ID: 934951125

View in Genome Browser
Species Human (GRCh38)
Location 2:98576422-98576444
Sequence CTGTGGGGCTGGTGGTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 0, 2: 7, 3: 52, 4: 612}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934951116_934951125 2 Left 934951116 2:98576397-98576419 CCGGGAAAGTATGGCGGGAGGAG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG 0: 1
1: 0
2: 7
3: 52
4: 612

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934951125 Original CRISPR CTGTGGGGCTGGTGGTCAGG AGG Intronic
900183780 1:1323936-1323958 CTGGGGGGCTGAGGGTCTGGGGG + Intronic
900183854 1:1324128-1324150 CTGAGGGGCTGGGGGGCTGGGGG + Intronic
900396609 1:2455626-2455648 CTGGGGTCCTGGGGGTCAGGCGG + Intronic
900429621 1:2595578-2595600 CTGTTGGGCTCTAGGTCAGGTGG - Intronic
900550619 1:3252609-3252631 GGGTGGGGCTGGTGGGCAGCAGG + Intronic
900698052 1:4024498-4024520 AGGTGGGGCTGGTGATTAGGAGG + Intergenic
900996048 1:6124256-6124278 CAGGGGAGCTTGTGGTCAGGAGG - Intronic
901210147 1:7520084-7520106 TTGGGGGGCTGGTGGACTGGTGG - Intronic
901821657 1:11834311-11834333 CCGTGAGGCTGATGGTCATGCGG - Exonic
902579393 1:17398794-17398816 CTCTTGGGCTGCTGGTCAGAGGG - Exonic
902817898 1:18926538-18926560 CTCTGAGGCTGGTGGCCAGGAGG + Intronic
902881441 1:19374370-19374392 CGATGGGGTTGGTGGTCATGAGG + Intronic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
902944977 1:19829051-19829073 GGGTGGGGAGGGTGGTCAGGAGG - Intergenic
903070419 1:20724396-20724418 CAGAGGGGCTGGTGGGCAGTGGG - Exonic
903499248 1:23792569-23792591 GTGTGGGGCTGATGGCCTGGTGG + Intronic
903680503 1:25093277-25093299 CTCTGGGACTGGTGGGCTGGGGG - Intergenic
903795710 1:25927548-25927570 CTGTGAGTCTGGGAGTCAGGGGG + Intergenic
904035586 1:27557023-27557045 CTGTGTGGCTGGGGGTAGGGTGG - Intronic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
904466443 1:30710895-30710917 CTGTGAGGCTGGGGGTTGGGGGG - Intergenic
905031396 1:34886286-34886308 CTGGGGGGCAGGGGGTCGGGAGG + Intronic
905270630 1:36785318-36785340 CTGTGGGGCTCATAGTCTGGAGG + Intergenic
905348612 1:37328711-37328733 CTGTGGGACTGGGGGTTGGGTGG - Intergenic
905894727 1:41538112-41538134 CAGTGGGGGTGGGTGTCAGGTGG + Intronic
906523641 1:46481366-46481388 CTGTGGGGCTGGTCATAGGGAGG + Intergenic
906730473 1:48076524-48076546 CTGTTGGGCAGCTGGTCAGCCGG + Intergenic
907964577 1:59316871-59316893 ATATGGGGAGGGTGGTCAGGCGG - Intronic
908920579 1:69186545-69186567 TGCTGGGGCTGGTGGTCTGGGGG - Intergenic
909615744 1:77606219-77606241 CTGTGGTGATGGTGGCCATGGGG + Intronic
909781969 1:79558854-79558876 CTGTGGTGGTGGTGGTCACATGG + Intergenic
910118809 1:83761570-83761592 CTGAGGGGTGGGTGGGCAGGGGG - Intergenic
910739397 1:90498323-90498345 ATGTGGGCCTGGTGGTTAGTTGG + Intergenic
911121718 1:94303029-94303051 TGTTGGGGCTGGTGGTCTGGGGG - Intergenic
913075580 1:115338342-115338364 GTGCGGGGCTGGTGGTGGGGAGG - Intergenic
913227619 1:116713808-116713830 CACTGGGGCTGGTGGTCTGGGGG + Intergenic
913438005 1:118867281-118867303 TTGTGGGGGTGGTGGTAAAGAGG - Intergenic
913503640 1:119495811-119495833 CGCTGGGGCTGGTGGTCCAGAGG + Intergenic
913510657 1:119558730-119558752 CGCTGGGGCTGGTGGTCTAGAGG + Intergenic
913531715 1:119738372-119738394 GTGTGGGGCTGCTGGGCAGCAGG - Intronic
915088340 1:153404191-153404213 CTGTAGGGCTGCTGAGCAGGTGG - Intergenic
915972636 1:160365426-160365448 CTGGGGGGCAGGGGATCAGGTGG - Intergenic
916120721 1:161525774-161525796 CTATGGGGCTGCTGTGCAGGCGG + Exonic
916130488 1:161607407-161607429 CTATGGGGCTGCTGTGCAGGCGG + Intronic
916522387 1:165575877-165575899 GCGTGGGCCTGGGGGTCAGGAGG - Intergenic
918124665 1:181572487-181572509 CTGTGCTGGTGGTGGTCAGAGGG + Intronic
918962880 1:191303183-191303205 GTGAGGAGCTGGTAGTCAGGGGG + Intergenic
919552883 1:199013999-199014021 CTGTGGGGAAGCTGGTGAGGTGG + Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
920091016 1:203453300-203453322 TCCTGGGGCTGGTGGCCAGGAGG - Intergenic
920115200 1:203615842-203615864 CTGTGGCACTGGTGTACAGGTGG - Intergenic
920128184 1:203710512-203710534 GTGTGGTGCTGGTGGTTTGGGGG - Intronic
920432444 1:205927635-205927657 GTGTGGGGCTGGGGGGCACGGGG + Intronic
920679240 1:208060110-208060132 CTGTGGAGTTGGTGGGCAGGAGG - Intronic
922358053 1:224795444-224795466 CTGTGGTGGTGGTGGACATGGGG - Intergenic
922377194 1:224980362-224980384 CTGTGGTGGTGGTGGCCACGGGG + Intronic
923124130 1:231020782-231020804 TTGTGGGGCTAGTTTTCAGGAGG - Intronic
923283343 1:232466126-232466148 CTGTGGGGCTGGTTATCACTGGG + Intronic
923363208 1:233233608-233233630 CTAATGGGCGGGTGGTCAGGAGG - Intronic
924873519 1:248075017-248075039 CTCAGGGGCTGGGGGTCTGGGGG - Intronic
1062771240 10:103284-103306 GCGTGGGGCTGGGGGTGAGGGGG - Intergenic
1062911475 10:1215127-1215149 CCAAGGGGCTGGAGGTCAGGGGG - Intronic
1063375806 10:5553636-5553658 CTGTGGGGCTGGGAGGGAGGAGG - Intergenic
1064409573 10:15093235-15093257 CACTGGGGCTGGTGGTCCGGGGG + Intergenic
1065093453 10:22258667-22258689 CTGAGGGGCAGGTGGTCAGATGG - Intergenic
1065808469 10:29418524-29418546 ATGGGGGGCTGGTGGTGATGGGG - Intergenic
1065917354 10:30364922-30364944 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1066653067 10:37678193-37678215 CTGTGGGGCTGCTGTTTAGGTGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067077733 10:43197678-43197700 CTGTGGGATTGGAGGTCAGGAGG - Intronic
1067513087 10:46911516-46911538 CTGGGGGCCAGGTGGGCAGGGGG + Intronic
1067649166 10:48140326-48140348 CTGGGGGCCAGGTGGGCAGGGGG - Intergenic
1067719810 10:48719781-48719803 CTTAGGGGCTCGTGTTCAGGTGG + Intronic
1067807455 10:49403068-49403090 GTGTCGGGCTGGGGATCAGGAGG - Intergenic
1067854572 10:49781057-49781079 GTGTTGGGCTGGGGATCAGGAGG - Intergenic
1068103842 10:52590333-52590355 CTCTGGGGCTGGGGGTGGGGTGG + Intergenic
1068103896 10:52590722-52590744 CTGTGGTGGTGGTGGCCAAGGGG - Intergenic
1068338319 10:55667316-55667338 CCCTGGGGCTGGTGGTCTGGGGG + Intergenic
1069549509 10:69353132-69353154 ATGGGGGGCTGGTTGCCAGGGGG + Intronic
1069708861 10:70476504-70476526 CTGGGGGGCTGGTGGTGGGCTGG + Intergenic
1069907753 10:71741847-71741869 CTCTGGCGCTCGCGGTCAGGCGG - Intronic
1069933524 10:71899836-71899858 CTGTGGTGGTGGTGGCCACGGGG - Intergenic
1071124446 10:82318058-82318080 CTTTGTGTCTGGTGGGCAGGGGG + Intronic
1071167357 10:82822366-82822388 CTGCTGGGCTGCTGCTCAGGAGG - Intronic
1071418533 10:85464293-85464315 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1072681274 10:97508703-97508725 GTGTGGAGGTGGTGGTCTGGGGG - Intronic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1074856972 10:117480805-117480827 CTGTGGTGCTGGTGGCTGGGAGG + Intergenic
1075194989 10:120348523-120348545 CTGTGGTGGTGGTGGCCATGAGG + Intergenic
1075788555 10:125066974-125066996 ACCTGGGCCTGGTGGTCAGGCGG - Intronic
1076048003 10:127310266-127310288 CTGTAGGGGTGGGGGTAAGGGGG - Intronic
1076066527 10:127452783-127452805 CTGTGGGGCTGCAGATCATGTGG + Intergenic
1076473255 10:130734915-130734937 ATGTGGAGCTGGTGGTAAGGAGG + Intergenic
1076607393 10:131697897-131697919 CTGAGGAGCAGCTGGTCAGGAGG - Intergenic
1076744046 10:132503945-132503967 CTGGGGGTGTGGTGGACAGGTGG - Intergenic
1077052219 11:572059-572081 CGGTGGGGGTGGGAGTCAGGAGG + Intergenic
1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG + Intronic
1077187933 11:1243765-1243787 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077188360 11:1245436-1245458 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077188890 11:1247536-1247558 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077189315 11:1249207-1249229 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077329815 11:1979334-1979356 CAGTGGGGCTGTTTGCCAGGTGG - Intronic
1077486607 11:2841622-2841644 CTGTGGGGCTGTTGGCCTGCAGG + Intronic
1080128630 11:28766965-28766987 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1080489784 11:32750607-32750629 CTGTGGTGGTGGTGGCCATGGGG - Intronic
1080522832 11:33082702-33082724 ATCTGGGGCTGGTGGTGTGGGGG - Intronic
1080588771 11:33703588-33703610 CTGTCGGCCTGGTAGCCAGGTGG + Intronic
1080589313 11:33707741-33707763 CTGTCGGCCTGGTAGCCAGGTGG + Intronic
1080682180 11:34487221-34487243 CTCTGGGGCTGGCTCTCAGGTGG + Intronic
1081132275 11:39394745-39394767 CTGTGGGATCGGTGGTGAGGTGG + Intergenic
1081202641 11:40236515-40236537 CTGTGAAGGTGGTGGTGAGGAGG - Intronic
1081568650 11:44276096-44276118 CAGTGGGGCTTGGGGTGAGGAGG + Intronic
1081733003 11:45384734-45384756 CTGTGGGGCTGGCGTTGGGGAGG - Intergenic
1081752538 11:45522194-45522216 CTGTGGGACTGAAAGTCAGGTGG - Intergenic
1082044652 11:47715111-47715133 GTCTGGGGCAGGTGGTGAGGGGG + Intronic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1082894275 11:58173638-58173660 CTGAGGGGGTGGGGTTCAGGGGG - Intronic
1083184192 11:61008005-61008027 CGGTGGGGGTGGAGGTCTGGAGG - Intronic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG + Exonic
1083697186 11:64450600-64450622 CTTTGAGCCTGGTGGTCAGGAGG - Exonic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083827764 11:65212796-65212818 GTGAGGGGCTGGAGGGCAGGAGG + Intergenic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1083885959 11:65573638-65573660 CTGAAGGGCTGGGGGGCAGGGGG + Exonic
1084004423 11:66315481-66315503 ATAGGGGGCTGGTGGGCAGGAGG + Exonic
1084014144 11:66368858-66368880 CTGTGGGGCTGTTGACCAGGAGG + Intronic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084088788 11:66866803-66866825 CTGTGTGGGTGGTTGTGAGGGGG + Intronic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1085753505 11:79184543-79184565 GTGTGGGGGTGGAGGTTAGGGGG + Intronic
1086423269 11:86658713-86658735 CAGTGGGGCAGCTGGCCAGGTGG - Intronic
1087031968 11:93715250-93715272 CTGTGGTGGTGGTGGACAAGGGG - Intronic
1088009865 11:104986697-104986719 CTGTGGTGCTGGTGGCCACAGGG + Intergenic
1088685960 11:112284799-112284821 CTGTGAAGCTGGTGGGCATGAGG + Intergenic
1088697608 11:112381815-112381837 CTCTGGGGCGGGTGGTGGGGAGG + Intergenic
1089198428 11:116708954-116708976 CTCTGGAGGTGGTTGTCAGGAGG - Intergenic
1089650121 11:119907488-119907510 CTGGGTGGCTGGTGGACAGGTGG + Intergenic
1089683971 11:120135121-120135143 ATGTGGTTCTGGTGGGCAGGAGG - Intronic
1090192038 11:124778512-124778534 CTGTAGGGATAGAGGTCAGGAGG + Intronic
1090597796 11:128337814-128337836 AGGTGAGGCTGATGGTCAGGAGG + Intergenic
1090804850 11:130196503-130196525 CCGGGGGGCTGGGGGTCTGGTGG - Intronic
1202812793 11_KI270721v1_random:34513-34535 CAGTGGGGCTGTTTGCCAGGTGG - Intergenic
1091622478 12:2099804-2099826 CTGTGGTGCTGGGGGTAATGGGG - Intronic
1091763757 12:3104925-3104947 GTGTGGGGGTGATGGGCAGGGGG + Intronic
1092090698 12:5801500-5801522 CTGTAGGGCTGATGTTCAGATGG - Intronic
1092670916 12:10859377-10859399 TTGTGGTGATGGTGGCCAGGGGG + Intronic
1093728662 12:22543978-22544000 CTGAGGGGCTGGGGGCGAGGTGG + Intronic
1093931857 12:24961699-24961721 CTGGGGTGGTGGTGGTCATGGGG + Intergenic
1094056279 12:26272615-26272637 CTCCGGTGGTGGTGGTCAGGGGG + Intronic
1094707576 12:32929252-32929274 ATTTGTGGCTGGTGGGCAGGGGG - Intergenic
1095861253 12:46920219-46920241 CTGTTGGTCTGGTGCTAAGGAGG - Intergenic
1096891131 12:54772674-54772696 GTGGGGGGCTGGTGGGGAGGTGG - Intergenic
1096984759 12:55748973-55748995 CCGAGGGGCTGGTGAGCAGGGGG + Exonic
1098649022 12:72941166-72941188 CTGGGGTGGTGGTGGTCATGAGG - Intergenic
1099176870 12:79432357-79432379 TTGTGGGGTTGGGGGGCAGGGGG - Intronic
1100367748 12:93937085-93937107 CTGTGGTTCTGATGGTCTGGTGG - Intergenic
1101607536 12:106258909-106258931 CTGTGGTGGTGGTGGACATGGGG + Intronic
1101781112 12:107837015-107837037 TTGTGGGGGTGGTGTTCAGTGGG - Intergenic
1101865624 12:108517651-108517673 GTGTGGGGCTGATCCTCAGGTGG + Intronic
1102443878 12:112986556-112986578 CTGTGCTGCTGGTGGTAAAGAGG + Intronic
1102952983 12:117042357-117042379 CTGGGGGGCTGGTGGTGAGGTGG - Intronic
1103145199 12:118589612-118589634 CTGTGGGGAGTGTGGTCAGCAGG + Intergenic
1103446708 12:120999605-120999627 CTGTGGGGCTGGCGCTGAGCCGG - Exonic
1103506123 12:121443253-121443275 CTGTGGGGTGGGAGGTCAGTTGG - Intronic
1103966953 12:124646102-124646124 ATGTGGGGCTGGGGGGGAGGGGG + Intergenic
1104211637 12:126694302-126694324 CTGAGTGGCTGGTGCTCATGGGG - Intergenic
1104430345 12:128711026-128711048 CTGCAGGGCTGGTGCTCAGTGGG - Intergenic
1104536453 12:129622226-129622248 CTGTGGGGCTAGTGGACGAGTGG - Intronic
1104928257 12:132324906-132324928 CTGTGGGGCTGGAGGGCTTGGGG - Intronic
1106388110 13:29307788-29307810 CACTGGGGCTGGTGGTCTGGGGG - Intronic
1107399331 13:40053721-40053743 CTGTGGTGATGGTAGTCAGTTGG - Intergenic
1107888849 13:44896502-44896524 CCGCGGGGGTGGGGGTCAGGAGG - Intergenic
1107913115 13:45123987-45124009 CACTGGGGCTGGTGGTCCAGGGG + Intronic
1109078227 13:57865026-57865048 CTGTGGGGCGGGTGGTGGGGGGG + Intergenic
1110271207 13:73592763-73592785 TTGTGGGGGAGGTGGGCAGGTGG + Intergenic
1111618392 13:90691446-90691468 CTGTGGGGCTCCTGCACAGGTGG - Intergenic
1112338894 13:98536867-98536889 CTGGGCGGCTGGAGGACAGGCGG - Intronic
1112907803 13:104445892-104445914 CTGTCGGGGTGGGGGTCAAGGGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113787737 13:113011482-113011504 CGGTGTGGATGGTGGACAGGTGG + Intronic
1113787761 13:113011605-113011627 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787827 13:113011932-113011954 CGGTGTGGATGGTGGACAGGCGG + Intronic
1113787857 13:113012096-113012118 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787873 13:113012177-113012199 CAGTGTGGATGGTGGACAGGCGG + Intronic
1113787895 13:113012300-113012322 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787921 13:113012443-113012465 CAGTGCGGATGGTGGACAGGTGG + Intronic
1113787968 13:113012689-113012711 CAGTGTGGATGGTGGACAGGTGG + Intronic
1114055752 14:18965928-18965950 CTGTGGGGCTTCTGGCCTGGGGG - Intergenic
1114106795 14:19435836-19435858 CTGTGGGGCTTCTGGCCTGGGGG + Intergenic
1114648506 14:24268852-24268874 CTGTGGGCCTGGTGCTGATGGGG - Intronic
1116149982 14:41128702-41128724 CTGGGGGGCTGGAGGGCTGGGGG - Intergenic
1116269693 14:42745602-42745624 GTGAGGGGCTGGTGGAGAGGTGG + Intergenic
1116892762 14:50284906-50284928 ATGTTGGGGTGATGGTCAGGTGG - Intronic
1117321728 14:54630650-54630672 CTTTGGTGGTGGTGGTCATGGGG + Intronic
1117753907 14:58954255-58954277 CAGTGTGGCTGGTGCACAGGTGG - Intergenic
1118375249 14:65171151-65171173 CAGTGGGGCTGGGGGACATGAGG + Intergenic
1119912018 14:78358189-78358211 CTGTAGGGGTGGTGGTAATGAGG + Intronic
1120697498 14:87660059-87660081 CTGTGGTGGTGGTGGTCACAAGG + Intergenic
1121620653 14:95345854-95345876 GTGTGGGGCGGGGGGTGAGGGGG + Intergenic
1121798092 14:96752308-96752330 CCCTGGGACTGGAGGTCAGGAGG + Intergenic
1122564809 14:102645590-102645612 CTTTGGGGCTGGGTGGCAGGTGG - Intronic
1122950845 14:105043679-105043701 CCGTGGGGCTGGGGGGCTGGGGG + Intergenic
1202852837 14_GL000225v1_random:31655-31677 GTGGGGAGGTGGTGGTCAGGCGG - Intergenic
1123707340 15:22959786-22959808 CTGAGAGGCTGGTGGGGAGGGGG - Intronic
1123984143 15:25630242-25630264 CTGTGGTGATGGGGGTCATGAGG - Intergenic
1124616371 15:31245251-31245273 CTATTGGTCTGGTGCTCAGGAGG - Intergenic
1124959098 15:34381927-34381949 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1124975724 15:34528148-34528170 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1125482332 15:40089196-40089218 CTGAGGGGGTGGAGGTCGGGGGG + Exonic
1125889988 15:43258710-43258732 CTGTGGTGCTGCAGGACAGGAGG - Intronic
1126063905 15:44810460-44810482 CTCTTGGACAGGTGGTCAGGAGG + Intergenic
1126856920 15:52847675-52847697 CTGTGGTGGTGGTGGTGGGGTGG + Intergenic
1127534214 15:59874859-59874881 CTGTGGCTCTGGTAGTCAGAGGG - Intergenic
1127993022 15:64134641-64134663 CTGTGGGGGTGGGGTTGAGGAGG - Intronic
1128901004 15:71422954-71422976 CTGTGGAGGTGGTGGCCACGGGG - Intronic
1129156459 15:73721393-73721415 CTGCGGTGCTGGTGCTCAGGGGG - Intergenic
1129296772 15:74604167-74604189 CTGTGGGGCTGGAGGTGTGTGGG + Intronic
1129465278 15:75721364-75721386 CTGTGGGGAAGGTGGTCTGTGGG + Intergenic
1129952792 15:79606953-79606975 CAGTGAAGCTGGTGGTCAGAGGG - Intergenic
1130979867 15:88804847-88804869 CTGTGGGGCTGGCTGCCAGGAGG + Intronic
1130988439 15:88860162-88860184 CTGTGGGCCAGGTGCCCAGGAGG + Intronic
1131513682 15:93063830-93063852 CTGTGGAGGTGGGGGTCAGTTGG + Intronic
1132574108 16:656880-656902 CCGTGGGGCTGGTGGCCAGCTGG - Intronic
1132865528 16:2091175-2091197 CTGTGGGGGGCGCGGTCAGGAGG + Intronic
1133232176 16:4372002-4372024 CTGTGGGGCTGGGGGGCTGCGGG + Intronic
1134903897 16:17962908-17962930 AGGGGGGGGTGGTGGTCAGGAGG - Intergenic
1135086787 16:19481510-19481532 CTGTGGAGCTGGTGTTTTGGTGG + Intronic
1135973625 16:27090267-27090289 CTGCTGGGCAGGAGGTCAGGGGG - Intergenic
1136133461 16:28239664-28239686 TGCTGGGGCTGGTGGTCCGGGGG + Intergenic
1136186491 16:28591567-28591589 CTGTGGGGCAGGCAGACAGGAGG - Intronic
1136188976 16:28604291-28604313 CTGTGGGGCAGGCAGACAGGAGG - Intergenic
1136417476 16:30112794-30112816 CTGTGGGGGTGAAGGTCAGCGGG + Intronic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1138129419 16:54466997-54467019 CTCTGGGGCTAGAAGTCAGGGGG - Intergenic
1138200282 16:55083264-55083286 CTGGGGCGCTGGTGTTGAGGTGG + Intergenic
1139957501 16:70700158-70700180 CTTTGGGGCTGGGGGTGGGGAGG - Intronic
1139969551 16:70765304-70765326 CTCTGGAGCTGCTGGTGAGGAGG + Intronic
1140912646 16:79467921-79467943 CTTTGGGGGTGGTGGTCGTGGGG + Intergenic
1141452920 16:84117401-84117423 CCGTGGGGCCGGGGGTCAGGAGG - Intergenic
1141569051 16:84923123-84923145 CTCTGGGGCTGATGGACAGCTGG - Intergenic
1141611958 16:85186953-85186975 CTGAGGGGCTGGTGGGAAAGAGG - Intergenic
1142005563 16:87688034-87688056 TGGTGGGGCTGGGCGTCAGGTGG + Intronic
1142138437 16:88461982-88462004 CAGTAGGGCTGGTGGCCTGGGGG - Intronic
1142283026 16:89159445-89159467 CAGACGGGCTGGTGCTCAGGGGG - Intergenic
1142410556 16:89913783-89913805 CGGTGGGACTGTTGGTCCGGCGG + Intronic
1142919618 17:3172767-3172789 CTGTGGTGGTGGTGGACATGGGG + Intergenic
1142970910 17:3610883-3610905 CTGTCGGGGTGATGGTCAGGTGG + Exonic
1143120527 17:4603747-4603769 CTGTGTGGCAGGTGGAAAGGAGG + Intronic
1143282484 17:5765251-5765273 GAGTGGGGCTGGGAGTCAGGTGG - Intergenic
1143413754 17:6729467-6729489 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1143593133 17:7897948-7897970 CTGTGGGGCAGGAGGCCATGGGG - Intronic
1143644249 17:8219737-8219759 CTGTGTGGATGGTGGTGAGATGG + Intergenic
1143707726 17:8711016-8711038 CTGTGGGGCTAGCTGTCAGCTGG - Intergenic
1143709829 17:8726622-8726644 CTGTAGGGGTGGTGCTGAGGGGG + Intergenic
1143730517 17:8880299-8880321 CTGAGGCTCTGGTGCTCAGGGGG - Exonic
1144201946 17:12949528-12949550 CTGTTGACATGGTGGTCAGGAGG + Intronic
1144872675 17:18380653-18380675 GTGTGGTGCTGGGTGTCAGGCGG - Intronic
1145293081 17:21565272-21565294 CTCTGGAGCTGGTGCTCAGATGG - Intronic
1145386888 17:22420654-22420676 CTCTGGAGCTGGTGCTCAGATGG + Intergenic
1146208959 17:30927017-30927039 CTATGGGCCTGGTGCGCAGGTGG + Intronic
1146872482 17:36385446-36385468 CTGTGGGGCTGATTCCCAGGAGG + Intronic
1147421657 17:40324866-40324888 CTGTGGGGTTGGTGGGGAAGAGG + Intronic
1147677925 17:42220110-42220132 CTGTGAGGCAGGCGGGCAGGAGG - Intronic
1147688123 17:42299462-42299484 CTGTGAGGCAGGCGGGCAGGAGG + Intronic
1147728589 17:42582314-42582336 ATGTGGGGCTGGGGCACAGGAGG - Intronic
1147770877 17:42867133-42867155 GTGTGGTGCTGCTGGTCAAGAGG - Intergenic
1148156150 17:45426144-45426166 GGGTGGGGCTTGGGGTCAGGGGG + Intronic
1148511628 17:48175856-48175878 CTGTGTGGCTGGGGCTCAGTGGG + Intronic
1148823505 17:50375369-50375391 CTCTGGTGCTGGAGGACAGGAGG - Exonic
1149085157 17:52708039-52708061 GTGTGGGGTTGGTGGGGAGGTGG + Intergenic
1150141494 17:62733548-62733570 CTGGTGGGCTGGTGGGCTGGTGG - Intronic
1150284104 17:63945825-63945847 CTGCAGGCCTGGTGGTCAAGAGG + Intronic
1150284873 17:63949007-63949029 CACTGGGGCTGGGGGCCAGGAGG - Intronic
1150577154 17:66440629-66440651 GTCTGGGACTGGTGGTCAAGGGG + Intronic
1151306793 17:73267741-73267763 GGGAGGGGCTGGAGGTCAGGAGG + Intergenic
1151431978 17:74069912-74069934 CTGTGGGGCTGGTGTAAAGAAGG - Intergenic
1151855087 17:76715306-76715328 CTGTGGGCGTGGGGGTAAGGAGG + Exonic
1151979103 17:77498500-77498522 CTGTGGGGGTGGGGGGCGGGCGG - Intronic
1152863310 17:82708842-82708864 GGGTGGGGCTGGTGGTAAGGGGG - Intergenic
1152863327 17:82708882-82708904 GGGTGGGGCAGGTGGTAAGGGGG - Intergenic
1152863344 17:82708922-82708944 GGGTGGGGCTGGTGGTAAGGGGG - Intergenic
1152863377 17:82709002-82709024 GGGTGGGGCTGGTGGTAAGGGGG - Intergenic
1153528165 18:6016947-6016969 CTGAGAGGCGGATGGTCAGGAGG - Intronic
1153627875 18:7038806-7038828 CTCTTGGCCTGTTGGTCAGGTGG - Exonic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1153909707 18:9696227-9696249 CTGTCTGCCTTGTGGTCAGGTGG - Intergenic
1153948558 18:10037956-10037978 CTGTGTGCCACGTGGTCAGGAGG - Intergenic
1156622718 18:38872283-38872305 CAGGGGGTCTGGGGGTCAGGGGG - Intergenic
1157364222 18:47048765-47048787 CTGTGGGGCTTGTTGTCATAGGG + Intronic
1157404933 18:47414756-47414778 GGGTGGGGATGGTGCTCAGGAGG - Intergenic
1157851051 18:51051153-51051175 CTATGGGGCTGTTTGTGAGGGGG + Intronic
1157937023 18:51884262-51884284 CTGTGGTGCTGGTGGCCCTGGGG + Intergenic
1158468650 18:57714162-57714184 CTGTGGTGGTGGTGGACATGGGG + Intronic
1160702336 19:513781-513803 ATGTGGGGCTGGTGTGCAGTAGG - Intronic
1160719876 19:592364-592386 CTGGGGGGCAGGTGGGCAGATGG + Intronic
1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG + Intronic
1161113722 19:2484944-2484966 CTCTGTGGCTGGTGGTTTGGAGG + Intergenic
1161398787 19:4058680-4058702 CTGCTGGGCTGGGGGACAGGAGG - Intronic
1161422452 19:4183343-4183365 CAATGGGGCTGGTGGCCTGGAGG + Exonic
1161627090 19:5333608-5333630 CTTTGTGGCTGGAGGTGAGGGGG - Intronic
1161820733 19:6529255-6529277 CTGGGGGGTTGGGGATCAGGGGG + Intergenic
1162193126 19:8962720-8962742 CTGTCTGGGTGGTGGTCATGTGG + Exonic
1163186360 19:15641864-15641886 CTGCGGGGCTCTTGGGCAGGGGG + Intronic
1163497754 19:17656446-17656468 CTGTGTGACTGGGGCTCAGGTGG - Intronic
1163622646 19:18369971-18369993 TTGTGGGGCTGGAGTTCAGCTGG + Intergenic
1164387275 19:27783677-27783699 CTGAGGGACTGGCTGTCAGGGGG + Intergenic
1165018058 19:32898401-32898423 GTGGGGGGCTGGGGGGCAGGTGG + Intronic
1165250033 19:34523676-34523698 ATGTGGGTCTGGTGCACAGGTGG + Intergenic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165286191 19:34844353-34844375 CAGTGGGGGTGCTGGGCAGGGGG + Intergenic
1165350216 19:35271167-35271189 CTGTGAGGGTGGTGGTCAGGGGG - Intronic
1165364998 19:35359892-35359914 CTGTGGAACTGGTGGCCAGGTGG + Exonic
1165366817 19:35372361-35372383 CTGTGGAACTGGTGGCCAGGTGG + Exonic
1165712669 19:38023249-38023271 CGGTGGGGCCGGGGGTCAGGGGG + Intronic
1166103451 19:40585226-40585248 CTGTGGTTCTGCTGTTCAGGAGG - Intronic
1166120341 19:40682696-40682718 CTGTGGGGGTGGACGCCAGGGGG - Intronic
1166354374 19:42218231-42218253 CTGCGGGGGTGGTGGTGGGGGGG - Intronic
1166416040 19:42595566-42595588 CTGTGGGCCTAGTGGTCATCAGG + Intronic
1166639434 19:44482553-44482575 GGGTGGGGGTGGTGTTCAGGAGG - Intronic
1166969955 19:46559645-46559667 CTCTGGAGCTGGTGGTCTGGGGG - Intronic
1167101897 19:47408825-47408847 CTGGGTGGATGGTGGGCAGGTGG + Intronic
1167599109 19:50443688-50443710 CTGTGGGGCAGGGGGACAGGAGG - Intronic
1167698092 19:51026541-51026563 CTCTGGGGCTGGGGCTCTGGGGG + Intronic
1168073382 19:53964834-53964856 CTGTGAGGCTGGGGTGCAGGAGG - Intronic
925167590 2:1727682-1727704 CAGGGGGTCTGGTGGGCAGGGGG - Intronic
925919686 2:8630537-8630559 CTGAGGGGCGGGGGGGCAGGGGG + Intergenic
925922142 2:8645309-8645331 CGGAGGGGCTGGGGGTCAGAGGG - Intergenic
926151558 2:10428424-10428446 ATGTGGGGCTGGTGGGGACGGGG - Intergenic
926311435 2:11678691-11678713 TTCTGGGGCTGGTGTCCAGGCGG + Intronic
926683090 2:15678661-15678683 CTGGGGGGCTGGGGGGCTGGAGG + Intergenic
927035315 2:19169003-19169025 ATATGGGGCTGGAAGTCAGGAGG + Intergenic
927208881 2:20626744-20626766 TTGTGGTGCTGGAGGTGAGGTGG + Intronic
927672346 2:25079266-25079288 CTGGGTGGCAGGTGTTCAGGAGG + Intronic
928209423 2:29312531-29312553 CTGTTGGGCTGTGGGGCAGGAGG + Intronic
929052450 2:37849646-37849668 GTGTGGGGATGGGGGTGAGGTGG - Intergenic
929917343 2:46147021-46147043 GTGAGGGACTGATGGTCAGGAGG + Intronic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
932414728 2:71566678-71566700 CCCTGGGGCTGGTGGTTTGGAGG + Intronic
932424521 2:71620650-71620672 TTGTGGGGCTGGGGGTAGGGGGG + Intronic
932449845 2:71802423-71802445 ATGTGGGGCAAGTGGACAGGAGG - Intergenic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
932909852 2:75794050-75794072 CAGTAGGGGTGATGGTCAGGGGG + Intergenic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
934048654 2:88191709-88191731 GAGTGGGGCTGGGGGTGAGGTGG - Intergenic
934723928 2:96602753-96602775 CTGTGGGGCTGGTCCTGGGGAGG + Exonic
934730291 2:96652203-96652225 CTGAGGAGCTGGTGGGCTGGTGG + Intergenic
934884703 2:98014421-98014443 CTGGTGGGCTGGTGGACTGGTGG - Intergenic
934884748 2:98014565-98014587 CTGGTGGGCTGGTGGGCCGGTGG - Intergenic
934884798 2:98014718-98014740 CTGCTGGGCTGGTGGGCTGGTGG - Intergenic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
935278978 2:101501621-101501643 CAGTCAGGCTTGTGGTCAGGTGG + Intergenic
935304789 2:101727006-101727028 GAGTGGGACTGGTGGTCAAGAGG - Intronic
937339607 2:121082671-121082693 CTGGGGGGATGGTAGTCTGGAGG + Intergenic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938379688 2:130829548-130829570 GTGTGGGGCTGGGGGCCCGGTGG - Intergenic
938473930 2:131590531-131590553 CTGTGGGGCTTCTGGCCTGGGGG - Intergenic
938739196 2:134214894-134214916 CTGTGTATCTGGTGGTTAGGTGG - Intronic
939884252 2:147664166-147664188 CTTTGTGGATGTTGGTCAGGTGG - Intergenic
940030976 2:149260869-149260891 GTGTGGGGCGGGGGGTGAGGGGG + Intergenic
941318177 2:164020670-164020692 CTGGTGGGCTGGTGGGCTGGTGG + Intergenic
943027476 2:182647132-182647154 CTGAGGGGCTGGTCCTCAGCTGG - Intergenic
943532704 2:189104714-189104736 CTGTGGGGGTGGGGGTAAAGTGG - Intronic
944614656 2:201448220-201448242 CTGTGGGGCTGGTACACAGTAGG + Intronic
944931666 2:204526487-204526509 CTGTGAGGTTGGAGGTAAGGTGG - Intergenic
945030609 2:205660063-205660085 CTGTGGGGCTGGGCAGCAGGTGG + Intergenic
945043685 2:205763742-205763764 CTTCGGGGCAGGTGGACAGGGGG - Exonic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948459449 2:238122104-238122126 CCCTGAGGCTGGTGGTCATGTGG - Intronic
948639624 2:239367075-239367097 CTGTGTGGCTGGGGGCCTGGGGG - Intronic
948747657 2:240107926-240107948 CCCTGGGCCTGGTGGGCAGGAGG + Intergenic
948813566 2:240498473-240498495 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948813578 2:240498508-240498530 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
949040963 2:241849839-241849861 CTGTGGGGGCAGTGGGCAGGAGG - Intergenic
1169254186 20:4084829-4084851 CTCTGGGTCTGATGGTCAGGAGG + Intergenic
1170154643 20:13258281-13258303 CTGTGGGGTTGGAAGTAAGGTGG - Intronic
1170169354 20:13393677-13393699 CGCTGGGGCTGGTGGTCCAGGGG - Intronic
1170864052 20:20137514-20137536 CTGTGGTGGTGGTGGACATGGGG - Intronic
1171293470 20:23995769-23995791 CTTTGAGCCAGGTGGTCAGGAGG + Intergenic
1171385082 20:24764438-24764460 CTGTGGGCTTGGAGGTCAGGCGG + Intergenic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1172773521 20:37394802-37394824 CTGTGGGCCTGGGGCTCAGCGGG + Intronic
1173126936 20:40345830-40345852 CTGTGGTGCTGGTGGCCATGAGG + Intergenic
1173552579 20:43943139-43943161 CTGTGGAGCTGGTGCTCTCGGGG + Intronic
1173570494 20:44072582-44072604 GTGTCGGGGTGGTGGTTAGGAGG + Intergenic
1173684119 20:44910586-44910608 GGGTGGGGGTGGGGGTCAGGCGG + Intronic
1173736924 20:45368548-45368570 CTGTAGGGCTGAGAGTCAGGAGG - Exonic
1174054486 20:47788509-47788531 CTGTGGGCCTGGCGGACACGTGG + Intergenic
1174150552 20:48483309-48483331 CAGTGGGGCTGGTGGGTGGGAGG - Intergenic
1174513912 20:51076647-51076669 CTCTGGGGGTGGTGGACTGGAGG + Intergenic
1175062664 20:56257909-56257931 CCTTGGGGCTGGTGTTGAGGTGG - Intergenic
1175257733 20:57657186-57657208 CTGTGCGGCCCGTGGTCATGGGG - Intronic
1175825590 20:61934803-61934825 AGGTTGGGCAGGTGGTCAGGCGG - Intronic
1175888794 20:62306977-62306999 CGGTGGGGCTGGAGGACTGGAGG + Intronic
1175940551 20:62535718-62535740 TTGAGGGGGTGGGGGTCAGGGGG + Intergenic
1176139366 20:63538293-63538315 CTCAGGGGCTGGGGGGCAGGCGG - Intergenic
1179204039 21:39256543-39256565 CTGAGGGGCTGCTGTTAAGGTGG + Intronic
1179232297 21:39515768-39515790 GTGTGGGGATGATGGTAAGGAGG + Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179482351 21:41686133-41686155 GTGTGGGGCAGGTGGGCAGTGGG + Intergenic
1179787366 21:43737502-43737524 CTGCGGAGCTGGAGGTCAGCGGG + Intronic
1180174332 21:46080374-46080396 CTGGGAGGCTGGTGGCCACGAGG - Intergenic
1180474229 22:15688479-15688501 CTGTGGGGCTTCTGGCCTGGGGG - Intergenic
1180646154 22:17340795-17340817 CTGAGAGGCTGGGAGTCAGGAGG + Intergenic
1180824526 22:18853485-18853507 CTTTGAGCCAGGTGGTCAGGAGG + Intronic
1180825076 22:18856171-18856193 CCGTGGTGCTGGGGGTCTGGTGG + Intronic
1181210987 22:21289430-21289452 CTTTGAGCCAGGTGGTCAGGAGG + Intergenic
1181361104 22:22336751-22336773 CGGGGGGGCTGGGGGTCAAGGGG + Intergenic
1181398513 22:22637458-22637480 CTTTGAGCCAGGTGGTCAGGAGG - Intergenic
1181427936 22:22856162-22856184 CTGTGGGGCCTGTGGTCCTGGGG + Intronic
1181501250 22:23316816-23316838 CTTTGAGCCAGGTGGTCAGGAGG - Exonic
1181567887 22:23750923-23750945 CGGAGGGACAGGTGGTCAGGCGG + Exonic
1181650902 22:24258602-24258624 CTTTGAGCCAGGTGGTCAGGAGG + Intergenic
1181706479 22:24652137-24652159 CTTTGAGCCAGGTGGTCAGGAGG - Intergenic
1181716930 22:24737825-24737847 CTGTGGTGGTGGTGGCCATGGGG + Intronic
1182434914 22:30324446-30324468 CTGTAGGGCTGGGGCTGAGGTGG - Intronic
1182552175 22:31106445-31106467 CTGTGGGGCTGGGCCGCAGGTGG - Intronic
1183253109 22:36744132-36744154 CTGGCCGGCTGCTGGTCAGGAGG - Intergenic
1183320909 22:37164483-37164505 TGGTGGGGGTGGTGGGCAGGGGG + Intronic
1183416807 22:37687260-37687282 CTGTGGGGCGGGTGGGGGGGGGG - Intronic
1184015294 22:41781490-41781512 GTGTGTGGCTGGTGGTCATAAGG + Intronic
1184308824 22:43628084-43628106 ATGTGAGGCTGTGGGTCAGGGGG - Intronic
1184595247 22:45509877-45509899 CTGTGGGGCAGGTGGGGTGGGGG + Intronic
1184648009 22:45906571-45906593 CTGATGGGCTGGTGGGCTGGTGG + Intergenic
1184668673 22:46001673-46001695 CTCTGGGGCTGGTGGCCAAACGG - Intergenic
1184781716 22:46652928-46652950 ATGTGTCGCTGGTGGGCAGGAGG + Intronic
1184920849 22:47604763-47604785 CTGTGAGGATGATGGACAGGAGG + Intergenic
1185228209 22:49665178-49665200 CAGCGGGGCTGGGGGTCAGCAGG - Intergenic
1203215959 22_KI270731v1_random:6000-6022 CTTTGAGCCAGGTGGTCAGGAGG - Intergenic
1203274664 22_KI270734v1_random:79390-79412 CTTTGAGCCAGGTGGTCAGGAGG + Intergenic
949290460 3:2459616-2459638 TTGTGATGCTGGTGGCCAGGTGG + Intronic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
952764233 3:36941348-36941370 CTGTGAGCCTGGTGGGCTGGTGG - Intronic
952964900 3:38614990-38615012 CTGTGGTCCTCGTGGTCATGTGG - Intronic
953532751 3:43752900-43752922 CTGACTGGCTGGTGGACAGGTGG - Intergenic
953941569 3:47103569-47103591 CTTTGAAGCTGGTAGTCAGGAGG - Intronic
954239861 3:49285078-49285100 TTTTGGGGCTGGGGGTCAGAAGG - Intronic
954299090 3:49689745-49689767 CTGTGGAGCTTGGGGCCAGGCGG + Intronic
954412045 3:50375022-50375044 CTTTGGGGCTGGTTGCCCGGTGG - Intronic
954656229 3:52195914-52195936 CTGTGGGGGTGGCGGTTGGGGGG - Intergenic
954686328 3:52372174-52372196 CGGTGGGCCTGGTGCACAGGAGG - Intronic
954689224 3:52386990-52387012 GTGTGGTGCTGGTGGTGTGGAGG - Intronic
956857256 3:73287308-73287330 TTGTGGGGCTGGAGGAGAGGAGG + Intergenic
958834366 3:99127032-99127054 CTGTTATGCTGGTTGTCAGGTGG + Intergenic
960210965 3:114965421-114965443 CTGGGGAGCTGCTGGTCAAGGGG - Intronic
960373878 3:116874640-116874662 ATGAGGGGCTGGAGGGCAGGAGG + Intronic
960997656 3:123350529-123350551 CTCTGGGGCTGAGGGCCAGGAGG + Intronic
961260143 3:125595514-125595536 CTGTGGGGCTGTGGGTGGGGCGG - Intergenic
961462739 3:127062987-127063009 GTGTGGGGGTGGTGGTGGGGGGG + Intergenic
961648651 3:128406236-128406258 CTGTGGGGCTTGTATTCATGAGG - Intronic
962828352 3:139119143-139119165 CTGTGGCCATGGAGGTCAGGTGG + Intronic
963094564 3:141522463-141522485 GCGTGGGGCTGGTGCTCGGGAGG + Intronic
965349920 3:167599351-167599373 CAGTGGTGGTGGTGGTCATGAGG - Intronic
966400981 3:179546701-179546723 CTGTGGTGGTGGTGGACATGGGG + Intergenic
967613758 3:191540040-191540062 ATGTGGGCCTGGGGGTCGGGGGG - Intergenic
968047262 3:195631348-195631370 GGGTGAGGCTGGTGGCCAGGGGG - Intergenic
968156876 3:196388297-196388319 CTGGGGGGCTGGGGGGCTGGGGG + Intronic
968307351 3:197658576-197658598 GGGTGAGGCTGGTGGCCAGGGGG + Intergenic
968515273 4:1013029-1013051 CTGGGGGACTGGGGGTCTGGGGG - Intronic
968556493 4:1248603-1248625 CGGTGGAGCTGGGGGTCCGGCGG + Intronic
968648002 4:1749451-1749473 GTGAGGGGCTGGTGGGGAGGGGG - Intergenic
968876487 4:3270406-3270428 CTGTGGGGCAGGTGGACCTGGGG - Intronic
968937855 4:3622548-3622570 ATGTGGGGCTGGGGGGCTGGTGG - Intergenic
969344684 4:6563479-6563501 CTGCGGGGCTGGGGGTGAGGCGG + Intronic
969414038 4:7047286-7047308 CTCTGCAGGTGGTGGTCAGGAGG + Intronic
969533525 4:7742036-7742058 CTTTGGGTCTGGGGGACAGGTGG - Exonic
969682241 4:8649781-8649803 CTGTGGGGCAGGCGGGCAGCGGG - Intergenic
969701241 4:8768915-8768937 CTGTGGTGCTGGTGGCCTGCAGG - Intergenic
970184183 4:13431570-13431592 CTGTGGGCCTGATGGTGTGGAGG - Intronic
970413367 4:15832994-15833016 CTGTGGTGGTGGTGGCCATGAGG - Intronic
970617717 4:17782870-17782892 CTCTGAGGATGGGGGTCAGGGGG + Intergenic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
972296623 4:37745479-37745501 CAGTGGGGCTGGTGGGCAACTGG - Intergenic
975839084 4:78455158-78455180 GTGTGGGGTTGGTGATGAGGAGG - Intronic
975992159 4:80268251-80268273 CTGTGGGGCTTTTGCTCAGTAGG + Intronic
976316305 4:83662648-83662670 CTGTGGGACTAGTGGTATGGGGG + Intergenic
976628083 4:87208094-87208116 CTCTGGGGCTGGTGGTCTGGTGG - Intronic
980156760 4:129117384-129117406 CTATGGGGCTGGGGGACAGTGGG - Intergenic
980861221 4:138501645-138501667 GTGTGTGTCTGGGGGTCAGGTGG - Intergenic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
981767892 4:148273063-148273085 CTTTGTGGTGGGTGGTCAGGTGG - Intronic
982086501 4:151841581-151841603 CTGTGGGGATGCTGCACAGGAGG - Intergenic
982560410 4:156922729-156922751 CTGTTGGGTTGGGGGTCGGGGGG + Intronic
982670417 4:158313945-158313967 CAGAAGGGCTGGTGGGCAGGTGG + Intergenic
983017285 4:162628729-162628751 CTGGGGTGGTGGTGGTCAGAGGG + Intergenic
983222885 4:165059511-165059533 TGGTGGCCCTGGTGGTCAGGGGG - Intergenic
983743445 4:171164830-171164852 TTGTGGGGGTGGTGGGCAAGCGG + Intergenic
985574162 5:665878-665900 CTGGGGGAGGGGTGGTCAGGAGG - Intronic
985627400 5:996497-996519 CTGTGTGGCTGGTGGGCATGTGG + Intergenic
985640792 5:1062673-1062695 CTGGGGGGCTGGGGGGCTGGGGG + Intronic
985994847 5:3592244-3592266 CTGTGGGGGTGGGGGTTGGGCGG - Intergenic
986250116 5:6047764-6047786 CTGTGGGGCTTGTGGCAGGGAGG - Intergenic
986715394 5:10520097-10520119 CCATGGGGCTGCTGGGCAGGAGG - Intronic
990578935 5:57150154-57150176 CTGTGGTGGTGGTGGCCATGGGG - Intergenic
990708740 5:58559610-58559632 CTGTAGGGCTGGATATCAGGAGG - Intergenic
992069468 5:73136034-73136056 CTGTGGGGGTGGTGGGCCTGAGG + Intergenic
992942779 5:81779279-81779301 CTGCGGAGCTGCAGGTCAGGAGG - Intergenic
993654652 5:90562565-90562587 CTGCTGGGCAGGTGGTCATGGGG + Intronic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995675077 5:114654328-114654350 CAGTTGGGCTGTTGGTAAGGAGG - Intergenic
995770659 5:115665596-115665618 TTGTGGTGGTGGTGGTCATGGGG + Intergenic
997054534 5:130425521-130425543 CTGTGGGGCTTCTGGTCTAGGGG + Intergenic
997590826 5:135071186-135071208 AGCTGGGCCTGGTGGTCAGGTGG - Intronic
997819950 5:137056259-137056281 ATGTGGGGGTGGGGGACAGGGGG + Intronic
998163285 5:139825679-139825701 GTGTGGGGGTGGTGGTGAGTGGG + Intronic
999484918 5:151985637-151985659 GTGTGGGGCAGGGGGTGAGGGGG - Intergenic
999632584 5:153585933-153585955 CTGATGGGGTGGTGGTGAGGAGG + Intronic
1000300272 5:159950468-159950490 CACTGGGGCTGGTGGTCCAGGGG + Intronic
1000569947 5:162899351-162899373 CTGTGGGGTTAGTGGTAATGGGG - Intergenic
1000679985 5:164171622-164171644 CTGGGGGGCTGGAGGTGGGGTGG - Intergenic
1001098848 5:168797298-168797320 CTCTGGGGCTGCCAGTCAGGTGG + Intronic
1001481803 5:172093783-172093805 CTGGGGGACTGGTGGTTTGGAGG + Exonic
1001797475 5:174514310-174514332 CGCTGGGGCTGGTGGTCAGGGGG - Intergenic
1001949370 5:175805620-175805642 GGGTGGGTCTAGTGGTCAGGGGG + Intronic
1002185539 5:177453198-177453220 CTCTGGGGCTGGAGGTGATGGGG - Intronic
1002221988 5:177690368-177690390 ATCTGGGGCTGGTGGTTTGGTGG + Intergenic
1002372740 5:178767984-178768006 CTGTAGGGCTGTGAGTCAGGGGG + Intergenic
1002780283 6:359834-359856 CCATGGGGCTGGTGGAGAGGAGG - Intergenic
1003052904 6:2796185-2796207 GCGTGGGGCTGGTGGTCCTGCGG - Intergenic
1003362668 6:5443667-5443689 CTGCGGGGCTGGGGCTCAGCTGG - Intronic
1003404522 6:5817396-5817418 TGGTGGAGCTGGTGGTCTGGAGG + Intergenic
1004228644 6:13811787-13811809 ATGTGGGGGTGGGGGTGAGGAGG - Intronic
1004620509 6:17326703-17326725 CTGAGGGCCTGGAGGCCAGGAGG + Intergenic
1005593044 6:27348486-27348508 CAGTGGTGGTGGTGGTCAGCTGG - Intergenic
1006430877 6:33995043-33995065 CTCTGGGGCTGCAGGTCGGGGGG - Intergenic
1006848135 6:37077621-37077643 CTGTGTGGCTGCAGGTCAGGAGG - Intergenic
1007219402 6:40266611-40266633 GTCTGGTGCTGTTGGTCAGGAGG - Intergenic
1007257209 6:40537673-40537695 CAGTGGAGCTTGTGGTCTGGTGG - Intronic
1007412888 6:41674973-41674995 TTGTGGGGTTGGGGGACAGGAGG + Intergenic
1008427905 6:51380678-51380700 GTGTGGGACTGGTGGACAGAAGG + Intergenic
1008591094 6:52994808-52994830 CTGTAGGGGTGGTGGACACGCGG - Intronic
1008878375 6:56354186-56354208 CTGTGGGGCTAAAAGTCAGGTGG + Intronic
1009373480 6:62938348-62938370 CTGTGGTGGTGGTGGCCATGAGG - Intergenic
1010659939 6:78557625-78557647 GTGTGGGGCAGGTGGGAAGGGGG - Intergenic
1011054677 6:83193064-83193086 CGGAGGGGCTAGTGGTCTGGCGG - Intronic
1011071846 6:83393412-83393434 CGCTGGGGCTGGTGGTCTGGGGG - Intronic
1011377796 6:86708399-86708421 ATGAGAGGCTGGTGGTGAGGAGG - Intergenic
1012096593 6:94970236-94970258 TTCTGGGGGTGGAGGTCAGGAGG + Intergenic
1013081893 6:106820546-106820568 GTGTGGGGTTTGTGGTCAGCAGG - Intergenic
1013633018 6:112003185-112003207 CTGTGGGGCAGGTGGTAAGCTGG + Intergenic
1013954993 6:115831490-115831512 CTGCAGGGCTGATGGTCAGATGG - Intergenic
1014852802 6:126362087-126362109 GGGAGGGGCTGGTGGGCAGGAGG + Intergenic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015497062 6:133893180-133893202 CTGTGGGGTTGGTGGAAGGGCGG - Exonic
1015601110 6:134911630-134911652 CTGTCTGGGTGGTGGTCAGAGGG - Intergenic
1015665032 6:135619140-135619162 CGCTGGGGCTGGTGGTCCGGGGG + Intergenic
1016631093 6:146232659-146232681 TTGGGGGGCTGGAGGGCAGGTGG - Intronic
1017024816 6:150172460-150172482 CTGTGGTGCAGGTGGGGAGGCGG + Intronic
1017715808 6:157212224-157212246 GCGTGGGGCTTGGGGTCAGGAGG - Intergenic
1018061613 6:160094055-160094077 AGGTAGGGCTGGTGGACAGGAGG - Intronic
1018167959 6:161117049-161117071 CTGGAGGGCTGGTGGCCACGAGG + Exonic
1018765768 6:166931861-166931883 CAGTGGAGCAGGTGCTCAGGAGG - Intronic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018840760 6:167514478-167514500 CTGGGGGACTGGGGGTCTGGGGG + Intergenic
1018862249 6:167719647-167719669 CTGTTGGGGTGGTGGGCAAGAGG + Intergenic
1018923898 6:168193762-168193784 ATATGGGCCTGGTGGGCAGGAGG + Intergenic
1019140114 6:169937644-169937666 ATGTGGGGCCGGCGGGCAGGTGG - Intergenic
1019164340 6:170088241-170088263 CTGTGGGGCTGGGAGTGAGCGGG + Intergenic
1019191692 6:170254871-170254893 CTGTGGGCCTGGTGGGCACCAGG + Intergenic
1019254680 7:41705-41727 CTGTGAGGCTAGAGGTAAGGTGG - Intergenic
1019314637 7:378914-378936 CTGCGGGGCTGTTGGGCGGGAGG - Intergenic
1019351607 7:556641-556663 CTGTGGCGCGGCTGGACAGGAGG + Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019637885 7:2086108-2086130 CCTTGGGGCTGCTGGCCAGGAGG - Intronic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019777608 7:2921935-2921957 CTGTGGCACTGCTGGCCAGGGGG - Intronic
1020014164 7:4821247-4821269 CTGTGGGGTGGGCTGTCAGGCGG - Intronic
1020212070 7:6165069-6165091 CTCTGGGGCTGGTGGGAAAGGGG - Intronic
1020551809 7:9615989-9616011 CGTTGGGGTTGGTGGTCTGGGGG - Intergenic
1023265847 7:38404414-38404436 CTGTGGGGCTGGGAGTGTGGAGG - Intronic
1023515504 7:40997394-40997416 CTGTGGTGCTGGTTGCCATGTGG - Intergenic
1023965313 7:44960964-44960986 CTGAGGGGCTGGGGCTGAGGGGG + Intergenic
1024982255 7:55167217-55167239 CGGTGGTGATGGTGGTGAGGAGG + Intronic
1026734708 7:72942273-72942295 CTGTGGTGCTGGTGGTCGTGGGG - Exonic
1026785042 7:73297185-73297207 CTGTGGTGCTGGTGGTCGTGGGG - Intergenic
1027109037 7:75422745-75422767 CTGTGGTGCTGGTGGTCGTGGGG + Exonic
1027569010 7:79838882-79838904 CTGTGGGGCAGCTGGTAAGGAGG - Intergenic
1028002987 7:85524699-85524721 CTGTGGGGCTGGGGGAGTGGAGG + Intergenic
1028054477 7:86225569-86225591 ATGGGGGGCAGGAGGTCAGGGGG + Intergenic
1028234792 7:88347604-88347626 CTGAGGGTCTGGTGGTAAGTTGG + Intergenic
1029115285 7:98233474-98233496 CTGTGGGCCTGGGTGTCGGGAGG - Exonic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1029452244 7:100647570-100647592 AGGTGGGGGTGGGGGTCAGGTGG - Intronic
1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG + Intronic
1030431550 7:109455314-109455336 CTGTGGTGATGGTGGCCATGGGG - Intergenic
1031869365 7:127075504-127075526 ATGTGGGGCAGGGGGTCGGGGGG + Intronic
1032743675 7:134764838-134764860 ATGTGGGGCTGGTGCCAAGGAGG + Intronic
1032841130 7:135714404-135714426 CCAAGGGGCTGCTGGTCAGGTGG + Intronic
1033169940 7:139075063-139075085 CAGTGGGGCTGGTGGGGGGGTGG + Intronic
1033529181 7:142245773-142245795 CCCTGGGGCAGGTGGGCAGGAGG + Intergenic
1033867746 7:145713388-145713410 CTGTGGTGGTGGTGGCCATGAGG - Intergenic
1034064640 7:148124497-148124519 CAGTAGGGCAGGTGCTCAGGAGG - Intronic
1034255290 7:149721453-149721475 CGGTGGGCGTGGTGGCCAGGTGG - Exonic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034285646 7:149881583-149881605 CGGTGGGGCGGATGGTCAGGAGG + Intergenic
1034569534 7:151944279-151944301 CTGTGGGGCTGGGGAGGAGGGGG - Intergenic
1035906185 8:3512516-3512538 CTGGTGGGCTGGTGGGCTGGTGG + Intronic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1037801788 8:22040023-22040045 CTGGGGGGGTGGGGTTCAGGAGG - Intergenic
1037989665 8:23311859-23311881 CTGTCGGGTAGGTGGTCAGGAGG + Intronic
1040628203 8:49175992-49176014 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1042205684 8:66327592-66327614 TTGTCCGGCTTGTGGTCAGGTGG - Intergenic
1042485125 8:69339334-69339356 CTGAGGGGCTGCTGAGCAGGTGG - Intergenic
1044852946 8:96446788-96446810 CTGAGTCACTGGTGGTCAGGAGG - Intergenic
1047861663 8:128973565-128973587 CTGTGGGCCTGGTGGTAGGCTGG - Intergenic
1048031807 8:130640206-130640228 AGGTGGGGCTGGTGGGCAGGAGG + Intergenic
1048475537 8:134739211-134739233 CTTTTGGGCTGGTGGCAAGGTGG - Intergenic
1048999790 8:139817537-139817559 CTGTGGGGCAGGAGACCAGGAGG - Intronic
1049300425 8:141866753-141866775 CTGTGGGGCAGGTGAGCAGCAGG + Intergenic
1049369543 8:142257312-142257334 CTGCAGGGCCGGTGCTCAGGAGG + Intronic
1049598788 8:143497694-143497716 CTGTGGGGCTGCTGGCCGGCAGG - Intronic
1049687770 8:143945821-143945843 GTGTGGGGCTGGAGAGCAGGAGG - Intronic
1049744751 8:144258515-144258537 CTCTCAGGCTGGTGGCCAGGTGG + Intronic
1050424618 9:5500746-5500768 TTGTGGGCCTTGTGGTCAAGTGG - Intergenic
1051306771 9:15718213-15718235 CTGTGGCAGTGGTGGCCAGGGGG + Intronic
1051726185 9:20089692-20089714 CTGTGGCAGTGGTGGGCAGGGGG - Intergenic
1051966602 9:22836038-22836060 CTGTGGTGGTAGTGGCCAGGGGG - Intergenic
1052036171 9:23683629-23683651 CTGTGGGGGAGGGGGTTAGGTGG - Intergenic
1052342917 9:27380766-27380788 ATGAGGGGGTGGTGGGCAGGTGG - Intronic
1052677346 9:31644408-31644430 CTGTCGGGGTGGGGGTCTGGGGG - Intergenic
1052985718 9:34485921-34485943 CAGTGGGGCTGGGGGTGGGGAGG - Intronic
1055338123 9:75253617-75253639 GTGGGGGGCTGGTGGGGAGGTGG - Intergenic
1055785326 9:79864419-79864441 GTGTGGGGCTAGGTGTCAGGGGG - Intergenic
1056714681 9:89019364-89019386 CTGTGTGGCCTGTGGTCAGAAGG + Intronic
1056714743 9:89020167-89020189 CTGTGTGGCCTGTGGTCAGCAGG + Intronic
1056730990 9:89166569-89166591 CTGCGGGGAGGGAGGTCAGGCGG + Intronic
1057112917 9:92491314-92491336 TTGTGGGGCTGGGGGTCCTGAGG + Intronic
1057429302 9:94979740-94979762 CCGTGGGGCAGGTGGTGGGGGGG + Intronic
1057824526 9:98361730-98361752 CTATGTGGAAGGTGGTCAGGTGG + Intronic
1058106416 9:100976686-100976708 TTCTGGGGCTGGTGGCCTGGAGG - Intergenic
1060036849 9:120263148-120263170 CACTGGGGCTGGTGTTCAGATGG - Intergenic
1060237893 9:121878901-121878923 CTGTGGGGCTGGTGGTGCAGGGG + Intronic
1060385955 9:123228457-123228479 GTGTGGGGTTGGGGGACAGGGGG + Intronic
1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG + Exonic
1061542462 9:131284976-131284998 CTGTGGGACACGTGGCCAGGAGG + Intergenic
1061592229 9:131605064-131605086 CTCTGAGACTGGTGGGCAGGTGG + Intronic
1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG + Intergenic
1061941815 9:133887865-133887887 CTTCAGGGCTGGTGGTGAGGAGG - Intronic
1062421275 9:136483774-136483796 CTGGGAGGCTGGAGGGCAGGCGG + Exonic
1186927468 X:14350905-14350927 CGGAGGGGCTGGTGGGAAGGTGG + Intergenic
1187228137 X:17394010-17394032 CTGTGGGGCTGAGGGTGCGGTGG - Intronic
1187263103 X:17705243-17705265 AGGTGGGGCTGTTGGACAGGAGG + Intronic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1187636867 X:21238667-21238689 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1188265290 X:28066010-28066032 CTGTGGGGCGTGTGGTCAGCAGG - Intergenic
1190139573 X:47830822-47830844 ATGGGGGGCTGGTGGGGAGGTGG + Intergenic
1190808289 X:53860625-53860647 CTGGGGTGATGGTGGTCATGGGG - Intergenic
1191908544 X:66122400-66122422 CTCTGGGGGTGGGGGTGAGGGGG + Intergenic
1192676257 X:73199706-73199728 CTGTGGTGGTGGTGGCCATGGGG + Intergenic
1192737160 X:73860769-73860791 CTCTGGGTCTGGTGGTGTGGCGG + Intergenic
1193052356 X:77115036-77115058 CTGTGGTGGTGGTGGACATGGGG - Intergenic
1193194805 X:78619455-78619477 CTGTGGTGGTGGTGGCCATGAGG - Intergenic
1193444095 X:81577978-81578000 CTGTGAGACAAGTGGTCAGGTGG - Intergenic
1193868983 X:86773766-86773788 ATGTGGTGGTGGTGGTGAGGTGG - Intronic
1193905815 X:87243213-87243235 CTGTGGTGGTGGTGGACATGCGG - Intergenic
1193920985 X:87425558-87425580 CCCTGGGGCTGGTGGTCCAGGGG + Intergenic
1194057620 X:89156093-89156115 ATGTGGGGGTGGTGGTTGGGAGG + Intergenic
1195716684 X:107825578-107825600 TTGTGGGGTTGGGGGACAGGGGG + Intergenic
1195997278 X:110743872-110743894 TTGTGGGGATGGTGGTGAGGCGG + Intronic
1196047760 X:111274193-111274215 TTGTGGGGATAGTGGTAAGGAGG + Intergenic
1196495405 X:116318421-116318443 CTGTGGGAGTGGTGGCCATGGGG + Intergenic
1197146493 X:123178138-123178160 GTGTGGGGGTGGTGGTGATGGGG - Intergenic
1198427061 X:136530920-136530942 CTGTGGTGGTGGTGGTCCTGGGG + Intergenic
1199272224 X:145898065-145898087 CTGTGGGGCTGGGAGTGTGGAGG + Intergenic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic