ID: 934954455

View in Genome Browser
Species Human (GRCh38)
Location 2:98605934-98605956
Sequence CAGTGGGGCTGGAGGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 800
Summary {0: 1, 1: 2, 2: 2, 3: 82, 4: 713}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934954455_934954464 16 Left 934954455 2:98605934-98605956 CCTGCTTTCCTCCAGCCCCACTG 0: 1
1: 2
2: 2
3: 82
4: 713
Right 934954464 2:98605973-98605995 CATTACCCTGAGTTTCTCTGAGG 0: 1
1: 0
2: 2
3: 20
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934954455 Original CRISPR CAGTGGGGCTGGAGGAAAGC AGG (reversed) Intronic
900003525 1:29232-29254 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900023245 1:199748-199770 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900125672 1:1068061-1068083 CAGTGGGGTTGGATGCAGGCAGG - Intergenic
900331550 1:2137276-2137298 CAGTGCGGCTGGGGCAAAGCAGG - Intronic
900686915 1:3954547-3954569 CAGAGGGGCGGGAGGAGAGGCGG - Intergenic
900729096 1:4240347-4240369 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901149518 1:7091938-7091960 CACTGGTGCTGGCGGAACGCAGG - Intronic
901155627 1:7136022-7136044 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901155812 1:7137450-7137472 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901469045 1:9442986-9443008 CAGGGAGACAGGAGGAAAGCAGG + Intergenic
901706362 1:11076488-11076510 CAGTGGTGGTGGAGGAAAAACGG - Intronic
901742306 1:11350303-11350325 CAGTGAGGCAGGAGGAGGGCTGG - Intergenic
901770837 1:11529625-11529647 CATCGGGGCTGGAGCTAAGCAGG - Exonic
901784162 1:11613566-11613588 CAGTGGACTTTGAGGAAAGCAGG - Intergenic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
902332077 1:15735598-15735620 CAGTGGGGGTGGGGGCGAGCAGG + Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902410534 1:16209017-16209039 AGGTGGGGCTGGAGGGTAGCAGG + Exonic
902676622 1:18013185-18013207 GAGTGGGGGAGGAGGAAAGCTGG - Intergenic
902761789 1:18585894-18585916 GAGTGGGGGTGGGGGGAAGCTGG + Intergenic
902821373 1:18945339-18945361 CAGTGGGCCAGGAGCAAAACGGG + Intronic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
902975334 1:20084356-20084378 CAGGAGGGCAGAAGGAAAGCCGG - Intronic
903330647 1:22595376-22595398 CGGTGGGGCTGGGGGCAGGCAGG - Intronic
903477430 1:23629171-23629193 CAGTGGGGCTGGGGCAAGGGAGG - Intronic
903806780 1:26011262-26011284 TAGTGAGGCGAGAGGAAAGCAGG + Intergenic
904001569 1:27341896-27341918 CAGTGGAGCTGGGGCCAAGCTGG + Intergenic
904597974 1:31658598-31658620 CAGTGAGAGGGGAGGAAAGCAGG + Intronic
905122949 1:35695727-35695749 CAGTGGGGAGGGAAGAAAGGAGG + Intergenic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
905307559 1:37030058-37030080 CAGTTGAGAAGGAGGAAAGCTGG + Intronic
905346658 1:37315695-37315717 CATTGGGGGTTGGGGAAAGCTGG + Intergenic
905446356 1:38030598-38030620 GAGGGGGACTGGAGGAAAGCTGG - Intergenic
905739330 1:40355965-40355987 TAGTGGGGGTGGGGGAAAGTGGG - Intronic
905934723 1:41814192-41814214 CTGTGAGGCTTGTGGAAAGCTGG + Intronic
906644734 1:47466229-47466251 CACTGGGTCAGGAGGTAAGCAGG - Intergenic
907515291 1:54989847-54989869 AAGTGGGGCTGGAGCATGGCTGG + Intronic
908267473 1:62393586-62393608 CAGAGGGGTTGGAGCAATGCAGG - Intergenic
908671832 1:66556538-66556560 CAATGGAGCTGGAGGAGGGCAGG + Intronic
909032569 1:70559748-70559770 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
910405394 1:86883789-86883811 AAGTGGGGCCTGAGGTAAGCAGG - Intronic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
911686064 1:100779174-100779196 CAGTGAAGCAAGAGGAAAGCAGG - Intergenic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
912109132 1:106318487-106318509 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
912348150 1:108985014-108985036 CAGTGGAGGTGGAGCAAAGTGGG - Intronic
912970027 1:114272389-114272411 ATGTGGGGCGGGAGGAGAGCAGG + Intergenic
914355954 1:146884827-146884849 CACTGGGGATGGTGGAAAGTGGG - Intergenic
914931855 1:151942056-151942078 CATTAGGGCTGGAGGAAATAGGG + Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915515367 1:156409562-156409584 GAATGGGGCTGGAGGAAGGGAGG - Intronic
915517159 1:156420309-156420331 CAGAGGGGCCCGGGGAAAGCCGG - Intronic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915830467 1:159124784-159124806 CAGTAGAGCAGGAGGAAAACAGG + Intronic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
916486758 1:165266393-165266415 CAGTGTGGCTGGGGCAAAGATGG + Intronic
917112593 1:171565150-171565172 CAGTGAGGCTGAAGCATAGCAGG - Intronic
918042883 1:180923894-180923916 CAGTGGGGCAGGATGGGAGCTGG - Intronic
918048500 1:180955142-180955164 AAGTGGGGCTGGAGAAGAGCAGG + Intergenic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919500374 1:198330705-198330727 CAGGGATGCTGGAGGAAAGGTGG - Intergenic
919666006 1:200293183-200293205 CAGTGGGGCAGAAGGAAAATGGG + Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919770256 1:201154105-201154127 GAGTTGGGCGGGAGGGAAGCAGG - Exonic
919784280 1:201249332-201249354 CAGTGGGGCTGGAACAAAGGTGG - Intergenic
919885163 1:201928361-201928383 TAGTGAGGCTGGAGCAAAGGAGG - Intronic
919921658 1:202169766-202169788 CACAGGGGCTGGAGGAAGGATGG - Intergenic
920363566 1:205436110-205436132 CTGAGGGGCGGGAGGAAGGCAGG - Intronic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
920874456 1:209821355-209821377 CACTGGGGGAAGAGGAAAGCTGG - Intergenic
922421464 1:225463462-225463484 CAGGGAGGCGGGAGGAAAACAGG + Intergenic
922546892 1:226464475-226464497 CAGCGGGGCTGGAGCATGGCCGG - Intergenic
922571272 1:226635884-226635906 CAGTGGGGCCAGAGGAAGGCCGG + Intronic
922672191 1:227518968-227518990 CAGTGGGGCTAGAGGGAGCCTGG + Intergenic
923676579 1:236085629-236085651 CCCTGGGGCAGGAGCAAAGCTGG + Intergenic
924210689 1:241764098-241764120 CAGTGTGGCTGGAGTAATACTGG + Intronic
924306914 1:242698861-242698883 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
1063088265 10:2839018-2839040 CAGAGGGGCTGGGGAAGAGCTGG - Intergenic
1063103255 10:2969990-2970012 CAGTGGCTCTTGAGGAAAACAGG + Intergenic
1063294443 10:4790255-4790277 GAGTGGGGTTGGAGGAAACCTGG + Intronic
1063461265 10:6216284-6216306 CCCTGAGGGTGGAGGAAAGCAGG + Intronic
1063785723 10:9380621-9380643 CAGCGTGGCTGGAACAAAGCAGG + Intergenic
1063827141 10:9910801-9910823 CAGTGAGGCTAGAATAAAGCAGG - Intergenic
1064367057 10:14717638-14717660 CAGTGTGGCTAGAACAAAGCAGG - Intronic
1064435977 10:15311627-15311649 CTGTGGGGCGGGAAGAAACCAGG - Intronic
1064546091 10:16451216-16451238 CAGTGCAGCTAGAGTAAAGCAGG - Intronic
1064585556 10:16836567-16836589 CAGAGGGGCAGGAGGAAGGGAGG + Intronic
1064667022 10:17664422-17664444 AAGAGGAGCTGGAGGAAAGGGGG - Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065864593 10:29903092-29903114 CAGTGCGGCTAGAACAAAGCGGG - Intergenic
1067146057 10:43694732-43694754 CAGAGGGGCTGGAGGAGGGGAGG + Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067411737 10:46070644-46070666 CAGTGGTGCTGAAAGGAAGCAGG + Intergenic
1067575157 10:47404171-47404193 CTGGGGAGCTGGAGGAAGGCAGG + Intergenic
1067826309 10:49576051-49576073 CACTGGGGTAGGAGGAAAACTGG + Intergenic
1068280704 10:54865212-54865234 CAGTGTGGCTAGAACAAAGCAGG + Intronic
1068288968 10:54976940-54976962 CTGTGAGGCTGGAAGAAAGGTGG + Intronic
1068738219 10:60438848-60438870 CTGTGGGGAGGGAGAAAAGCAGG + Intronic
1068963194 10:62886115-62886137 CAGTGAGTCAGGAGGGAAGCTGG + Intronic
1069034170 10:63630382-63630404 CAGTGAGGCTGGAGCCACGCTGG + Intergenic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1069799419 10:71072885-71072907 CAGAGTGCCTGGAGCAAAGCCGG + Intergenic
1069986309 10:72286561-72286583 AAGTGGGGCTGGAGGCAGGGTGG + Intergenic
1070722964 10:78769447-78769469 TGGTGGGGCTGAAGGAAAGAAGG - Intergenic
1070961392 10:80502467-80502489 CAGAGACACTGGAGGAAAGCTGG + Intronic
1071122563 10:82296449-82296471 TGGTGGTGGTGGAGGAAAGCAGG + Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071603498 10:86970266-86970288 TGGTGGGGCTGGAGGGAGGCGGG + Intronic
1071959264 10:90793952-90793974 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1072374911 10:94804361-94804383 CAGTTGGTCTGGAGGAAGGTAGG - Intronic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1073957442 10:108889661-108889683 CAGTGCGGCTGGAACAAAGCAGG - Intergenic
1073993255 10:109287920-109287942 CAGGGAGGGTGGAGGAAAGTGGG - Intergenic
1074108759 10:110408157-110408179 CAGAGGGGCTGGAGGAGGCCTGG + Intergenic
1074449497 10:113547702-113547724 CATGGGGGAGGGAGGAAAGCAGG - Intergenic
1074888051 10:117710267-117710289 CACAGCGGCTGTAGGAAAGCTGG + Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075261650 10:120968509-120968531 CACTGGGGAGGAAGGAAAGCTGG - Intergenic
1075383384 10:122037208-122037230 CGGTGTGGCTGGAGAAAAGTGGG + Intronic
1075613099 10:123869250-123869272 CAGCCAGGCTGCAGGAAAGCGGG + Intronic
1075734057 10:124653339-124653361 CAGGAGGGTTGGAGTAAAGCAGG + Intronic
1075945263 10:126427552-126427574 CAGCGTGGCTGGAATAAAGCAGG + Intronic
1075970725 10:126649977-126649999 GAGTGGGGAGGGAGGAAAACAGG + Intronic
1076065981 10:127448172-127448194 CAGTGCTGCTGGAGGAAGCCAGG - Intronic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076447068 10:130523567-130523589 CAGCGTGGCTGGAATAAAGCCGG + Intergenic
1076632725 10:131861119-131861141 CAGTAGAGTTGGAGTAAAGCAGG + Intergenic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1076942787 10:133620968-133620990 AAGTGGGGCTGGGGGAAGCCCGG + Intergenic
1076995289 11:294695-294717 CGGTGGGGCTGGAGGAACCCAGG - Exonic
1077212905 11:1381794-1381816 CAGAGCAGCGGGAGGAAAGCAGG - Intergenic
1077330669 11:1982630-1982652 CCCTGGGGCTTGGGGAAAGCCGG - Intronic
1077413134 11:2412757-2412779 CGCTGGTGCTGGAGGAAATCCGG - Exonic
1077440323 11:2565873-2565895 CACTGGGTCTGGAGGAAGGAGGG + Intronic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077493161 11:2871412-2871434 CAGGGAGGCTAGAGGAAGGCGGG - Intergenic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1077782678 11:5348668-5348690 CAGGGCGGCTAGAAGAAAGCAGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1079152509 11:17913248-17913270 GTGTGGGGCTGGAAGAAAGTGGG - Intronic
1079232888 11:18664969-18664991 GTGTTGGGCCGGAGGAAAGCAGG + Intergenic
1079467354 11:20743616-20743638 CTGTGGGGTAAGAGGAAAGCAGG - Intronic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1081743016 11:45454089-45454111 CAGTGGGGTTGGGGGAAGCCGGG + Intergenic
1081907391 11:46678547-46678569 CAGTGGGGCTTCTGCAAAGCAGG + Exonic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083144869 11:60750583-60750605 CAGTGGGACGTGCGGAAAGCAGG - Intergenic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1084082927 11:66840866-66840888 CAGTTGGGATGGAAGATAGCTGG - Intronic
1084172367 11:67406705-67406727 CATGGGGGCTGGAGGAAGGAGGG + Intronic
1084209635 11:67615046-67615068 GAGTGGGGCTGGAGCACAGGTGG - Intergenic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085204515 11:74722742-74722764 GAGTGGGGCTAGAAGAATGCAGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085323919 11:75592331-75592353 CATTGGGGCTGCAGGCAAGGAGG - Intronic
1085993511 11:81881416-81881438 CAGTGGGGTAAGATGAAAGCAGG - Intergenic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1088212640 11:107473557-107473579 CAGTGAGGCTGGAATAAAGTAGG - Intergenic
1088594286 11:111428353-111428375 CAGTGGGGTTTGAAGAAATCTGG - Intronic
1088851300 11:113705597-113705619 CAGTGAGGCTGCAGGACAGCAGG + Intronic
1088907832 11:114168255-114168277 TCCTGGGGCTGGAGGGAAGCAGG - Intronic
1088928107 11:114322584-114322606 GAGTGGGGCTCGAGGAAACCTGG + Intergenic
1089371040 11:117957838-117957860 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
1089430971 11:118424200-118424222 CAGTGTGGCTGGAGGAAGAGTGG - Intronic
1089758211 11:120702620-120702642 CCAAGGGGCAGGAGGAAAGCTGG + Intronic
1090396369 11:126421878-126421900 GAGTGGGGGTGCAGAAAAGCTGG - Intronic
1091161847 11:133429951-133429973 CAGTGAGTCTGGATGGAAGCGGG + Intronic
1202813647 11_KI270721v1_random:37809-37831 CCCTGGGGCTTGGGGAAAGCCGG - Intergenic
1091376944 12:31286-31308 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1091534338 12:1391418-1391440 CAGTGGGGGTGAAGGAAGGGGGG + Intronic
1091545264 12:1497484-1497506 CTCTGGGGCTGGGGGGAAGCTGG + Intergenic
1091671652 12:2456516-2456538 CAGTGTGGCTGGAGCAGGGCAGG - Intronic
1092104528 12:5912193-5912215 CAGTGGGTCTAGTGAAAAGCAGG - Intronic
1092259746 12:6946470-6946492 CTTTGGGGCTGCAGGGAAGCTGG + Intronic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1092529379 12:9331883-9331905 CAGTGTGGCTGCAGGGAGGCTGG + Intergenic
1092902202 12:13070508-13070530 CACTTGGGCTGGAGGAAATTGGG + Intronic
1092999173 12:13979689-13979711 CAGTGGGGGTGGATGTATGCAGG - Intronic
1094057737 12:26283847-26283869 CAGTGCGGCTAGAACAAAGCAGG + Intronic
1094206768 12:27848661-27848683 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1094323369 12:29209556-29209578 CAGTTCTGCTGGAGGAAAACTGG + Intronic
1094472071 12:30812147-30812169 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1094490994 12:30960514-30960536 CAGCAGACCTGGAGGAAAGCAGG - Intronic
1095590310 12:43895960-43895982 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1096189927 12:49609820-49609842 GAGTGGGGCTGGACCAGAGCAGG - Intronic
1096571882 12:52528142-52528164 AAGAAGGGCTGGAGGAAATCAGG - Intergenic
1096816893 12:54207469-54207491 CAGTGGAGGTGGGGGGAAGCAGG + Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097285622 12:57874942-57874964 CAGTGTGGCTGGAGCAATGTAGG + Intergenic
1097912239 12:64982714-64982736 GAATTGGGATGGAGGAAAGCAGG - Intergenic
1097966352 12:65585659-65585681 GAGTGGAGCTGGAGGAAAGGAGG - Intergenic
1098014803 12:66092846-66092868 CAGTGGGTCTGGAGCCAAGCAGG - Intergenic
1098832369 12:75377652-75377674 CACTGTGGCTGGAATAAAGCAGG - Intronic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099095813 12:78372870-78372892 CAGTGGGGCAGGGGCAAGGCAGG - Intergenic
1100526573 12:95425145-95425167 CAGAGAGGCTGGAGGAAACGGGG - Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101084984 12:101226628-101226650 CTGTAAGGCTGGAGGAAACCAGG - Intergenic
1101607024 12:106255002-106255024 TAGTGTGGCTAGATGAAAGCGGG - Intronic
1101937424 12:109069653-109069675 CAGTGGGGGATGAGGATAGCAGG + Intronic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102390344 12:112544477-112544499 CAGTGGGGGTAGGGGAAAGAGGG + Intergenic
1102561115 12:113762878-113762900 TCCTGGGGCTGGAGGAAGGCTGG - Intergenic
1102961422 12:117095961-117095983 CTGTGGGACTGCAGGCAAGCTGG + Intronic
1103328490 12:120137569-120137591 CTGTGGTTCTGGAGGAGAGCTGG - Exonic
1103568662 12:121830051-121830073 CAGTTGGGCTGCAGGCAAGGTGG - Exonic
1103736220 12:123062408-123062430 CTGTGGGGCTGGGGGAATCCTGG + Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106485503 13:30168758-30168780 CACTGGGGTTTGAGGAAGGCTGG - Intergenic
1107191829 13:37597275-37597297 CATTTGGGCTGGAGGATAGAGGG + Exonic
1107651410 13:42549028-42549050 AAGTGGGGCTGGGGGAAACAGGG - Intergenic
1107933040 13:45322095-45322117 TAGTGGGGCTAGAGCAAAGCAGG + Intergenic
1108152281 13:47548504-47548526 CTTTGGGGCTGGATGAGAGCAGG - Intergenic
1108313625 13:49218480-49218502 AAGTGGAGGTGGAGGAAGGCTGG + Intergenic
1109143370 13:58745306-58745328 CAGTGAGGGTGGGGGAAAGTAGG + Intergenic
1110240298 13:73259274-73259296 CAGGGAGGCTGGAGAACAGCTGG - Intergenic
1113128963 13:107013351-107013373 CAGTGAGGCTAGAAAAAAGCAGG + Intergenic
1113218796 13:108074311-108074333 CAGTGTGGCTGGAACAAAGCAGG - Intergenic
1113517463 13:110914661-110914683 CAGTGGGAGTCGGGGAAAGCGGG - Intronic
1113550220 13:111187061-111187083 CAGTTGGGCTGGAATAGAGCTGG + Intronic
1113916133 13:113875135-113875157 CAGTGGGGCTGGGCCCAAGCAGG + Intergenic
1113959548 13:114119055-114119077 GGGTGGGTCAGGAGGAAAGCGGG - Intronic
1114432274 14:22671608-22671630 CCCTGGGGCTAGAGGAAATCAGG + Intergenic
1115834026 14:37377274-37377296 CAGTAGGGGAGGAGGAAAGAGGG + Intronic
1116292274 14:43059371-43059393 CAGAGGGGTTGGAGGGCAGCAGG + Intergenic
1116613906 14:47109362-47109384 CAGTTGGTCTGGACAAAAGCTGG - Intronic
1117001685 14:51376886-51376908 CAGTGCAGCTGGAATAAAGCAGG + Intergenic
1117416707 14:55503090-55503112 CAGTGGGTGGGGAGGCAAGCTGG + Intergenic
1117934778 14:60890770-60890792 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1118375249 14:65171151-65171173 CAGTGGGGCTGGGGGACATGAGG + Intergenic
1118447704 14:65866851-65866873 CTATGGGGCAGGAGAAAAGCTGG + Intergenic
1120100952 14:80445207-80445229 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1120924776 14:89787085-89787107 CAGTGCGGCTGGAATAAAGCAGG + Intergenic
1121172016 14:91862510-91862532 GAGTGGGGCTGAGGGAAATCTGG + Intronic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122277696 14:100603703-100603725 CAGCAGGGCTGGACGAAGGCTGG - Intergenic
1122385391 14:101341828-101341850 CAGTGTGGCTGCAGCAAAGGAGG - Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122609208 14:102969707-102969729 TGGTGGGGCTGGAGGGTAGCAGG - Intronic
1122874225 14:104656112-104656134 CAGTGCGGCTGGAGGCAGACGGG + Intergenic
1123926700 15:25120004-25120026 CTGTGAGGCTGTAGGAAAGCTGG - Intergenic
1124241133 15:28028484-28028506 CAGTGGAGCTGTAGGGAAGGTGG + Intronic
1124361179 15:29037588-29037610 ACGTGGGGCTGGAAGAAATCAGG + Intronic
1124583211 15:30980737-30980759 AAGTGGGGGTGAAGAAAAGCGGG + Intronic
1124813586 15:32966166-32966188 CCGTGGGGCTAGAGCCAAGCAGG - Intronic
1124855084 15:33380023-33380045 CAGTGCGGCTAGAACAAAGCAGG - Intronic
1125721934 15:41849374-41849396 GAGTGGGGATTGGGGAAAGCAGG + Intronic
1125885917 15:43229401-43229423 CTCTGGGGTTGGAGGAAAGCTGG + Intergenic
1125979367 15:43985951-43985973 CAGTGGGCCTGAAGGAATGCAGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126837087 15:52678802-52678824 CGGCGGGGCTGAAGGAAATCCGG - Intronic
1126989264 15:54353725-54353747 CAGTGAGGTCAGAGGAAAGCTGG - Intronic
1127508383 15:59616546-59616568 CAGTGAGGCAGGAAGAATGCTGG - Intronic
1127651337 15:61011117-61011139 GAGGGGGGTGGGAGGAAAGCTGG - Intronic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1128997797 15:72309604-72309626 CAGTGGTGATGGAGGACACCTGG + Intronic
1129000725 15:72331356-72331378 CAGTGCAGCTGGAATAAAGCAGG - Intronic
1129472041 15:75761498-75761520 CAGTGGTGGTGGAGGAATTCCGG + Intergenic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130580841 15:85135537-85135559 CAGTGGGGCAGGATGAGAACAGG - Intronic
1130898149 15:88186594-88186616 CTCTGGGGCTGCAGGAAAGCAGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131076388 15:89497709-89497731 AAGAGGGGCTGGAGGGGAGCAGG + Intergenic
1131285010 15:91049584-91049606 GACTGGGGCTGGAGAGAAGCGGG + Intergenic
1132359623 15:101201567-101201589 CAGTGGGGTGGGAGGAGAGGAGG + Intronic
1132449976 15:101961708-101961730 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
1132570990 16:643911-643933 CAGTGGGGCTAGAGGAGCCCTGG + Intronic
1132574108 16:656880-656902 CCGTGGGGCTGGTGGCCAGCTGG - Intronic
1132589471 16:720439-720461 GAGTGTGGTGGGAGGAAAGCCGG - Intronic
1132676663 16:1123880-1123902 CTGTGGGGCTGGGGGAAGCCGGG + Intergenic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1133365965 16:5210419-5210441 CAGTCTGGCTGGAGGACAGTGGG - Intergenic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133905874 16:10021764-10021786 CAGTGGGGCTGGAGCAAATGAGG + Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134362744 16:13546940-13546962 CAGTGTGGCTGTAGCACAGCAGG - Intergenic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1135517065 16:23145025-23145047 CAGTGGGGGTGCAGGAAGCCTGG - Intronic
1135715117 16:24757621-24757643 GAGAGGGGCTTGAGGACAGCAGG - Intronic
1136402000 16:30024302-30024324 CAGTCAGGGAGGAGGAAAGCAGG - Exonic
1136536635 16:30903398-30903420 CAGAGGGGCTGAAGGAAAGGAGG - Exonic
1136576738 16:31129799-31129821 CAGTGGAGCTGGATGAAGCCCGG - Intronic
1137374937 16:47944326-47944348 CAGCGGGGCAAGGGGAAAGCAGG + Intergenic
1137523992 16:49217788-49217810 CAGTGAGGCTAGAATAAAGCAGG - Intergenic
1137768632 16:50996812-50996834 CAGTGGGGCTGGGGGAGGGTGGG - Intergenic
1137847720 16:51708470-51708492 TAGTGGAGCTGGAGAAAAGATGG + Intergenic
1138238743 16:55408923-55408945 CAGTGAGGGAGGAGGAAAGCAGG - Intronic
1138510815 16:57507616-57507638 CTGTGGGGCTTGAGGAAGACTGG + Intergenic
1139335510 16:66228262-66228284 CAGTTGTGCTGGTGGAGAGCAGG - Intergenic
1139510746 16:67427204-67427226 CAGTGAGGTCGGAGGAAACCCGG + Intergenic
1139958220 16:70703396-70703418 CCATGGGGCTGGAGGAGGGCAGG + Intronic
1139978062 16:70830634-70830656 CACTGGGGATGGTGGAAAGTGGG + Intronic
1140430418 16:74898277-74898299 GAGTGGGACTGGAGCAATGCAGG - Intronic
1140774297 16:78235874-78235896 CAGAGGGGCTGTAGCATAGCAGG + Intronic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1142008010 16:87699385-87699407 CAGTGGTGATGTAGAAAAGCAGG + Intronic
1142144417 16:88486989-88487011 CTGTGAGGGTGGAGGAAATCAGG - Intronic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1142698052 17:1644304-1644326 CTGCTGGGCTGGAGGAGAGCTGG + Intronic
1142742590 17:1939872-1939894 CAAAGGGGCTGGAGGCTAGCTGG - Intronic
1142872440 17:2829494-2829516 TAGAGGGGCTGGAGGTGAGCAGG - Intronic
1143030789 17:3965782-3965804 CTGTGGAGCTAGAGGAATGCTGG + Intergenic
1143999071 17:11035750-11035772 CAGTGGGGCTGGAGCATGGAGGG - Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144150395 17:12437648-12437670 CAGTGGGGGTGGGGGAAATGGGG - Intergenic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144952166 17:19000213-19000235 CACTAGGGCTGGAGGGAGGCTGG + Intronic
1145254693 17:21316212-21316234 GACTGGGGCTGGAGGACAGGAGG - Intergenic
1145321904 17:21771753-21771775 GACTGGGGCTGGAGGACAGGAGG + Intergenic
1145838088 17:27969993-27970015 CAGTGAAGCTGGAGAAAAGAGGG - Intergenic
1146477055 17:33171524-33171546 CAATGGTGATGGAGAAAAGCAGG - Intronic
1146631028 17:34469385-34469407 CATTAGGGTTGGAGGGAAGCTGG - Intergenic
1146792611 17:35760957-35760979 GAGTGGGGCTGGAGGCAGGGTGG + Intronic
1147256845 17:39186652-39186674 CAGTGGGGCTGGAGCACCTCCGG - Intronic
1147448407 17:40488895-40488917 CAGAGGGGCTGGAGCAGTGCTGG + Exonic
1147871623 17:43591711-43591733 CTGGGGGGCTGGGGGAAACCTGG + Intergenic
1148786781 17:50149593-50149615 CGGTGGAGGTGGAGGAGAGCGGG - Exonic
1148989985 17:51657472-51657494 AGGTGGGTCTGGAGAAAAGCAGG + Intronic
1148998988 17:51737754-51737776 AAGGGGGGCTGTAGGGAAGCAGG - Intronic
1150076131 17:62193632-62193654 TAGTGGGCTTGGAGGACAGCAGG - Intergenic
1150631233 17:66881822-66881844 AAATGGGCCTGGAGGAAAGTGGG + Intronic
1150895514 17:69205776-69205798 CAGTGGGGCTGGGGGAATATTGG + Intronic
1151431978 17:74069912-74069934 CTGTGGGGCTGGTGTAAAGAAGG - Intergenic
1151445920 17:74163942-74163964 CAGTGGAGGCGGAGGAAAACTGG - Intergenic
1151449322 17:74188127-74188149 CAGTAGGGCTGAACCAAAGCAGG + Intergenic
1151512709 17:74571059-74571081 CAGTGGGGAGGGAAGAAAGTGGG - Intergenic
1151530344 17:74700294-74700316 AAGTGAGGCTGGAGTGAAGCAGG - Intronic
1151941912 17:77297999-77298021 CAGAGGGGCTGCAGTAGAGCAGG + Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152559516 17:81070919-81070941 CAGTGGGGGTGGATGACAGAAGG + Intronic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1152992756 18:377872-377894 GAGTGGGGCTGGGGGAAATAGGG + Intronic
1153101161 18:1471244-1471266 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1153118468 18:1690376-1690398 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1155257719 18:24013992-24014014 CAGTGGGGCAGGAGGAGAAATGG - Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1156169861 18:34469613-34469635 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1156466929 18:37353634-37353656 AGGTGGGGCTGGGGGAAAGGTGG + Intronic
1156524669 18:37755699-37755721 AACTGGGAATGGAGGAAAGCTGG - Intergenic
1157158236 18:45288394-45288416 CAGTGGGGCAGGAGCAACGATGG + Intronic
1157242631 18:46025390-46025412 CAGTGGAGCTGGAAGAGAGTGGG - Intronic
1157557345 18:48621545-48621567 CAGTGAGGCAGGAGGGAACCAGG + Intronic
1157845465 18:51000125-51000147 CAGAGTGGCTGGAACAAAGCTGG + Intronic
1158321129 18:56265834-56265856 CAGGTGGGCTGGAAGAAAGTAGG + Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158667981 18:59449939-59449961 CAGAGGGGCTGAAGGGAACCAGG - Intronic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1160635278 19:70840-70862 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1161233769 19:3188180-3188202 CCGGGGGGCTGGAGGGAGGCCGG - Intronic
1161738442 19:6005841-6005863 CAGTGGGGCTTAAGGGAGGCTGG + Intronic
1162157889 19:8692119-8692141 CAGTGTGGCTGGAGGTAAAGGGG + Intergenic
1162946834 19:14049087-14049109 GAGTGGGGCTGGAGGATGGGGGG + Intronic
1164594368 19:29524333-29524355 CAGCGGGGTTCCAGGAAAGCAGG - Intergenic
1164609130 19:29620488-29620510 CAGGGAGGCAGGAGGAAAGTTGG - Intergenic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1164741143 19:30576358-30576380 CAGTGGAGATGGAGGAACGATGG - Intronic
1165133344 19:33647270-33647292 CAGTGAGACAGGAAGAAAGCAGG + Intronic
1165136962 19:33675612-33675634 CAGTGGGGCAGGAAGGAGGCTGG - Intronic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165773584 19:38391923-38391945 CTGAGGGGCAGAAGGAAAGCAGG - Intronic
1166320769 19:42017604-42017626 CAGAGAGGTTGGAGGAAACCAGG + Intronic
1166360721 19:42251929-42251951 CTGAGGGGCTGGTGGAAGGCTGG - Intronic
1166913922 19:46181143-46181165 CAGTGAGGCTGGAAGCAAGATGG - Intergenic
1167510985 19:49895263-49895285 CTGTGGGGATGGAAGAAGGCAGG - Intronic
1167587542 19:50383491-50383513 TGGTGGGGCTAGAGGAAATCAGG + Intergenic
1167710390 19:51106999-51107021 CAGATGGGCTGGATGAAAGGTGG - Intronic
1167882119 19:52468729-52468751 CAGTGTGGCTAGAACAAAGCAGG + Intronic
1168251275 19:55143648-55143670 CAGAGGGGTGGGAGGCAAGCCGG - Intronic
925273580 2:2633124-2633146 CTGTGGGGCTGTAGGAAAAGCGG + Intergenic
925572491 2:5326528-5326550 CAGTGTGGCTGGGACAAAGCCGG - Intergenic
925847562 2:8047516-8047538 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
925913460 2:8587992-8588014 CAGTGGGGCAGGTGGGAACCTGG + Intergenic
926039812 2:9664100-9664122 CAGTGGGGCAAGAGGAATTCAGG - Intergenic
927028578 2:19096386-19096408 CAGTGCGGCTAGAGTAAAGCAGG + Intergenic
927077594 2:19595550-19595572 CAGTGCGGCTAGAAAAAAGCCGG + Intergenic
927355660 2:22170184-22170206 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
928490161 2:31775081-31775103 CAGTGCGGCTAGAATAAAGCAGG + Intergenic
929191773 2:39146925-39146947 CAGTGGGACTGGGGGAAAGCAGG - Intergenic
929246432 2:39708247-39708269 CAGTGGGGCTGGAGGGAGTGAGG + Intronic
929759944 2:44798463-44798485 ATGCGGGGCTGGAGGAAAGCAGG - Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929895957 2:45960996-45961018 CAGAGGGGCTGGAAGCAAGAGGG + Intronic
930164838 2:48194808-48194830 CAGTGGGGATGGGGAAGAGCAGG - Intergenic
930273750 2:49286746-49286768 CAGTGGTGGTGGATGAAGGCTGG + Intergenic
930480857 2:51946737-51946759 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
931054168 2:58450011-58450033 CAGAGGGGCTTGAGGGAACCTGG - Intergenic
931110122 2:59101269-59101291 CAGTGTGGCTAGAGTAAAACAGG - Intergenic
931255462 2:60568336-60568358 GAGGGGGGGTGGTGGAAAGCAGG - Intergenic
932561491 2:72875178-72875200 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
932795504 2:74692018-74692040 CACTGGGCCAGGAGGGAAGCTGG + Intergenic
932904992 2:75739448-75739470 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
933008767 2:77029541-77029563 CAGTGTGGCTAGAATAAAGCAGG - Intronic
933315942 2:80715205-80715227 CAGTGGCATTTGAGGAAAGCAGG + Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
933946010 2:87286702-87286724 CAGTGAGGGGAGAGGAAAGCAGG + Intergenic
934729540 2:96647913-96647935 CAGGGTGGCTGGAGGAATGAGGG + Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
934981768 2:98849088-98849110 CAGTGGGGCTCAAGAGAAGCTGG + Intronic
935708107 2:105873634-105873656 CAGTGAGGCTGGGGGAAGGGTGG + Intronic
936334201 2:111574884-111574906 CAGTGAGGGGAGAGGAAAGCAGG - Intergenic
936566202 2:113584203-113584225 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
937206207 2:120238696-120238718 CAGTGGGGCAGGAGGAGGACAGG + Intergenic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937732634 2:125252891-125252913 CAGTGTGGCTGCAATAAAGCAGG - Intergenic
937923984 2:127153837-127153859 CTATGTGGCTGGAGGAAACCAGG + Intergenic
938769425 2:134488343-134488365 CAGTGTGGCTAGAATAAAGCAGG + Intronic
938902709 2:135811563-135811585 CAGTGTGGCTGGAGCAATGAGGG + Intronic
938997198 2:136692700-136692722 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
939356911 2:141114425-141114447 CAGTGGGGTGGAAGGGAAGCTGG + Intronic
940711424 2:157167049-157167071 CAGTGTGGCTAGAACAAAGCAGG + Intergenic
941039139 2:160600665-160600687 CAGAGTGGCTAGAAGAAAGCAGG + Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941294197 2:163715507-163715529 CAGAGCGGCTGGAGTGAAGCAGG - Intronic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
942179969 2:173370974-173370996 CAGTGGGACAGTAGGAAACCAGG + Intergenic
942181937 2:173388496-173388518 CAGAGGGTCTGGAAGGAAGCAGG + Intergenic
942308903 2:174635433-174635455 TAGAGAGGCTGGAGGAGAGCTGG + Intronic
943088751 2:183349221-183349243 CAGAGAGCCTGGAGGGAAGCGGG - Intergenic
944745417 2:202650831-202650853 CAGTGCGGCTAGAATAAAGCAGG - Intronic
945039740 2:205733782-205733804 GGGTGGGGCTGGAGAAGAGCAGG - Intronic
945420834 2:209634048-209634070 CGGTGTGGCTGGAGCAAAGATGG - Intronic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946349391 2:219139408-219139430 CACTGGCTCTGGAGGAAACCAGG + Intronic
946523915 2:220497286-220497308 CAGTGAGGCTAGAATAAAGCAGG - Intergenic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
947670198 2:231930868-231930890 CAGTGGGGTTGGAGGCCATCTGG - Intergenic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948554261 2:238796409-238796431 CTGTGTGGCAGGAGGACAGCTGG + Intergenic
948567696 2:238897188-238897210 AAGTGCGGCAGGAGGAACGCAGG - Intronic
948610232 2:239162113-239162135 CAGTGGGGCTGCTGGGAAGCAGG - Intronic
948874031 2:240818035-240818057 CAGTGGGGAAGGGGGAAAGGAGG + Intronic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1168857432 20:1018584-1018606 CAGTGGGGCTGGAAAAGAGTGGG - Intergenic
1169260423 20:4134446-4134468 CCGTGAGGCAGGAGGAAAACCGG + Intronic
1170100037 20:12688837-12688859 TAGTGGGGATTGAGGAAAGGTGG - Intergenic
1170531270 20:17294833-17294855 CAGAGGAGATGGAGGAAAACAGG - Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170871762 20:20212656-20212678 AGGTGGGGGTGGAGGATAGCAGG - Intronic
1171324224 20:24276633-24276655 CAGTGTGGGTGCAGGACAGCAGG + Intergenic
1171424699 20:25042267-25042289 GCCTGGGGCTGGAGGAAAGGTGG + Intronic
1172630939 20:36377808-36377830 CCGTGTGGTTGGAGGAACGCGGG - Intronic
1172997869 20:39084004-39084026 CAGTGGGGCTGGGGGCAGGGTGG + Intergenic
1173229168 20:41180798-41180820 CAGAGTGGCTGGAGGAAAAGTGG - Exonic
1173246548 20:41341255-41341277 CAGTCAGGCTGGGGTAAAGCTGG - Intronic
1173609435 20:44355856-44355878 AAGTGGGGCTGGGGGAAGACTGG + Intronic
1173850832 20:46216652-46216674 GAGGGGGGCTGGGGGATAGCTGG + Intronic
1173926536 20:46785238-46785260 CAGTGGGGTTGCAGCAAAGAGGG - Intergenic
1174199319 20:48796029-48796051 AACTGGGGCTGGAGGCAACCAGG + Intronic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1175129183 20:56776438-56776460 CAGTGGCGCTGGAGGAGGGTGGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175548823 20:59802390-59802412 CATTGAGGCAGGAGGATAGCAGG + Intronic
1175665432 20:60854604-60854626 CAGTGCGGCTGGAACAAAGCAGG - Intergenic
1175888794 20:62306977-62306999 CGGTGGGGCTGGAGGACTGGAGG + Intronic
1175966059 20:62660818-62660840 AAGTGGGGCTGGGGGAAGGAGGG - Intronic
1176289820 21:5037971-5037993 CAGTGGGGAGGGGGGAGAGCGGG - Intronic
1176289841 21:5038023-5038045 CAGTGGGGAGGGGGGAGAGCGGG - Intronic
1176419988 21:6506351-6506373 CAGTGTGGCTGGAACAAAGCAGG + Intergenic
1176910351 21:14557915-14557937 CAGGTGGCCTGAAGGAAAGCAGG - Intronic
1177378232 21:20302107-20302129 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178668545 21:34569958-34569980 CAAAGGGGCTGGAGGAAGGGAGG + Intronic
1178759915 21:35392535-35392557 GATAGGGGCTGGAGGAGAGCAGG + Intronic
1179164410 21:38924579-38924601 CAGTGGATCTGCAGGAAGGCTGG - Intergenic
1179647639 21:42785057-42785079 GTGTGGGGCTGGAGGAACCCCGG - Intergenic
1179695479 21:43114671-43114693 CAGTGTGGCTGGAACAAAGCAGG + Intergenic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1179867410 21:44225616-44225638 CAGTGGGGAGGGGGGAGAGCGGG + Intronic
1180007454 21:45029423-45029445 CTGGGGTGCTGGAGGCAAGCGGG + Intergenic
1180880999 22:19203557-19203579 CAGCGGGGTGGGAGAAAAGCAGG - Intronic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1181967350 22:26666508-26666530 CAGTGTGGCAGGAGCAGAGCTGG + Intergenic
1182116219 22:27757961-27757983 TAGTGGGGCAGGAGAAAAGTGGG - Intronic
1182335265 22:29579951-29579973 CAGTGGGGCTTTTGGACAGCTGG - Intronic
1182707408 22:32294547-32294569 GGGTGGGGCAGGAGGAAAGTGGG - Intergenic
1182926706 22:34131904-34131926 CAGTGGGGCTAGAATAAAGCAGG - Intergenic
1182989182 22:34750714-34750736 CAGCAGGGTTGGAGGAAAGTGGG + Intergenic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184395749 22:44238000-44238022 GGGTGGGGCAGGAGGAAAGTGGG - Intergenic
1184549699 22:45197941-45197963 CAGATCGGCTGGAGGAAAGAAGG + Exonic
1184761550 22:46547544-46547566 CAGTGGGGCTGGTGGAGCTCTGG - Intergenic
1184798598 22:46746711-46746733 CAGACAGGCAGGAGGAAAGCAGG + Intergenic
1185014047 22:48333246-48333268 GAGTGAGGCTGGAGGGAGGCGGG - Intergenic
1185042778 22:48513921-48513943 CAGCAGGGCAGGAGGAAAGGGGG + Intronic
1185228209 22:49665178-49665200 CAGCGGGGCTGGGGGTCAGCAGG - Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
949424669 3:3904089-3904111 CACTGAGGCTTGAGGAAAGCAGG - Intronic
949660706 3:6275315-6275337 CAGTGTGACTGGAACAAAGCAGG - Intergenic
950482127 3:13250795-13250817 CAGCAGGGGTGGGGGAAAGCTGG - Intergenic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
950988273 3:17400722-17400744 CAGTGTGGCTAGAATAAAGCAGG + Intronic
951464419 3:22986688-22986710 GAGAGGAGCTAGAGGAAAGCAGG + Intergenic
952382437 3:32816096-32816118 TAATGGGGCTGGGGGGAAGCAGG - Intergenic
952684633 3:36133853-36133875 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
952954324 3:38547773-38547795 CCCTGGGGCTGGGGGAAGGCAGG + Intergenic
953189034 3:40666235-40666257 CATTGTGGCGGGAGGAAAGGTGG + Intergenic
953317284 3:41940555-41940577 CACTGAGGCAGGAGGATAGCTGG + Intronic
953576973 3:44120734-44120756 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
953586761 3:44208029-44208051 CAGTGGGCCTAGAAGAAAGTGGG - Intergenic
954143251 3:48621213-48621235 CACAGGGGCTGGATGAGAGCAGG + Intronic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
954917970 3:54164685-54164707 CAGTGGGGATGGGGGAAGGATGG + Intronic
955148884 3:56347389-56347411 AGGGGGCGCTGGAGGAAAGCTGG + Intronic
955829596 3:62986932-62986954 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956682096 3:71790439-71790461 CAGTGTGGCAGGAGCAGAGCTGG - Intergenic
956857256 3:73287308-73287330 TTGTGGGGCTGGAGGAGAGGAGG + Intergenic
956902936 3:73735797-73735819 AAGTGGGGCTTAAGGTAAGCTGG + Intergenic
957037058 3:75303130-75303152 GAGTAGGGGTGGAGGAAAGGGGG + Intergenic
958053930 3:88385233-88385255 CGGTGAGGCGGGAGGAAAACTGG + Intergenic
958833251 3:99114963-99114985 CAGAGGGGCTGGAGCTAAGATGG + Intergenic
959824066 3:110771832-110771854 CAGTGTGGCTGCAGCAGAGCTGG - Intergenic
959983566 3:112546832-112546854 CAGTGGGGCGGGGGGAAAGAAGG + Intronic
960461748 3:117943977-117943999 CAGTGGGGTTGGAGGATAAAAGG + Intergenic
960864894 3:122189522-122189544 CACTGAGGGTGGAGGAAAACAGG - Intronic
960882156 3:122356034-122356056 CAGTGAGGTTGGAGGTGAGCAGG + Intergenic
961168620 3:124780309-124780331 CAGTGGGGCTGCAGGAAGGAAGG + Intronic
961262683 3:125615312-125615334 CAGTGTGGCTAGAACAAAGCAGG + Intergenic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961616543 3:128187201-128187223 CAATGGGGCTGGAGGCAGTCAGG - Intronic
961616791 3:128188858-128188880 GAGCGGGGCTGGAGGACAACAGG - Intronic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
962309256 3:134313709-134313731 CAGTCGCGCTGGAGGAAAGGAGG + Intergenic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
962958512 3:140288665-140288687 CAGTGGTGTTGGTGGGAAGCAGG - Intronic
963043181 3:141083877-141083899 CAGAGGGGAGGGAGGTAAGCAGG - Intronic
964421736 3:156510846-156510868 CAAAGGGGCAGGAGGGAAGCCGG - Intronic
964792321 3:160463726-160463748 AAGTGGGGCGGGTGGAAAGGAGG + Intronic
964807595 3:160628573-160628595 CAGTGAGGCTACAGGAAAACAGG + Intergenic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
965707379 3:171522631-171522653 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
965798403 3:172466053-172466075 CAGGGGGGCTTGAATAAAGCAGG - Intergenic
966386170 3:179401038-179401060 AAGTGGGGGTGGAGGAAAAAAGG - Exonic
966973332 3:185065262-185065284 CCCTGGGGCTGGAGCAAGGCAGG - Intergenic
967745215 3:193047479-193047501 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
969444780 4:7238608-7238630 CAGTGGGGATGGTGGAAGCCAGG + Intronic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
969982566 4:11173225-11173247 CAGTGTGGCTGGAATAAAGCAGG + Intergenic
970088486 4:12374901-12374923 CAGTGGGGCTAGAATAAAGGAGG - Intergenic
970168985 4:13269975-13269997 CAGTGGGGGAGGAGAAAAGGAGG - Intergenic
970213091 4:13731244-13731266 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
970386315 4:15560411-15560433 CAGTTGGGCTGGAGGACTGGGGG + Intronic
970636975 4:18021177-18021199 CAGGGCGGCCGGAGGAAGGCGGG - Intronic
971126759 4:23762883-23762905 CAGTGTGGCTAGAATAAAGCAGG + Intronic
971664117 4:29459750-29459772 CAGTGTGGCTAGAAGAAAGCAGG + Intergenic
971935604 4:33143482-33143504 CAGTAGGGCTAGAATAAAGCAGG - Intergenic
972296623 4:37745479-37745501 CAGTGGGGCTGGTGGGCAACTGG - Intergenic
973590612 4:52437060-52437082 GACTGGGGCTGGAGGAAAAGTGG + Intergenic
973666600 4:53165571-53165593 CAGTGTGGCTGGAGCAAACAAGG - Intronic
973816499 4:54624360-54624382 CAGTGGAGCTGGGGAACAGCTGG + Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974349382 4:60724679-60724701 AATGGGGGCTGGGGGAAAGCAGG - Intergenic
974588607 4:63915720-63915742 CAGTGCGGCTAGAATAAAGCAGG + Intergenic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
975099905 4:70501043-70501065 CAGTGGGGCTAGAATAAAGCAGG - Intergenic
975114923 4:70669871-70669893 CAGTGAGACAGGAGGAAAACAGG - Intronic
976028380 4:80720038-80720060 CAGTGAGGATGGAGGAAACCAGG + Intronic
976050357 4:81004677-81004699 CAATGGGCCTGGAGGAAATGAGG + Intergenic
977155669 4:93569707-93569729 CAGTGCGGCTGAAGGAAAATGGG - Intronic
977679642 4:99784960-99784982 TAGTGTGGCTGGAGCAGAGCAGG - Intergenic
979889058 4:126066382-126066404 CAGTGGGGCTAGAACAAAGCCGG - Intergenic
980933922 4:139208183-139208205 CAGCGCGGCTAGAGCAAAGCAGG - Intergenic
981334198 4:143550573-143550595 CAGTGGGGGTGGGGGAAAGTGGG - Intronic
981619137 4:146673885-146673907 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
981756657 4:148147210-148147232 CACTGGAGATGGAGGAAAGGTGG - Intronic
982284758 4:153723919-153723941 CACTGGGGCTGGGGGAAAAGGGG - Intronic
982645208 4:158015507-158015529 CAGTAGGGCTGGAAAAAGGCTGG + Intergenic
983844076 4:172494806-172494828 CAGTGCGGCTAGAATAAAGCAGG - Intronic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986013922 5:3740924-3740946 CAGTGAGGTGTGAGGAAAGCCGG - Intergenic
986287715 5:6372328-6372350 CCGAGGGGCTGGAGGAGAGGCGG - Exonic
986926071 5:12753645-12753667 CAGTGCGGCTGGAACAAAGCAGG - Intergenic
987230514 5:15889086-15889108 AAGTGGGGCGGGGGGAAAGAAGG + Intronic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988580278 5:32462784-32462806 CAGGGCAGCTGGAGTAAAGCAGG - Intergenic
992167294 5:74067275-74067297 CACTGGGGCTAGAGGAGTGCTGG + Intergenic
993069393 5:83140438-83140460 CAGTGCGGCTAGAACAAAGCAGG - Intronic
994858459 5:105156935-105156957 CAGGGAAGGTGGAGGAAAGCAGG - Intergenic
995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG + Intergenic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996909168 5:128635706-128635728 CAGTGCGGCTAGAAGAAAGCAGG - Intronic
997033574 5:130160330-130160352 TAGTGGGCAAGGAGGAAAGCAGG - Intronic
997567270 5:134898047-134898069 CAGTGGTGCTGAAGGGAGGCTGG - Intronic
998369868 5:141654030-141654052 CAGTGGGGCTGGGGGATTGGGGG + Exonic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
1000694348 5:164361266-164361288 AAGTGGGGCTGGAAGAAAAGGGG + Intergenic
1000753573 5:165128438-165128460 CAGTGGGGCTGAGAGAGAGCAGG + Intergenic
1000922978 5:167160372-167160394 CAGTGAGGCTGGAGCACAGCAGG - Intergenic
1001247160 5:170113368-170113390 CTTCGGGGCTGAAGGAAAGCAGG - Intergenic
1001930297 5:175668169-175668191 CTGGGGAGCTGGAGGAAGGCAGG + Intronic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002856829 6:1045317-1045339 CATAGGGGCTGGAGGAAAATGGG + Intergenic
1003153423 6:3571641-3571663 CAGTAGGGCTGGAGCAAGGCTGG + Intergenic
1003249443 6:4413126-4413148 CAGCTGGGGTGGGGGAAAGCCGG + Intergenic
1003682399 6:8269040-8269062 CAGTGGTGATGGAGAAAACCAGG + Intergenic
1003874446 6:10423640-10423662 GAGGGGGGATGGAGGAAAGGGGG + Intergenic
1004203796 6:13573782-13573804 AAGTGGTGCTGGTGGCAAGCCGG + Intergenic
1004251227 6:14024640-14024662 GAGTGGGGCTTGGGGAAAGTAGG + Intergenic
1004383152 6:15149571-15149593 CAGAGGGACAGGAGGAAAGAGGG + Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004585376 6:16994646-16994668 GAGTGGGTCAGGAGGTAAGCAGG + Intergenic
1004692542 6:18004772-18004794 CAGTGAGGCTGGAGGGAGCCAGG - Intergenic
1005562042 6:27050313-27050335 CAGGGCGGTTGGAGGAGAGCCGG + Intergenic
1005582189 6:27245974-27245996 GAGTGGGGAGGGAGGAAGGCAGG - Intergenic
1006448710 6:34093608-34093630 CTGTGTGGCTGGAGCAGAGCAGG + Intronic
1006452739 6:34114554-34114576 GAGAGGGGCTGGAGGAAATTGGG - Intronic
1006776203 6:36594403-36594425 GTGTTGGGCCGGAGGAAAGCGGG + Exonic
1006794855 6:36725478-36725500 CAGAGGGGCAGAAGGAATGCTGG - Intronic
1007192190 6:40028915-40028937 CAGTGAGGGTGGAGAAAAGTAGG + Intergenic
1007433826 6:41793614-41793636 CTGAGGGGCTGGATCAAAGCTGG + Exonic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1007958202 6:45935990-45936012 CAGGGAGGATGGAGGAAATCGGG - Intronic
1008206425 6:48664687-48664709 CTGTGGGGGTGGGGAAAAGCTGG + Intergenic
1008437226 6:51490528-51490550 AAGTGGGGCTTGGGGGAAGCTGG - Intergenic
1010598729 6:77797745-77797767 CAGTGTGGCTAGAACAAAGCAGG - Intronic
1010981455 6:82374848-82374870 CAGTGGGCCTGGAAGAAGGGTGG + Intergenic
1011380826 6:86740518-86740540 CAATGTGGCTGGAACAAAGCAGG - Intergenic
1011704349 6:89985952-89985974 GTGTGGGGCTGGAGGGATGCGGG + Intronic
1012143790 6:95656141-95656163 AAGTGGGGATGGAGAAAAGGTGG - Intergenic
1013004567 6:106060224-106060246 CAGTGAGGAAGGAGGAAAACAGG + Intergenic
1013176385 6:107680837-107680859 CAGTCACGCTGGAGGACAGCTGG + Intergenic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1013633018 6:112003185-112003207 CTGTGGGGCAGGTGGTAAGCTGG + Intergenic
1014707288 6:124763122-124763144 AAATGGGGTTGGGGGAAAGCAGG + Intronic
1014781824 6:125573593-125573615 CGGTGGTGCTTGAGGAAAGGGGG - Intergenic
1015612959 6:135045505-135045527 CAGTGGTGCTGGAATGAAGCAGG + Intronic
1016151169 6:140744938-140744960 CAGTGTGGCTAGAATAAAGCTGG - Intergenic
1017010263 6:150058493-150058515 CAGCGGGGCTAGAGGAGAGCAGG - Intergenic
1017424409 6:154305731-154305753 CAGTGGAGCTGGAATAAAGCAGG + Intronic
1018098835 6:160418191-160418213 CAGTGTGGCTTGAACAAAGCAGG + Intronic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1020010628 7:4804004-4804026 CAGTGGGGCTGGAGGGTTCCTGG - Intronic
1021108346 7:16665577-16665599 CAGTGAGGCTGGGGGAAACAGGG - Intronic
1021401285 7:20212540-20212562 GAGTGGGGCAGGAGGAAAAGCGG + Intronic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022515871 7:30974690-30974712 CTGTGGGGCTGGGGGAAGGTGGG + Intronic
1022537931 7:31109528-31109550 AAGTGGGGCTGGGGAGAAGCAGG + Exonic
1022940404 7:35231514-35231536 CAGTGAGCCTGGAGGAATCCCGG + Exonic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023942541 7:44779142-44779164 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1024744573 7:52391262-52391284 CAGTGCAGCTGGAATAAAGCAGG + Intergenic
1025911519 7:65832506-65832528 CAGTGGAGCAGAAGGAAAGAGGG + Intergenic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1027807859 7:82852392-82852414 CAGTGTGGCTAGAATAAAGCAGG + Intronic
1028932036 7:96423988-96424010 AAGCAGGGCTGGAGGAAAGGAGG - Intergenic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1031185487 7:118474630-118474652 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1031380790 7:121083604-121083626 CACAGGTGCTGGAGGATAGCAGG + Intronic
1031919143 7:127588627-127588649 GAGCGGGGCTGGAGGGACGCGGG - Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1033985365 7:147219538-147219560 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1034083051 7:148298471-148298493 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1034316945 7:150141996-150142018 GGCTGGGGCTGGAGGACAGCAGG - Intergenic
1034433920 7:151054149-151054171 CAGTGGGACTACAGGAAGGCAGG - Intronic
1034445784 7:151113571-151113593 GACTGGGGGTGGAGGAAAGTGGG + Intronic
1034785158 7:153919368-153919390 CAGAGGGCCTGAAGGAAAGCTGG + Intronic
1034789919 7:153958690-153958712 GGCTGGGGCTGGAGGACAGCAGG + Intronic
1034972230 7:155426549-155426571 AAGTGCAGCTGGAGGAGAGCAGG + Intergenic
1035314301 7:157988642-157988664 CAGGGGGGCTGGAGGGAACCGGG + Intronic
1035332588 7:158105981-158106003 CAGTGGAGCTGGATGAAGGAGGG - Intronic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036756754 8:11476298-11476320 GACTGGGGATGGGGGAAAGCCGG - Intergenic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1037604045 8:20422588-20422610 AACTGGGGCTGGAGGAAATGGGG - Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1038602267 8:28957406-28957428 GAGTGGGGAAGGAGGAAATCGGG + Intronic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039592003 8:38757232-38757254 CGGTGGGGCGGGAGGAAGGGTGG - Intronic
1040449228 8:47527296-47527318 CAGGAAGGCTGGAGGAAATCTGG - Intronic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1040900699 8:52414511-52414533 CAATGAGGCGAGAGGAAAGCGGG + Intronic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1041713337 8:60912281-60912303 AAGTGGGGAGTGAGGAAAGCAGG + Intergenic
1041719237 8:60961415-60961437 CCGTGGGGCCTGAGGACAGCTGG - Intergenic
1042187366 8:66150523-66150545 GAGTTGGGTGGGAGGAAAGCGGG + Intronic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043005394 8:74811875-74811897 CAGTGGGGCTGGACATATGCTGG + Intronic
1043951111 8:86310112-86310134 CAGTGGTGCTAGAACAAAGCAGG + Intronic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044800418 8:95948291-95948313 GAGTTGGGCAGGAGGGAAGCAGG - Intergenic
1045414540 8:101952976-101952998 CCGTGGGGATGAAGGAAAGGAGG - Intronic
1045485404 8:102627529-102627551 CAGCTGTCCTGGAGGAAAGCGGG + Intergenic
1047778391 8:128092159-128092181 CAGGGGGGCTGGCTGACAGCAGG - Intergenic
1048306742 8:133289802-133289824 CAGTGGGGCAGCAGGAACGCTGG + Intronic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1048856752 8:138693041-138693063 CTGTGGAGCTGGCGGAAGGCAGG - Intronic
1049292221 8:141810255-141810277 CAGTGGTGGTGGAGGCAAGGCGG + Intergenic
1049476740 8:142800387-142800409 CAGTGGGGCTGGAGACAGGGGGG - Intergenic
1049955468 9:688916-688938 CAGTGGGAAAGAAGGAAAGCAGG - Intronic
1050098844 9:2096936-2096958 CATTGGGGCAGGAAGAAAGAAGG + Intronic
1050495012 9:6231349-6231371 TAGTGTGGCTGGAGCAGAGCGGG - Intronic
1050504175 9:6330013-6330035 CTGAGGGGCTGGAGGAAAACAGG + Exonic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052560403 9:30077450-30077472 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1052977712 9:34423756-34423778 CAGTGGGGTTGGAAAAAAGGAGG + Intronic
1054906588 9:70418915-70418937 AAGTGGGGCGGGAGCAAAGTAGG - Intergenic
1056258417 9:84823997-84824019 CAGTGGGGGAGGAGCTAAGCAGG + Intronic
1056526541 9:87447833-87447855 CAGGGAGGTTGGAGGAATGCAGG - Intergenic
1056804796 9:89720184-89720206 CAAGGGAGCAGGAGGAAAGCAGG + Intergenic
1056942942 9:90970866-90970888 CAATGGGGCTGGAAGGAGGCTGG - Intergenic
1057211903 9:93205099-93205121 CAGAATGGATGGAGGAAAGCAGG - Intronic
1057669502 9:97076232-97076254 CTGTGGGTCTGGAGGAACCCGGG + Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057818269 9:98311679-98311701 CAGTGGGGCTGTGGGCAAGAGGG - Intronic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1058190784 9:101912299-101912321 CAGGGAGGGTGGAGGAAGGCTGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059227140 9:112682553-112682575 CACAGAGGCAGGAGGAAAGCAGG - Intergenic
1059819450 9:117956069-117956091 CAGTGGGGCAGGAGAATAGGGGG + Intergenic
1059953870 9:119495903-119495925 CAGTGAGGCTGGGGGAGAGAGGG + Intronic
1060521642 9:124297457-124297479 CAGTGAGGCTGGCGGGGAGCTGG - Intronic
1060536715 9:124395561-124395583 CAGTGTGGCTGCATGAAAACTGG - Intronic
1061327663 9:129874060-129874082 CAGAGTGGCGGGAGGAGAGCTGG + Intronic
1061393203 9:130329154-130329176 CAGTGGGGCTGGAGCAGAAATGG - Intronic
1061396467 9:130346463-130346485 CGGTGGGGCTGGAGGCAGGGGGG + Intronic
1061930309 9:133828980-133829002 GAGTGGGGCTGGCGGAGTGCTGG - Intronic
1062184139 9:135207650-135207672 CAGCGTGGCTGGAACAAAGCAGG + Intergenic
1062243172 9:135550476-135550498 CACTGGGGCTGCAGGGATGCGGG + Intergenic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1062709952 9:137969863-137969885 CAGTAGGGCAGGAGGGAGGCAGG - Intronic
1185885000 X:3774598-3774620 AAGTGGGGATGGATGAAACCAGG + Intergenic
1187179670 X:16932016-16932038 CAGTGGTGGGGGAGGACAGCAGG + Intergenic
1187305233 X:18089392-18089414 CAGAGGAGCTGGAGGAATGAGGG - Intergenic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187654883 X:21460674-21460696 CAGTGGGGGTGGAGGAGAAGTGG - Intronic
1187704564 X:21996918-21996940 CAGCGGGGCTAGAGGAAGGCTGG + Intergenic
1187927617 X:24264327-24264349 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1188012589 X:25073592-25073614 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1188240766 X:27786630-27786652 CAGTAGAGCAGGAGGAAAGAAGG - Intergenic
1189103992 X:38218979-38219001 CAGTGGAGGTGGTGGCAAGCAGG + Intronic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1189244671 X:39554336-39554358 TAGTGTGGCTGGAGCAGAGCGGG + Intergenic
1189322831 X:40096932-40096954 CGGTGGGCCAGGAGGAGAGCAGG - Intronic
1192156021 X:68747197-68747219 TAAGGGCGCTGGAGGAAAGCTGG + Intergenic
1192569255 X:72189343-72189365 AGGTGGGGCAGGAGGGAAGCGGG - Intronic
1194016200 X:88624640-88624662 CAGTGTGGCTAGAGGAGTGCAGG + Intergenic
1194023317 X:88721200-88721222 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1194895630 X:99435893-99435915 CAGAGCGGCTGGAGTAAAACAGG + Intergenic
1195399467 X:104446264-104446286 CAAAGGGGCTGAAGGAAAGAGGG + Intergenic
1195791426 X:108591867-108591889 CAGTGGGGTTGGAGTATTGCTGG - Intronic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1198204241 X:134451399-134451421 CCCTAGGCCTGGAGGAAAGCGGG + Intergenic
1198279405 X:135126854-135126876 GAGTGGGGCTGGGGTCAAGCAGG + Intergenic
1198291551 X:135245660-135245682 GAGTGGGGCTGGGGTCAAGCAGG - Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1199160155 X:144599768-144599790 CTGTGGGGCTAGAGTAAAACAGG - Intergenic
1199433763 X:147789671-147789693 GAGTGGGGCTGGACAGAAGCAGG - Intergenic