGGTGGGGGAGGAAGGTGG + Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1143109137 17:4543789-4543811 CAGAGGGCCCAGGAGGGAGGCGG - Intronic
1143208837 17:5167902-5167924 TAGAGGGAACAGGAGGAAAGGGG - Intronic
1143796319 17:9339676-9339698 CAGAGTACACAGCAGGAATGAGG - Intronic
1145137683 17:20424562-20424584 TAGAGGGAACAGGAGGAAAGGGG - Intergenic
1145301709 17:21645571-21645593 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1145328017 17:21848132-21848154 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1145348601 17:22057753-22057775 CAGAGTGTAAAGGGGGCAGAAGG - Intergenic
1145694822 17:26779516-26779538 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1145995729 17:29103747-29103769 CAGACTGTCTAGGAGGAGGGAGG - Intronic
1146058313 17:29591943-29591965 CAGGGTGTGGAGGAGGAAGGAGG + Intronic
1146552963 17:33797974-33797996 CAGTGTGCAAAGGAGGAAGTGGG + Intronic
1146585432 17:34077937-34077959 CAGGATGTCCTGGAGGAAGGAGG - Intronic
1147544968 17:41394062-41394084 CAGGGTGTGCAGGGGGCAGGAGG + Exonic
1147721578 17:42543007-42543029 CACTGTGGACAGGAGGTAGGGGG - Exonic
1148051020 17:44769953-44769975 CAGAGGGGGCAGCAGGAAGGGGG - Intronic
1148183941 17:45627796-45627818 TAGAGTATACGGGAGGATGGGGG - Intergenic
1148690907 17:49526364-49526386 CTGAGTGGGCAGGAGGGAGGTGG - Intergenic
1148825883 17:50393811-50393833 CAAAGTGTACAGAAGGAGTGCGG + Intronic
1149871453 17:60185659-60185681 TAGAGGGAACAGGAGGAAAGGGG + Intronic
1150280323 17:63926280-63926302 CAGAGTGTAAATGAAGATGGAGG + Intergenic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1150703541 17:67468214-67468236 AAGATAGTACAGGAGGAAGCAGG + Intronic
1151203039 17:72482988-72483010 CAGGCTGTACAGGAAGCAGGAGG + Intergenic
1151290670 17:73147725-73147747 CAGCATGTTGAGGAGGAAGGCGG - Intergenic
1151800860 17:76378869-76378891 CTAAGGGTACAGGAGGAAAGGGG - Intronic
1151887783 17:76933314-76933336 CAGAGGGTAGAGGGGGCAGGCGG - Intronic
1151888738 17:76939665-76939687 CAGAGTGGGGAGGAGGAAGGGGG - Intronic
1152723436 17:81933957-81933979 CAGCGAGGGCAGGAGGAAGGTGG + Intronic
1203192637 17_KI270729v1_random:204353-204375 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1203202004 17_KI270730v1_random:3788-3810 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1153349052 18:4058709-4058731 CGGAGGCTACAGGAGGAAGTGGG - Intronic
1153812713 18:8765894-8765916 CTGAGTGGACAGAAGGAAAGAGG - Intronic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1153985003 18:10343846-10343868 CAGAGTGCCCAGGAGGAAGCTGG - Intergenic
1154492388 18:14932037-14932059 GTGAGTGTGCAGGAGGGAGGTGG - Intergenic
1155326666 18:24671607-24671629 CAGAGAGGAAAGGAGGGAGGGGG + Intergenic
1156547881 18:37983881-37983903 CAGAGCTCACAGGAGGAAGAAGG - Intergenic
1156565259 18:38181538-38181560 CAGAGTGTGCATGGGGCAGGGGG + Intergenic
1157802069 18:50628733-50628755 CAGAGCCCACAGGAGGAATGTGG - Intronic
1157939749 18:51915124-51915146 CAGAGTGGACTGGAGGGAGCAGG + Intergenic
1158067775 18:53433767-53433789 GTGTGTGTACAGGGGGAAGGTGG - Intronic
1159115372 18:64107330-64107352 CAGAATGTGAAGGAGTAAGGGGG + Intergenic
1159342244 18:67150260-67150282 TATAGAGTCCAGGAGGAAGGAGG + Intergenic
1159400209 18:67921932-67921954 CAGGATGTACAGGAAGAAGAAGG - Intergenic
1161443746 19:4306448-4306470 GAGAGTGTACAGGTGGATGGAGG - Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1162543580 19:11314180-11314202 CAGAGGGTACGGGAAGAATGGGG + Intronic
1162678226 19:12317108-12317130 TAGAGTATACAGGAGGATGTGGG + Intergenic
1162824158 19:13241329-13241351 CAGAGTCTACAGGAAGTGGGAGG + Intronic
1165269320 19:34691424-34691446 CAGACTGCAAAGCAGGAAGGGGG - Intergenic
1165827523 19:38713815-38713837 AACAGTGTAGAGGAGGCAGGGGG - Intronic
1165862756 19:38917840-38917862 CAGAGGGCACAGGAGTCAGGAGG + Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1165935364 19:39385445-39385467 CAGAGTGTGCAGGACGCAGGCGG + Intronic
1166720209 19:44992171-44992193 CAGAGTGCACAGGGGAGAGGTGG + Intronic
1167194764 19:48020687-48020709 CAGAGGGCCCTGGAGGAAGGAGG - Intronic
1167304135 19:48697017-48697039 CAGAGGGGAGAGGAGGAAGCCGG + Intronic
1167696903 19:51020090-51020112 CAGACTGTGGAAGAGGAAGGAGG + Intronic
1168657259 19:58139524-58139546 CACAGGGTACAGCAGGAAGCAGG + Intronic
1202711304 1_KI270714v1_random:20748-20770 CTGACTGTCCTGGAGGAAGGGGG - Intergenic
926616353 2:15000578-15000600 CTGAGTCCACAGGAGGTAGGCGG - Intergenic
927641718 2:24849741-24849763 CAGAGGGGAAAGGAGGAGGGGGG + Intronic
928409392 2:31042827-31042849 GGGAGAGCACAGGAGGAAGGAGG - Intronic
930539477 2:52687158-52687180 AAGGGTGTACAGGTGGTAGGAGG + Intergenic
930804214 2:55473919-55473941 CTGTGGGTAGAGGAGGAAGGGGG + Intergenic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
931620572 2:64205817-64205839 CAAAGTGTGCAGGAAGCAGGGGG - Intergenic
932593230 2:73079610-73079632 AACACTGTCCAGGAGGAAGGGGG - Intronic
933615502 2:84478813-84478835 CCCAGTATCCAGGAGGAAGGAGG + Intergenic
934514684 2:94979179-94979201 CGGAGTCTACAGGAGGGTGGAGG + Intergenic
934516434 2:94990922-94990944 CAGATTTAACAGGAGAAAGGAGG + Intergenic
934545076 2:95207658-95207680 CTGAGTGTCCGGGAGGAGGGTGG + Exonic
934562189 2:95319194-95319216 CAGAGTCTGCAGGAGGAAGGCGG + Intronic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
935152900 2:100454367-100454389 CAGAGGGTGCAAGAGAAAGGAGG - Intergenic
935436905 2:103045225-103045247 CAAAGTGTTCAAGAGGAAGCAGG + Intergenic
936011965 2:108930603-108930625 CGGCGTGTCCAGGAGGATGGGGG + Intronic
936678362 2:114741397-114741419 GAGAGTGTCAAGGAGAAAGGAGG + Intronic
937039217 2:118807998-118808020 CAGAGTGGGCAGGAGGGAGAGGG + Intergenic
937263034 2:120598453-120598475 CAGGGGCTACAGGAGGAAAGCGG + Intergenic
937366297 2:121264390-121264412 CAGAGTGGAAATGGGGAAGGCGG + Intronic
937905318 2:127050165-127050187 CAGAGGCTACAGGAAGAAGCGGG + Intronic
937915744 2:127097907-127097929 CAGAGGGCAAAGGAGGCAGGTGG - Intronic
938063591 2:128269691-128269713 CAGCGTGGACAGGAGCCAGGAGG - Intronic
938102280 2:128505189-128505211 CAGAGCCTTCAGGAGGTAGGAGG + Intergenic
939554687 2:143660235-143660257 CAGAATGTGGAGGAGGAAGGAGG - Intronic
939621571 2:144425704-144425726 CAGATTGTAGAGGACGTAGGAGG + Intronic
940467271 2:154046791-154046813 CTGAGGATACAGGAAGAAGGTGG + Intronic
940770560 2:157835197-157835219 CACAGTGTAGGGGAGGAAGGGGG - Intronic
941454657 2:165700933-165700955 GAAAGGGTACAGGAGGAAAGAGG - Intergenic
944153378 2:196585934-196585956 CAGGGAGTACAGGCTGAAGGAGG - Intronic
944537434 2:200725086-200725108 CAGAGGGTCCAGCAGGAAGAGGG + Intergenic
945212100 2:207394437-207394459 CTGAGGTTACAGAAGGAAGGAGG + Intergenic
945556384 2:211281523-211281545 CAGAGGGTACAGTGAGAAGGTGG - Intergenic
946181312 2:217950783-217950805 AAGAGTGCAGAGGAGGAAGAGGG - Intronic
946506638 2:220308695-220308717 AAGAGTGTGTGGGAGGAAGGGGG - Intergenic
946732314 2:222721240-222721262 CAAAGTGTTCAAGAGGAAGCAGG - Intergenic
947339885 2:229127175-229127197 CTGTGTGTCCAGGAGGAAAGGGG + Intronic
948752372 2:240140061-240140083 AAGCCTGTGCAGGAGGAAGGAGG - Exonic
949080144 2:242089435-242089457 CAGAGTGGCCTGGAGGAATGAGG - Intergenic
1170815326 20:19709020-19709042 GAGAGTGGAGAGGAAGAAGGAGG + Intronic
1171173921 20:23037065-23037087 CAGCTTGTACAGGAGAGAGGAGG + Intergenic
1171437713 20:25135972-25135994 CAAAGTGTAGAGGAGAGAGGTGG + Intergenic
1171518287 20:25756954-25756976 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1171558570 20:26099252-26099274 CAGAGTGTAAAGGGGGCAGAAGG - Intergenic
1172839536 20:37893904-37893926 CAGAGAGGAAAGAAGGAAGGAGG - Intergenic
1173185422 20:40836590-40836612 CAGAGTGTAGAGGAGGATAAAGG - Intergenic
1173617461 20:44412494-44412516 CAGAGTGTGTAGGGGGAAGCCGG + Intronic
1173985585 20:47259203-47259225 CAGGGTGTGGAGGTGGAAGGAGG + Intronic
1174079044 20:47957952-47957974 CAGATGGGAGAGGAGGAAGGAGG + Intergenic
1174271042 20:49368769-49368791 CAGAGTGGGCAGGAGGGAGAAGG - Exonic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1175002793 20:55647907-55647929 AAGTATGTAGAGGAGGAAGGTGG - Intergenic
1175154539 20:56961198-56961220 CTGGGTGTACAGGAGCAGGGAGG - Intergenic
1175185482 20:57177205-57177227 AAGAGGGTTGAGGAGGAAGGAGG + Intronic
1175724813 20:61310587-61310609 CAGGCTGGACAGCAGGAAGGGGG - Intronic
1175840042 20:62020931-62020953 CAGCGTGAACATGAGGAAGGAGG + Intronic
1176652447 21:9563368-9563390 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1178329641 21:31676648-31676670 AAGAGTAGACAGGATGAAGGAGG - Intronic
1179076409 21:38126418-38126440 CAGAGTGGTCAGGAGGCAGGAGG + Intronic
1179149237 21:38795991-38796013 CACAGTGAACAGGAAGCAGGGGG + Intergenic
1179236741 21:39554167-39554189 CAGAATGACTAGGAGGAAGGAGG - Intergenic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180693677 22:17738578-17738600 CTGAATGGACAGGAGGAAGGGGG + Intronic
1181539993 22:23567866-23567888 CAGAGAGGAAAGGAGGAAAGAGG + Intergenic
1182059937 22:27389559-27389581 AAGAGTGCACAGAAGAAAGGAGG + Intergenic
1182822817 22:33233432-33233454 GAGAGAGGACAAGAGGAAGGAGG - Intronic
1183068521 22:35380341-35380363 CAGAGTGTGGAGGAGGCAGGCGG + Intronic
1183261075 22:36796365-36796387 CAAAGTGTCCAGCAAGAAGGAGG + Intergenic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
1184049630 22:41994823-41994845 CAGAGTTGAGAGGAAGAAGGTGG - Intronic
1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG + Intronic
1184338806 22:43874127-43874149 CAAAGTGTTCAAGAGGAAGCAGG + Intergenic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184482350 22:44755243-44755265 CAGTGTGTGTGGGAGGAAGGTGG - Intronic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
1184767392 22:46578748-46578770 AAGGGTGTGCAGCAGGAAGGAGG - Intronic
1184775188 22:46619637-46619659 CAGAGTGAACAGGAGGACCGGGG - Intronic
951027409 3:17844597-17844619 CACAGTGTACAGGGAGGAGGTGG + Intronic
952139153 3:30459112-30459134 CACAGAGTACAAGAGTAAGGGGG + Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
952916627 3:38250818-38250840 CAGAGGGAACAGGAGGACTGCGG - Intronic
953476757 3:43211875-43211897 CAGAAGGTACAGGTGGAAGGCGG + Intergenic
954215074 3:49120244-49120266 AAGTGTGTAAAGGAGGAAGGAGG + Intronic
954283709 3:49602877-49602899 CAGAGTGTGCAGAAGAGAGGAGG - Intronic
955247994 3:57246631-57246653 CAAAGAGTACATCAGGAAGGGGG + Intronic
956457461 3:69436956-69436978 CAGAGTTTACAAGAGGCTGGGGG + Intronic
959208766 3:103347786-103347808 CAGATTGTTCAGGAGGTTGGGGG + Intergenic
960508807 3:118524299-118524321 CTGAGGATACAGGAGGAAAGAGG - Intergenic
961001781 3:123379016-123379038 AAGAGTGTAGAGGAGGACAGGGG - Intronic
961745231 3:129060323-129060345 TTGAGTATACAGGAGGAGGGAGG + Intergenic
963323608 3:143836610-143836632 GAGAGGGGACAGAAGGAAGGAGG + Intronic
963323781 3:143838396-143838418 GAGAGTGTTCAGGAGGGAGAGGG + Intronic
963434026 3:145244957-145244979 CAGTGTGTACAGGAAGATGGAGG + Intergenic
963667156 3:148202611-148202633 CAGAGGGCAAATGAGGAAGGGGG - Intergenic
963817257 3:149845398-149845420 CATAGTGAACAGGATGAAGTTGG + Intronic
964278846 3:155039194-155039216 CAGAGGATATAGGAGCAAGGTGG + Intronic
965585511 3:170314372-170314394 CAGTGTGCACAGGAGAAAGGAGG - Intergenic
966649328 3:182281739-182281761 CAGAGTGTAATGGAGGCAGGAGG - Intergenic
966888501 3:184389671-184389693 CATTATGTACAGGAGGAAAGGGG - Exonic
967586596 3:191221651-191221673 CAAAGTGTTCAAGAGGAAGCAGG + Intronic
968725180 4:2243788-2243810 CAGTTTGGACAGGAGGAAGTGGG + Intergenic
968922537 4:3530150-3530172 CAGGGTGGTCAGGAGGCAGGAGG - Intronic
969141500 4:5078103-5078125 AAGAGCGTAAAGGAGGAAAGGGG + Intronic
969193886 4:5545505-5545527 CAGAGTTATCAGGAGGAAGCAGG + Intronic
969365196 4:6690125-6690147 CAGAGAGGCCAGGAGGAGGGCGG - Intergenic
969545560 4:7824748-7824770 CTGAGGGAACGGGAGGAAGGGGG + Intronic
975147062 4:70980143-70980165 GAGTGTGTACAGGGGGAAGATGG - Intronic
975281650 4:72568996-72569018 CAGAGTGTGCAGGAGCGAGAAGG + Intergenic
976222590 4:82769791-82769813 CAGAGTGAGAGGGAGGAAGGGGG + Intronic
977536775 4:98262334-98262356 CAGATTAGACAGGAGGAAGCTGG - Intronic
977754282 4:100648289-100648311 CACAGTTTACAGAAGCAAGGTGG - Intronic
977874028 4:102128363-102128385 CAGAGTGTACAGGAAGCATGGGG - Intergenic
978342009 4:107728923-107728945 CAGGGTGAACAGGATGATGGTGG + Intergenic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
982317736 4:154048309-154048331 CAAAGGATACAGGAGGAGGGTGG + Intergenic
982515390 4:156340863-156340885 CAGAATGTAAAGAAGGAAGCAGG + Intergenic
982905407 4:161063144-161063166 GAGAGGGTAAAAGAGGAAGGAGG - Intergenic
983366484 4:166797066-166797088 CAGATTGAAGAGGAGTAAGGAGG + Intronic
984149800 4:176113147-176113169 AAGAGTGTAAAGGAGGTAGATGG - Intronic
984559057 4:181246937-181246959 CAGAGAGCAAAGGAGGATGGAGG + Intergenic
985450164 4:190057372-190057394 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
986482651 5:8204347-8204369 CAGAAGGTGAAGGAGGAAGGAGG - Intergenic
986599670 5:9459226-9459248 GAGTGTGAACAGGAGGAAGCAGG - Intronic
987605815 5:20134744-20134766 CAAAGTCAAAAGGAGGAAGGAGG - Intronic
989987954 5:50724847-50724869 CAGAGTGGGAGGGAGGAAGGGGG - Intronic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
991166009 5:63566068-63566090 CAGACTGGACAGGATCAAGGTGG - Intergenic
991729816 5:69574644-69574666 CTGAGTGTTCAAGAGTAAGGAGG + Intronic
991806248 5:70429785-70429807 CTGAGTGTTCAAGAGTAAGGAGG + Intergenic
991865138 5:71053230-71053252 CTGAGTGTTCAAGAGTAAGGAGG - Intronic
992761863 5:79957555-79957577 CACAGTGGAAAGGAGGAAGTAGG + Intergenic
993274809 5:85843718-85843740 GAGAGAGTACAGGAGCCAGGGGG + Intergenic
993552483 5:89291092-89291114 CAGAATGTGCGGGAGGAGGGGGG - Intergenic
994269276 5:97757982-97758004 AGGTGTGTACAGGAGGAAGATGG - Intergenic
994519780 5:100818409-100818431 GAGAGTGTACATGAGAAAAGTGG - Intronic
995240865 5:109884525-109884547 CAGCCTGTACAGGAGGACGGAGG + Exonic
995686796 5:114780598-114780620 GAGGGTGTACAGGAGAAAGAGGG - Intergenic
996400012 5:123052287-123052309 CAGGGAGTACAAGAGGAAGATGG - Intergenic
997717993 5:136056407-136056429 CAGAGGCCACAGGAGAAAGGAGG - Intronic
999008259 5:148006007-148006029 CAGTTTGTATAGGAGGAGGGAGG - Intergenic
999247007 5:150160421-150160443 CTGAGTGTCCAGGAGGTAGGGGG - Intergenic
1000166797 5:158657548-158657570 CAGAGTGTGAGTGAGGAAGGTGG - Intergenic
1000821740 5:165993309-165993331 AAGAGTGGCCAGGAGGAAGGAGG - Intergenic
1001241011 5:170069829-170069851 CAGAGTCCACAGGAAGAAGAGGG - Intronic
1002094874 5:176824806-176824828 CAGAGAGTACACAAGGTAGGGGG - Intronic
1002389500 5:178898703-178898725 CATGCAGTACAGGAGGAAGGGGG - Intronic
1002415218 5:179116920-179116942 CACAGTGCCAAGGAGGAAGGGGG + Intronic
1002575749 5:180172779-180172801 CAGGGAGTACAGGAGGCAGGGGG - Intronic
1002701908 5:181130509-181130531 CAGGGTGTCCTGGAGGCAGGTGG - Intergenic
1002703889 5:181147637-181147659 CAGGGTGTCCTGGAGGCAGGTGG + Intergenic
1003554563 6:7128304-7128326 GAGATTGTGCAGGAGGAAGTAGG + Intronic
1003606469 6:7565826-7565848 CAGAGGGTGGAGGTGGAAGGAGG + Intronic
1004288548 6:14345738-14345760 TAGAGTTTCCAGAAGGAAGGAGG + Intergenic
1005675933 6:28154859-28154881 CACAGTGTACAGTGGGGAGGTGG - Exonic
1005881716 6:30067373-30067395 CAGGGAGGAGAGGAGGAAGGGGG - Exonic
1006656865 6:35602703-35602725 AACAGTGCAGAGGAGGAAGGCGG - Intronic
1007424469 6:41737731-41737753 CTGAGGATATAGGAGGAAGGTGG + Exonic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1011957102 6:93037155-93037177 CAGAATGTACAGGGGCAAGATGG + Intergenic
1012239271 6:96853770-96853792 AAAAGTGTACAGGAGGACTGTGG - Intergenic
1014241614 6:119024023-119024045 CAGATGGTACAGGATGAAGCTGG - Exonic
1016461911 6:144286469-144286491 CTGAGGGGACAGGAGGAGGGGGG + Intronic
1016743972 6:147558599-147558621 CAGAGTTTCTAGGAGGACGGGGG - Intronic
1017071068 6:150576039-150576061 CAGTGTCTACACGAGGAAGATGG + Intergenic
1017392658 6:153958283-153958305 CAGAGTGAACAGGCTGATGGGGG + Intergenic
1017493322 6:154962891-154962913 CAGAGGGCACATGGGGAAGGTGG + Intronic
1017743520 6:157427168-157427190 CTGGGAGCACAGGAGGAAGGAGG + Intronic
1018365005 6:163110987-163111009 CAGAATGTCCAGCAGGAAGAGGG - Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018681620 6:166270192-166270214 CAGGGAGGACAGGAGGATGGAGG + Intergenic
1019571956 7:1717028-1717050 CAGAGCATGCAGGAGGGAGGAGG + Intronic
1019740577 7:2671011-2671033 CAGAGAGTTCAGGATGAGGGTGG + Intergenic
1019796551 7:3054206-3054228 CTGAGTGTGCAGGAGGAGAGTGG + Intergenic
1022029270 7:26477544-26477566 GAGACTGCAGAGGAGGAAGGAGG + Intergenic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1023560667 7:41470306-41470328 CAGAGTCTGAAGGAGGAGGGAGG - Intergenic
1024185672 7:46945867-46945889 CAGAGTGTCCAGGCAGAGGGAGG + Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024323099 7:48089055-48089077 GAGGGTGGAGAGGAGGAAGGCGG + Intronic
1025279114 7:57614295-57614317 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1025305617 7:57851205-57851227 CAGAGTGTAAAGGGGGCAGAAGG - Intergenic
1026257155 7:68722297-68722319 CAGCGTTTACAGGAAGAAGGAGG + Intergenic
1026674430 7:72417094-72417116 CAGTGAGTACAGGCGGAGGGCGG + Intronic
1026944481 7:74307056-74307078 AATAGTGAACAGGAAGAAGGGGG - Intronic
1027355629 7:77351796-77351818 CAAAGTGTCCAGGAGGCAGCTGG - Intronic
1028150207 7:87363556-87363578 CAGAGTACACAGGAGGGAGCTGG + Intronic
1029438402 7:100574786-100574808 GGGAGGGCACAGGAGGAAGGGGG + Exonic
1029607750 7:101609307-101609329 CTGAGAGGCCAGGAGGAAGGAGG - Intergenic
1029709677 7:102292857-102292879 GTGAGGGTGCAGGAGGAAGGGGG + Intronic
1031049663 7:116932188-116932210 CTGAGTGCACAAGAGTAAGGGGG - Intergenic
1031444542 7:121834823-121834845 TAGAGGGTAGAGGAGGGAGGTGG - Intergenic
1031981662 7:128130913-128130935 CAGGGAGAAAAGGAGGAAGGAGG - Intergenic
1032511485 7:132475951-132475973 CAGAGAGAACATGAGGGAGGTGG + Intronic
1034349892 7:150408712-150408734 GAGTGTGTACAGGAGCCAGGAGG - Intronic
1034744764 7:153513994-153514016 CAGTGTGGAGAAGAGGAAGGAGG + Intergenic
1034844998 7:154436322-154436344 AAGAGTATACAGGAAGGAGGTGG - Intronic
1034860203 7:154588206-154588228 CAGAGTGTCCCAGAGGAGGGAGG + Intronic
1035410568 7:158637449-158637471 CAGAGTCTGCTGGAGAAAGGGGG - Intronic
1035538186 8:407698-407720 CAGAGTGGCCTGGAGGAATGAGG - Intronic
1035939835 8:3886786-3886808 CAAAGATTACAGAAGGAAGGAGG + Intronic
1036099268 8:5759609-5759631 TGGAGTGTACAGGAGGTAAGAGG - Intergenic
1036191831 8:6678014-6678036 CAGAGTATACAGGAAGGAGCGGG + Intergenic
1036425403 8:8641386-8641408 CAGAGTGTGTAGGAGGAGGGAGG - Intergenic
1037499868 8:19475180-19475202 CAGAGTGTACAAGAGTATGGAGG + Intronic
1037646494 8:20797039-20797061 GGGAGTGTTCAGGAGGGAGGTGG + Intergenic
1037716812 8:21407904-21407926 CAGAGTGGGGAGGAGGAAGGTGG - Intergenic
1037783231 8:21885744-21885766 CAGAGTGGACGAGAGGAAAGAGG - Intergenic
1038542768 8:28402751-28402773 CTGTGTGTGCAGGAGGCAGGAGG - Intronic
1039094852 8:33872463-33872485 CAGAGGGGAAAGGAAGAAGGTGG + Intergenic
1039339701 8:36634138-36634160 CAGAATGCAGAGGAGGAAGCTGG - Intergenic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039560690 8:38510339-38510361 CAGGGTGGAAAGGAGGGAGGGGG + Intergenic
1039818986 8:41119567-41119589 GAGTGAGTACATGAGGAAGGGGG - Intergenic
1040445765 8:47491973-47491995 CAGGCAGTACAGGAGGAACGAGG + Intronic
1040520593 8:48172961-48172983 GAGGGTGGACAGGAGGAAGAGGG - Intergenic
1041793448 8:61721973-61721995 GAGTGGGGACAGGAGGAAGGAGG - Intergenic
1041903584 8:63008214-63008236 TAGAGTTTCCAGGAGGAGGGGGG - Intergenic
1046092644 8:109521203-109521225 TAGAGTGCTCAGGAAGAAGGAGG - Intronic
1047132741 8:122039088-122039110 CAGAGTGTTGAGAAGGAAGCGGG - Intergenic
1047188985 8:122661019-122661041 CTGAATGTAGGGGAGGAAGGTGG - Intergenic
1047545000 8:125807326-125807348 AAGAGTGTACAAGCAGAAGGCGG + Intergenic
1047636383 8:126767679-126767701 CAGACTGTACAGGAAGCATGGGG - Intergenic
1047818295 8:128489396-128489418 CAGAGAGGACAGTAGGCAGGAGG + Intergenic
1048167617 8:132077334-132077356 TGGAGTCTAGAGGAGGAAGGTGG + Intronic
1048465391 8:134661232-134661254 CAGAGTGTCGTGGAGGCAGGAGG + Intronic
1048711530 8:137217348-137217370 CAGAACGTACAGGAAGAATGGGG - Intergenic
1049370274 8:142261072-142261094 GAGAGAGGAAAGGAGGAAGGAGG + Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1051025444 9:12605110-12605132 CAGATTGAACAGGAGAAATGTGG + Intergenic
1051500217 9:17768584-17768606 CAGAGTGAACAAGAGGGAGAAGG - Intronic
1051910952 9:22154190-22154212 CCCAGGGTACAGGAGGAAGCTGG + Intergenic
1052030107 9:23618927-23618949 CAGAGTGAGCAGGGAGAAGGAGG - Intergenic
1052037720 9:23701905-23701927 AAGAGTGTACGGGAGGGAGGTGG - Intronic
1052268601 9:26603222-26603244 CAGAGTGTACACAATGAAGTGGG - Intergenic
1052857905 9:33418399-33418421 CAGAGAGTACAGCAGGAAGAGGG + Intergenic
1053232980 9:36427376-36427398 CAGCTTGTACAGGAGAAAGGAGG - Intronic
1053277492 9:36794438-36794460 CAGTGTGTGGAGGAGGCAGGAGG - Intergenic
1053353617 9:37429358-37429380 CAGAGGGTCCAGGACAAAGGAGG + Intronic
1054770442 9:69078435-69078457 CTGAGAGAAAAGGAGGAAGGTGG - Intronic
1056251677 9:84754804-84754826 CAGATGGGACAGGAGGAAGGTGG + Intronic
1057022185 9:91707843-91707865 CAGTGTGGACAGGAGGATGGGGG + Intronic
1057204661 9:93164091-93164113 CAGAGTGTCCAGGGAGAAGCTGG - Intergenic
1057334109 9:94142385-94142407 GAGAGGGTACAGGAGGCAGCAGG - Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1058918218 9:109587874-109587896 CAGAGACTGCAGGAGGAAGGTGG + Intergenic
1059094284 9:111395836-111395858 CAGTTTGTATAGAAGGAAGGAGG - Intronic
1060035084 9:120248294-120248316 CAGGGGGTGCAGGAAGAAGGAGG + Intergenic
1060887040 9:127161584-127161606 CACAGTGGACATGAGGGAGGTGG + Intronic
1060965930 9:127712324-127712346 CAGAATGTTCTGTAGGAAGGAGG - Exonic
1061022175 9:128023058-128023080 CAGAGGGTAGAGGAGGAAGTGGG - Intergenic
1061212842 9:129203518-129203540 CAGAGGGAACAGCATGAAGGAGG + Intergenic
1061271963 9:129548843-129548865 CTAAGTGTCCAGGAGGCAGGGGG - Intergenic
1061532505 9:131225898-131225920 GGGAGAGGACAGGAGGAAGGTGG + Intronic
1061567070 9:131447949-131447971 CAGGGAGTAAATGAGGAAGGAGG - Intronic
1062129653 9:134885603-134885625 CAGACTCCACAGGATGAAGGAGG - Intronic
1203630176 Un_KI270750v1:66909-66931 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1185627302 X:1491983-1492005 CAAAGTGGACCGGAGGGAGGCGG - Intronic
1185648085 X:1629295-1629317 CAGAGAGGACAGGAGGAGAGAGG + Intronic
1185932530 X:4219022-4219044 CAGTGTGTACTGGCTGAAGGTGG + Intergenic
1186732510 X:12425208-12425230 AAGACTAAACAGGAGGAAGGTGG - Intronic
1186889002 X:13941725-13941747 CAGTGTGTGGAGGAGGACGGAGG - Intergenic
1187357597 X:18591778-18591800 CTGAGTCTAGGGGAGGAAGGAGG - Intronic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1189823975 X:44898516-44898538 CTGTGTGTGCAGGAGGGAGGTGG + Intronic
1189931652 X:46018465-46018487 CAAAGAGTACAGTAGGAAGAGGG - Intergenic
1190041626 X:47077024-47077046 CAGAGTGCTCAGGAGGTTGGTGG + Intergenic
1190446728 X:50533216-50533238 AAGAGTGTACAGGAAAAAGAGGG + Intergenic
1190463152 X:50698907-50698929 CAGAGTTAGGAGGAGGAAGGTGG - Intronic
1190535141 X:51418404-51418426 CAAAGAGTAGAAGAGGAAGGAGG - Intergenic
1190729764 X:53217947-53217969 CAGATTGTGGTGGAGGAAGGTGG - Exonic
1190909703 X:54759348-54759370 CAGAGTTGACAGGAGGCAGTGGG + Intronic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1195465541 X:105174741-105174763 CAGAGCGTACAGGGTGAGGGTGG - Intronic
1195540060 X:106053296-106053318 CAGAGGCTGCAGAAGGAAGGGGG + Intergenic
1200061739 X:153486820-153486842 GAGTGTGTGCTGGAGGAAGGCGG - Exonic
1200655885 Y:5901711-5901733 CAGAGTGCAAAGAATGAAGGAGG - Intergenic