ID: 934953492

View in Genome Browser
Species Human (GRCh38)
Location 2:98595713-98595735
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 2, 1: 0, 2: 0, 3: 17, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934953492_934953493 24 Left 934953492 2:98595713-98595735 CCATGAGAGGGTAGCTGCAGATT 0: 2
1: 0
2: 0
3: 17
4: 120
Right 934953493 2:98595760-98595782 TCATTATCTCTGTATTAAATAGG 0: 2
1: 0
2: 2
3: 31
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934953492 Original CRISPR AATCTGCAGCTACCCTCTCA TGG (reversed) Intergenic
900826966 1:4934733-4934755 AATCTGCAGTTCCACTCCCAAGG - Intergenic
901989276 1:13099583-13099605 AATCTGCAGCCAGCCAGTCAGGG - Intergenic
901992537 1:13127181-13127203 AATCTGCAGCCAGCCAGTCAGGG + Intergenic
905401773 1:37708835-37708857 CTTCTGGACCTACCCTCTCATGG - Exonic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
908313762 1:62912181-62912203 GATCTGCAGCCACACTCTCTGGG + Intergenic
908711323 1:67018844-67018866 AATCTGCTGATACCCTTGCAGGG - Intronic
909052224 1:70779948-70779970 ATTTTGCAGCATCCCTCTCAAGG + Intergenic
911401886 1:97385670-97385692 CCTCTCCAGCTCCCCTCTCAGGG + Intronic
913358288 1:117948400-117948422 AAGCTGCAGCTTCCCTGTCTGGG - Exonic
916744377 1:167673246-167673268 AATCTGCTGCTACTCTTTTAAGG - Intronic
919604515 1:199665282-199665304 AATCTGCAGGTGACCTCTCTGGG + Intergenic
920202906 1:204270998-204271020 AGTGTGCAGCTAACCACTCAGGG - Intronic
920839347 1:209540937-209540959 TCTCTGCAGCCACCATCTCAGGG + Intergenic
921353662 1:214263943-214263965 AGGCTGAAGCTACCCTCTGAGGG + Intergenic
1066581086 10:36883028-36883050 AGTCTCCAGATGCCCTCTCATGG + Intergenic
1069835819 10:71307454-71307476 ACTCTGCTGGTACCGTCTCAGGG - Intergenic
1074270539 10:111949402-111949424 AATCTGTAGCTGCCCTATAAGGG - Intergenic
1074406184 10:113181955-113181977 AGGCTGCAGCTATCCTCCCATGG - Intergenic
1074545176 10:114396707-114396729 ACTCTGCTGCTACCCACACATGG - Intronic
1080592243 11:33734579-33734601 AATCTGCAGCTTCCCCTACAAGG + Intronic
1084902720 11:72321756-72321778 AAGCTGCAGTTTGCCTCTCAAGG + Intronic
1086414452 11:86574909-86574931 AATTTGCAGATACCTTCACATGG - Intronic
1087201795 11:95352937-95352959 AATATGCAGCTACCTTCTCTGGG - Intergenic
1089510889 11:118996485-118996507 AATGTTCAGCTGCCCTCTCAAGG - Intergenic
1089684470 11:120138016-120138038 CATCTGCAGCTTCCATCGCAGGG + Exonic
1090764777 11:129866986-129867008 TATCTGGAGGTACCATCTCAAGG - Intronic
1092282046 12:7105083-7105105 AATCTGCAGGAGTCCTCTCAGGG + Intronic
1094454064 12:30613021-30613043 AATCTGCAGCTGCCTTCTCCAGG + Intergenic
1095412202 12:41936519-41936541 ACTCTGCATCTGCCCTCTCCTGG + Intergenic
1100135327 12:91546075-91546097 AATGTTCAGCTCCCCACTCATGG - Intergenic
1103489808 12:121308505-121308527 CATCAGGAGCTGCCCTCTCATGG - Exonic
1109525727 13:63572317-63572339 AATCAGCAGCTACTCTCTAGAGG + Intergenic
1110706486 13:78605575-78605597 AACCTGCCCCTCCCCTCTCAAGG + Intergenic
1113500777 13:110772299-110772321 AGTTTGCAGCTGCCCTCTCGGGG + Intergenic
1115187154 14:30701897-30701919 AATCTGCAGCTCCCCTCAGTTGG + Intronic
1117807777 14:59512479-59512501 AATCTGGAGCAACCTTCTCAGGG - Intronic
1119738587 14:76999551-76999573 GATGTGCAGCCACCCTCTCCTGG + Intergenic
1122867437 14:104613627-104613649 AATCCACAGCTTCCCTCACATGG - Intergenic
1123039972 14:105486487-105486509 AAGCTACAGCTCCCCTCTCTGGG + Intergenic
1124610878 15:31207527-31207549 CATCAGCAGCTAACCTCTCCTGG - Intergenic
1126257099 15:46640584-46640606 AATCTGCAGCTACCTGCCCTGGG - Intergenic
1127906301 15:63378961-63378983 CATCTTCTGCTACCCTCCCAGGG + Intronic
1129443565 15:75600197-75600219 AACCTGCAGCTACCTTCTCTAGG - Intronic
1131110011 15:89759032-89759054 CCTCTGCAGCAACCCTCTCAGGG + Intergenic
1132241267 15:100259145-100259167 AATATGCAGCTAAACTCCCAAGG - Intronic
1132338251 15:101062582-101062604 AATCTACATCTACACCCTCAAGG + Exonic
1134413224 16:14020791-14020813 TATCTGGAGCTTCCCTTTCAGGG + Intergenic
1134847111 16:17449347-17449369 AATCTTCTCCTACCCTCTCCAGG - Intronic
1141356310 16:83349925-83349947 AAGCTGCAGTTACCCACTCTGGG - Intronic
1141823588 16:86463989-86464011 AATCTGCCTCTGCCCTCTCTGGG - Intergenic
1146812046 17:35911578-35911600 AATCTGCAGCAACCCACCAAGGG - Intergenic
1147176572 17:38659498-38659520 AAGCTGCAGGTAGCCTCTGAGGG - Intergenic
1150327574 17:64269131-64269153 ATTCTGCACCTTGCCTCTCAGGG + Intergenic
1151020661 17:70613234-70613256 AATAAGCCGCTACCCACTCAGGG + Intergenic
1152879214 17:82805906-82805928 AATCTGCAGCTCCTCACTCAGGG + Exonic
1161643094 19:5436424-5436446 AATTAGCAGCTCCCCTCCCAAGG - Intergenic
1167213804 19:48150584-48150606 AGGCTGAAGTTACCCTCTCAGGG - Intronic
928958709 2:36899588-36899610 AATCTGCAGCTGCACTTTCAAGG + Exonic
929548836 2:42876107-42876129 TTTCTGCAGCTTCTCTCTCATGG + Intergenic
930966643 2:57336463-57336485 AATTTGCCGCATCCCTCTCAAGG - Intergenic
932758395 2:74424246-74424268 AATGTGCAGCTTCCTTCTCTAGG + Intronic
933175750 2:79170337-79170359 AATTGGCAGCTACCCTCTTTGGG - Intergenic
933219236 2:79669599-79669621 AGTCAGCAGCCACCCTCTCCAGG - Intronic
933688911 2:85164095-85164117 AATATGCAGCTACCCGTTAAAGG - Intronic
934953492 2:98595713-98595735 AATCTGCAGCTACCCTCTCATGG - Intergenic
940599022 2:155834391-155834413 AATCTTCCCCTTCCCTCTCAAGG + Intergenic
940890505 2:159031060-159031082 AATCTGCTGCTAACTCCTCAGGG - Intronic
942134799 2:172914266-172914288 ACTCTGCATCTGCCCTCTGAGGG + Intronic
943102031 2:183498529-183498551 AAAATGCAGCTACTCTTTCAAGG + Intergenic
1173474534 20:43349644-43349666 ACTCTGCTCCTACCCTCTCTGGG + Intergenic
1178923101 21:36752511-36752533 ATTCTGCAGATGCCCTCTCAAGG + Exonic
1179045456 21:37840641-37840663 AATTTGAAGCTACTCACTCATGG + Exonic
1182737867 22:32543873-32543895 AACATGCAGCTTCCATCTCATGG - Intronic
1184391648 22:44206693-44206715 AACCTGCAGCCTCCCTCCCATGG + Exonic
1184654171 22:45932808-45932830 AGTCTCCAGCTGCCCTCTCCTGG - Intronic
953226994 3:41030189-41030211 AGGCTGAAGCTACCCTCTGAAGG - Intergenic
953353262 3:42231702-42231724 CCTCTGCTGCTGCCCTCTCAAGG + Intergenic
955629262 3:60954693-60954715 AATTTGCAGCTAACCTCTTTTGG - Intronic
959434152 3:106292455-106292477 TATCTTCAACTAACCTCTCATGG - Intergenic
962129035 3:132652783-132652805 AGGCTGAAGCTACCCTCTAAGGG - Intronic
966299607 3:178463164-178463186 AACGTGGAGCTACCCTCTGAGGG + Intronic
968389112 4:174256-174278 AATCTTCAGCCACCCTCTCTGGG + Intergenic
968669916 4:1843708-1843730 AGTCTGAAGCTGCCCTCACAGGG - Intronic
969574613 4:8029775-8029797 AAGCTGCATCTTCCCTCCCAGGG - Exonic
974972215 4:68844482-68844504 CATGTGGAGCTACCCTCTCCAGG - Intergenic
975073852 4:70179798-70179820 AATCTGCATTTCCCATCTCAGGG + Intergenic
976100436 4:81556764-81556786 AATCTTGAGGTACTCTCTCATGG + Intronic
979912673 4:126389120-126389142 AATCTGCAGCTACCCTCTCATGG + Intergenic
981114227 4:140971176-140971198 AATCTGCAGCTACAGTTTCAGGG + Intronic
982139709 4:152305830-152305852 ATACTGCAGCTACTCTCTCAGGG + Intergenic
987371301 5:17195745-17195767 TATCATCAGCTACCCTTTCAAGG + Intronic
988633645 5:32957947-32957969 GAACTACAGCTACTCTCTCAAGG + Intergenic
989936799 5:50037017-50037039 AATTTGCATCTTCCTTCTCATGG + Intergenic
992299202 5:75360613-75360635 AATCTACAGCTCACCTCTGAAGG + Exonic
993831112 5:92759177-92759199 AAATTGAAACTACCCTCTCATGG + Intergenic
999774549 5:154801917-154801939 AGGCTGGAGCTTCCCTCTCATGG + Intronic
1001954630 5:175840611-175840633 AATCAGCACCATCCCTCTCAGGG + Intronic
1003420377 6:5952487-5952509 AATGTCCAGCTACCCTACCAAGG + Intergenic
1005295736 6:24424969-24424991 GTTCTGCAGCTTCCCTCTAATGG - Exonic
1006183145 6:32166040-32166062 ACTCTGCAGGTACCCTCTAAGGG - Intronic
1008015837 6:46518590-46518612 AACCTGCTGCTGCACTCTCAGGG - Intergenic
1008604367 6:53125730-53125752 AAATTACAGCTACCCTCTTATGG + Intergenic
1012247754 6:96945125-96945147 AAGCTGCATCCAACCTCTCAAGG - Intronic
1013356660 6:109351195-109351217 CATCTGCTGCTACCTTCTCAGGG + Intergenic
1019145971 6:169975829-169975851 GTTCTGCACATACCCTCTCATGG + Intergenic
1022980463 7:35600806-35600828 AATCTACAGCTTTCCTCTGATGG + Intergenic
1028437728 7:90823765-90823787 AATCTGCAGCTTCATACTCAGGG - Intronic
1029593915 7:101526583-101526605 TATCTGCAAATCCCCTCTCAGGG + Intronic
1030756236 7:113291220-113291242 AATCTGCAGCTGCCCAGCCACGG + Intergenic
1031674655 7:124594663-124594685 ATTCTTCAGCCACACTCTCAGGG - Intergenic
1032575063 7:133044836-133044858 AATCTGCAGCTCTCCTCCCCAGG + Intronic
1033795136 7:144836849-144836871 AATCTCCCTCTACCCTCTTAAGG + Intergenic
1034712095 7:153202537-153202559 AATCTCCAGCTACCTCCTCATGG + Intergenic
1035582864 8:751016-751038 GATCTCCGGCCACCCTCTCACGG + Intergenic
1035582873 8:751056-751078 GATCTCCGGCCACCCTCTCACGG + Intergenic
1035582883 8:751096-751118 GATCTCCGGCCACCCTCTCACGG + Intergenic
1035582893 8:751136-751158 GATCTCCGGCCACCCTCTCACGG + Intergenic
1035582903 8:751176-751198 GATCTCCGGCCACCCTCTCACGG + Intergenic
1035582913 8:751216-751238 GATCTCCGGCCACCCTCTCACGG + Intergenic
1035582923 8:751256-751278 GATCTCCGGCCACCCTCTCACGG + Intergenic
1035582933 8:751296-751318 GATCTCCGGCCACCCTCTCACGG + Intergenic
1039491073 8:37947828-37947850 ATTCTGCAGCTTCCATCTCTGGG - Intergenic
1041528385 8:58834834-58834856 AATCTGCAGCCTCACTCTCTTGG + Intronic
1043798286 8:84574381-84574403 AATATTCAGTTACACTCTCAGGG + Intronic
1048951887 8:139503112-139503134 AATCTGCAGCCACAGTCTCTAGG + Intergenic
1049907023 9:227538-227560 GAGCTGCAGCTGCCCTCTGAAGG + Intronic
1049962618 9:751057-751079 AATCTGCACCTTCCTTCCCAAGG - Intergenic
1050556834 9:6796546-6796568 AAACAGCAGCTACCCTCACAAGG + Intronic
1052743964 9:32421522-32421544 ACTCTGCAACACCCCTCTCAGGG + Intronic
1053018664 9:34679074-34679096 AATCTGGATGTACCTTCTCAGGG + Intergenic
1054989070 9:71300313-71300335 AATCAGCAGCATCCCTGTCATGG - Intronic
1056104750 9:83336167-83336189 AATTAAAAGCTACCCTCTCAGGG - Intronic
1192339521 X:70251814-70251836 AATCAACTGATACCCTCTCAGGG - Intergenic
1192395080 X:70772247-70772269 AATGTGCAGATACCAACTCAAGG + Intronic
1193743919 X:85252165-85252187 AATCTGCTGCTACCCTGTGAGGG + Intronic
1194215156 X:91122230-91122252 AATGTGCAGTTGACCTCTCAAGG + Intergenic
1194731402 X:97459814-97459836 AATCTGAAGCTAAGCTCTCTGGG + Intronic
1199731267 X:150634817-150634839 AATCTTCAGCCAGCCTCTCCAGG - Intronic