ID: 934952362

View in Genome Browser
Species Human (GRCh38)
Location 2:98585616-98585638
Sequence GCCAGCTCGTCCGCACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934952354_934952362 6 Left 934952354 2:98585587-98585609 CCTCTGCATGCCTCGCCCCGGGC 0: 1
1: 0
2: 0
3: 18
4: 266
Right 934952362 2:98585616-98585638 GCCAGCTCGTCCGCACAGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 104
934952357_934952362 -10 Left 934952357 2:98585603-98585625 CCCGGGCCCTCTTGCCAGCTCGT 0: 1
1: 0
2: 0
3: 12
4: 185
Right 934952362 2:98585616-98585638 GCCAGCTCGTCCGCACAGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 104
934952356_934952362 -9 Left 934952356 2:98585602-98585624 CCCCGGGCCCTCTTGCCAGCTCG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 934952362 2:98585616-98585638 GCCAGCTCGTCCGCACAGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 104
934952351_934952362 9 Left 934952351 2:98585584-98585606 CCACCTCTGCATGCCTCGCCCCG 0: 1
1: 0
2: 2
3: 27
4: 268
Right 934952362 2:98585616-98585638 GCCAGCTCGTCCGCACAGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 104
934952350_934952362 14 Left 934952350 2:98585579-98585601 CCTCGCCACCTCTGCATGCCTCG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 934952362 2:98585616-98585638 GCCAGCTCGTCCGCACAGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 104
934952355_934952362 -4 Left 934952355 2:98585597-98585619 CCTCGCCCCGGGCCCTCTTGCCA 0: 1
1: 0
2: 0
3: 23
4: 261
Right 934952362 2:98585616-98585638 GCCAGCTCGTCCGCACAGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934952362 Original CRISPR GCCAGCTCGTCCGCACAGGC AGG Intronic
900087701 1:906262-906284 GCCAGCTCAACGGCACATGCTGG - Intergenic
900994253 1:6111921-6111943 CCCAGCTCTCACGCACAGGCAGG + Intronic
902520337 1:17012021-17012043 GCCTGCTCCTCCGCACACACCGG + Intergenic
903953421 1:27009710-27009732 GCCAGCTCCTGCTCCCAGGCTGG + Intronic
908293492 1:62690685-62690707 GCCAGCTCTTCCCCAGAGGTAGG - Intergenic
910259912 1:85284580-85284602 GGCAGCTCCTCTCCACAGGCAGG - Intergenic
910850315 1:91643627-91643649 GCCAGACCGTCCGTACTGGCTGG - Intergenic
913177103 1:116284972-116284994 GCCAGCTCATCAGCACTGCCAGG - Intergenic
917611000 1:176689054-176689076 GCCAGCTGGGCAGCACAGCCAGG + Intronic
918423744 1:184387619-184387641 CCCAGCCCCTCCGCCCAGGCCGG - Intronic
921625415 1:217373366-217373388 GGCAGCTCCTCTCCACAGGCAGG - Intergenic
1066080782 10:31928787-31928809 GCCGGCCCGTCCCCGCAGGCTGG + Exonic
1077076287 11:703670-703692 CCCAGCTCTGCCTCACAGGCAGG + Intronic
1081981763 11:47270850-47270872 GCAAGCTCATCAGCACAGACTGG - Intronic
1082816693 11:57514262-57514284 GCCAGCTCCTTGGCACCGGCTGG - Intronic
1083600222 11:63942737-63942759 GCCAGCTGGGCCAGACAGGCAGG - Intronic
1083855302 11:65390280-65390302 GCCTGCTGGTTCGCACAGGAGGG + Intronic
1096650461 12:53059712-53059734 GCCAGCTTCTCCTCGCAGGCTGG - Exonic
1101446422 12:104739909-104739931 GCAAGCTCATCAGCACAGGCTGG - Intronic
1102193004 12:111003022-111003044 GCCAGCTTGCCCACCCAGGCTGG - Intergenic
1111354413 13:87079952-87079974 GGCAGCTCCTACCCACAGGCAGG + Intergenic
1114494699 14:23124652-23124674 GCTTGCTCTTCCGCCCAGGCTGG + Intergenic
1118019349 14:61695408-61695430 GCCCGCTCGCCTGCCCAGGCCGG - Intergenic
1202859554 14_GL000225v1_random:72747-72769 GGCAGGGCGCCCGCACAGGCAGG - Intergenic
1202860728 14_GL000225v1_random:79579-79601 GGCAGGGCGTCCGCGCAGGCAGG - Intergenic
1202864308 14_GL000225v1_random:105094-105116 GGCAGGGCGCCCGCACAGGCAGG - Intergenic
1123909674 15:24954903-24954925 GCCTGCGCGGCCGCAGAGGCAGG + Intronic
1125429506 15:39581077-39581099 GCCAGCTCGGGCGCAGCGGCTGG - Exonic
1128388965 15:67170099-67170121 GCCAGCCCTCCCACACAGGCAGG - Intronic
1129006214 15:72375803-72375825 GTCAGCTCGGCCGCGCAGCCCGG - Exonic
1132698339 16:1211798-1211820 ACCAGCAGGTGCGCACAGGCGGG + Exonic
1132855685 16:2043641-2043663 ACCAGCTCGGCCACAGAGGCTGG + Exonic
1132948067 16:2543561-2543583 CCCACCTGGGCCGCACAGGCTGG - Intronic
1132966380 16:2657781-2657803 CCCACCTGGGCCGCACAGGCTGG + Intergenic
1136054753 16:27680133-27680155 GCCAGCCTGTGCCCACAGGCTGG - Intronic
1141972433 16:87492716-87492738 GCCCGCGCCTCCGCCCAGGCCGG + Intergenic
1142268235 16:89075222-89075244 GCCAGCCCCTCCTCCCAGGCAGG + Intergenic
1145897843 17:28470868-28470890 GCCAGCTTGTCCTCAGAAGCAGG - Intronic
1148063694 17:44853544-44853566 GCCAGATCATCCCCACAGCCAGG - Exonic
1148897549 17:50848248-50848270 GCCTGCAGGTCAGCACAGGCTGG - Intergenic
1152204702 17:78968296-78968318 CCCAGCACGTCCGCAGAGCCAGG - Intergenic
1154415746 18:14174386-14174408 GCCAGCTCCACAGCACGGGCAGG + Intergenic
1158626508 18:59076395-59076417 GCCTGCTGGTCTGTACAGGCTGG + Intergenic
1161495586 19:4584253-4584275 GCCAACGCGCCCGCCCAGGCCGG - Intergenic
1165390860 19:35538044-35538066 TCCAGCTCTTTCGCCCAGGCTGG - Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1167907385 19:52673177-52673199 TCCAGCTCTTTCGCACAGTCTGG - Intronic
1168475269 19:56670602-56670624 GCCACCTGCTCCACACAGGCCGG + Intronic
925185180 2:1842292-1842314 GGCAGCACCTCAGCACAGGCGGG + Intronic
925741599 2:7009782-7009804 GCCGGGTCCTCAGCACAGGCTGG - Intronic
930726423 2:54686305-54686327 GCTAGCTAGTCCACACAGACAGG - Intergenic
932073500 2:68643563-68643585 GCCAGCTGGGCTGCAGAGGCCGG - Intergenic
932365501 2:71150293-71150315 GCCAGCTTGTCCACATGGGCTGG + Intergenic
932780679 2:74556626-74556648 GACAGCACGTCTGCTCAGGCAGG + Exonic
934952362 2:98585616-98585638 GCCAGCTCGTCCGCACAGGCAGG + Intronic
936680087 2:114760096-114760118 TCCAGCTGGTCTCCACAGGCAGG + Intronic
939994543 2:148907727-148907749 GCCACCTCGGCCACAAAGGCTGG - Intronic
943700103 2:190980194-190980216 GCAAGCTGGTCCGCACTGTCTGG + Intronic
1172460106 20:35111283-35111305 GCCAGCTCATCCCCACACCCAGG - Intergenic
1173871192 20:46343300-46343322 TCCAGCTCGGCAGCACAGTCAGG + Intergenic
1174011226 20:47451089-47451111 TCTAGCTCTTCCGCCCAGGCAGG - Intergenic
1174172396 20:48625697-48625719 GCCAGCTCGTCATCACAGCGAGG + Exonic
1175083024 20:56437197-56437219 GCCAGCTCGTCAGAGCAGTCAGG - Exonic
1179129314 21:38620431-38620453 GCCAGCTCGTCTGCTTAGGAAGG + Intronic
1180693887 22:17739727-17739749 GGCACCACGTCCCCACAGGCAGG + Intronic
1183935909 22:41262131-41262153 GCCAGCTTTTAGGCACAGGCAGG - Intronic
1184613930 22:45625039-45625061 GCCAGCTCCACTGGACAGGCAGG + Intergenic
1184943061 22:47782825-47782847 GCCAGCAAGTCCTCACAGGTAGG + Intergenic
950020036 3:9780545-9780567 GCTGGCTGGTCCCCACAGGCTGG - Exonic
955743887 3:62120972-62120994 GCCAGCTCTGTCGCCCAGGCTGG + Intronic
962752435 3:138443782-138443804 GCCAGCTCCCTCGCACAGGGTGG - Intronic
969591664 4:8125839-8125861 GCCAGCTCGTCCTCCTGGGCAGG + Intronic
969700144 4:8763353-8763375 GCCAGCTGGGCCACTCAGGCTGG + Intergenic
972329062 4:38046916-38046938 GCCAGCTCCTTACCACAGGCAGG + Intronic
976922638 4:90457598-90457620 GGTAGCTCCTCCCCACAGGCAGG + Intronic
978013835 4:103719957-103719979 GCCAGCTGCCCGGCACAGGCTGG + Intergenic
981258429 4:142691013-142691035 GTCAGCTGGTCATCACAGGCTGG - Intronic
986254086 5:6087301-6087323 GCCTGCTGGTCAGCTCAGGCTGG - Intergenic
986569956 5:9154487-9154509 GCCAGTTCTACCGCACACGCAGG - Exonic
994082283 5:95720251-95720273 GCCAGCTGGGCTGCTCAGGCTGG - Intronic
995331983 5:110956550-110956572 GCCCCCACGTCCGCGCAGGCTGG + Intergenic
996702586 5:126465180-126465202 GCCAGCAAGTCCACACAGTCTGG + Intronic
1000340986 5:160277212-160277234 GACAGCACGACCGCATAGGCTGG + Intronic
1002202681 5:177539108-177539130 GGCAGCAAGTCTGCACAGGCTGG + Exonic
1002291656 5:178204695-178204717 GCCCGCTCGTCCCCACCCGCAGG - Exonic
1006446771 6:34084162-34084184 GCCAGCTGGACCTCAGAGGCGGG + Intronic
1007397751 6:41587201-41587223 GCCAGCTGTTGCGTACAGGCAGG - Intronic
1009243339 6:61204810-61204832 GGCAGCTCCTCTCCACAGGCAGG + Intergenic
1012530419 6:100229098-100229120 GTCAGCTGCTCCGCCCAGGCCGG + Intergenic
1014023588 6:116618541-116618563 GCCAGCTCTGTCGCCCAGGCTGG + Intronic
1015122016 6:129710227-129710249 GCCAGCTCCTCCCCGCAGGCTGG + Intergenic
1023364543 7:39450744-39450766 ACCAGCTCCTCCGCACTTGCTGG + Intronic
1030354289 7:108525876-108525898 GCCAGCTCCTCCCCAAAGCCTGG + Intronic
1032266499 7:130373725-130373747 GGCAGCCGGTCAGCACAGGCTGG + Intergenic
1037859861 8:22397546-22397568 GCCCGCTCTTTCGCCCAGGCCGG - Intronic
1048766410 8:137848903-137848925 TCCTGCTCTTTCGCACAGGCTGG - Intergenic
1048902374 8:139051093-139051115 GCCAGCCCCTCCACACAGGTGGG - Intergenic
1059226182 9:112675197-112675219 GCGAGCTCCTCCTGACAGGCAGG + Intergenic
1062097293 9:134709966-134709988 GGCAGCTCCTCCGCTCAGGTGGG - Intronic
1062231940 9:135486748-135486770 GGCAGCTCTTCAGCACTGGCGGG - Exonic
1202800322 9_KI270719v1_random:169886-169908 GCCTTCTCGTCAGCACAGACCGG - Intergenic
1186274853 X:7927779-7927801 GGCAGCTGGACCGCCCAGGCGGG - Intergenic
1187941400 X:24386285-24386307 GCCAGCTCTTCCACACTGCCAGG - Intergenic
1189465548 X:41275735-41275757 GGCAGCTCGTGCCCCCAGGCAGG + Intergenic
1190209482 X:48433371-48433393 GCAAGCTCCTCAGCCCAGGCTGG - Intergenic
1196456389 X:115894340-115894362 GCCAGCTCTGGCCCACAGGCGGG + Intergenic
1197342252 X:125287958-125287980 GGTAGCTCCTCTGCACAGGCAGG - Intergenic