ID: 934954519

View in Genome Browser
Species Human (GRCh38)
Location 2:98606506-98606528
Sequence CTGTAGGCAGAGATTATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934954519_934954523 11 Left 934954519 2:98606506-98606528 CCAACCATAATCTCTGCCTACAG 0: 1
1: 0
2: 0
3: 25
4: 261
Right 934954523 2:98606540-98606562 AACAGCTCCGCTTTCTATACTGG 0: 1
1: 0
2: 0
3: 1
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934954519 Original CRISPR CTGTAGGCAGAGATTATGGT TGG (reversed) Intronic
900951359 1:5859859-5859881 CTGTGGGCAGACAGTAGGGTGGG - Intergenic
901408914 1:9069372-9069394 GTGTTGGGAGGGATTATGGTGGG - Intronic
903194621 1:21675985-21676007 CTGTAGGCAGAAATACTGGCTGG - Intergenic
903200369 1:21732203-21732225 CAGAAGGCGGAGATTGTGGTGGG + Intronic
903259465 1:22123464-22123486 CTGAAGGAAGAGATTCTGGAAGG + Intronic
903482788 1:23666577-23666599 CAGGAGGCAGAGGTTGTGGTGGG - Intergenic
904182961 1:28679877-28679899 CGGGAGGCAGAGGTTGTGGTGGG - Intronic
904671678 1:32170885-32170907 CTGGAGGCAGATATTATAGCTGG - Exonic
905301621 1:36989772-36989794 CTTCAGGCTGAGATTGTGGTTGG - Intronic
905870930 1:41404304-41404326 CTGTAGGCAGGGATCCTGGTTGG - Intergenic
907142202 1:52198063-52198085 CTATAGGCAGAGATTTTCTTTGG + Intronic
907591053 1:55671628-55671650 TTGCAGAAAGAGATTATGGTAGG + Intergenic
908516328 1:64896487-64896509 GTGGAGGCAAATATTATGGTAGG + Intronic
911165630 1:94722180-94722202 CTGTAGGCAGAGACAAAGGAAGG + Intergenic
911725481 1:101237410-101237432 CTATAGACAAAGAATATGGTGGG + Intronic
912371893 1:109179991-109180013 CTGGAGGCAGAGGCTGTGGTAGG + Intronic
912510718 1:110188551-110188573 CTGCAGGCAGGTTTTATGGTCGG - Intronic
913511066 1:119563018-119563040 AGGTAGGGAGAGATAATGGTTGG - Intergenic
915430403 1:155861690-155861712 CAGGAGGCAGAGGTTGTGGTGGG - Intronic
915519617 1:156434303-156434325 CTGTATGCACAGACTATGCTGGG - Intergenic
915557442 1:156668476-156668498 CTGTGGGCAGAGATGATGATGGG + Intergenic
915579977 1:156807758-156807780 CTATAGGCAGAGATACTGGCGGG + Intronic
916782601 1:168051952-168051974 CTGGAGGCAGAGGTTGTAGTGGG - Intronic
917526498 1:175792770-175792792 ATGTAGGCAGAGGTGCTGGTTGG + Intergenic
917832797 1:178911561-178911583 CTGTAGTCTGAGGCTATGGTTGG + Intronic
919409112 1:197221952-197221974 CTGTGAGCAAAGATTTTGGTTGG - Intergenic
919519180 1:198566280-198566302 CAGGAGGCAGAGGTTGTGGTGGG - Intergenic
921440415 1:215179710-215179732 CTGTAGTCTGAGAGTATGGTTGG + Intronic
922205611 1:223443523-223443545 CTGTGGGCAGAGGGTATGGATGG + Intergenic
923152298 1:231244259-231244281 CTGTAGGAAGAGAATCAGGTTGG + Intronic
1066091425 10:32025001-32025023 CAGGAGGCGGAGGTTATGGTGGG + Intronic
1066144196 10:32539862-32539884 CTGTAGTCTGAGAGTGTGGTTGG + Intronic
1066475746 10:35746055-35746077 CTGTAGGCAGATATTATCTGAGG - Intergenic
1067175079 10:43940021-43940043 GTGGAGGCAGAGATTACTGTGGG + Intergenic
1067656499 10:48196098-48196120 CTGCAGGCAGAGGGTATGCTGGG + Intronic
1068488322 10:57688416-57688438 CTGTGGGCAGATTTTATGGCAGG + Intergenic
1068610269 10:59052115-59052137 CTGTGGTCTGAGAGTATGGTTGG + Intergenic
1069166173 10:65162726-65162748 CTGAAGGCTCAGATTATTGTTGG + Intergenic
1069580598 10:69563543-69563565 CAGGAGGCAGAGATCATGGTGGG - Intergenic
1070896933 10:79992340-79992362 CTGTGGTCTGAGAGTATGGTTGG + Intergenic
1071599399 10:86950264-86950286 CGGGAGGCAGAGGTTGTGGTGGG + Intronic
1071894272 10:90048436-90048458 CTGTATTCTGAGAATATGGTTGG + Intergenic
1072019953 10:91388767-91388789 CTGTGGTCTGAGAGTATGGTTGG + Intergenic
1072063772 10:91844574-91844596 ATGAAGGCAGAGACTTTGGTAGG + Intronic
1072512905 10:96147027-96147049 CTGTAAGCAGAGAATCTGGCAGG + Intronic
1076045891 10:127293901-127293923 CTGGAGGCAGAGAGTTGGGTGGG - Intronic
1081064715 11:38526570-38526592 CTGGAGGCTGAGAATATGATAGG - Intergenic
1082244562 11:49906307-49906329 CAGGAGGCAGAGGTTGTGGTGGG - Intergenic
1082565712 11:54675753-54675775 CAGGAGGCAGAGGTTGTGGTGGG + Intergenic
1082938454 11:58678572-58678594 CTGTAGTCTGAGAGTATAGTTGG + Intronic
1085115734 11:73929980-73930002 CGGGAGGCAGAGGTTGTGGTGGG + Intergenic
1085888323 11:80547082-80547104 CTGTGGTCTGAGAATATGGTTGG - Intergenic
1087990442 11:104741732-104741754 CTGTAGGGAGAGGTGCTGGTAGG + Intergenic
1088659948 11:112035560-112035582 CAGGAGGCAGAGGTTGTGGTGGG - Intronic
1090573886 11:128079014-128079036 CTGTGCTCAGATATTATGGTTGG - Intergenic
1090606624 11:128428732-128428754 TTGAAGGCAGAGAATATGGATGG - Intergenic
1091031538 11:132193296-132193318 CTGTGGTCTGAGAGTATGGTTGG - Intronic
1091690273 12:2591500-2591522 CTGGAGGCAGAGGTTCTGCTGGG + Intronic
1092199647 12:6572350-6572372 CAGGAGGCAGAGGTTGTGGTGGG + Intronic
1092512961 12:9177070-9177092 CAGGAGGCAGAGATTATTGTGGG - Intronic
1092808873 12:12253188-12253210 CAGAAGGCAGAGGTTGTGGTGGG + Intronic
1093497729 12:19776993-19777015 CTGTGGTCTGAGATTGTGGTTGG + Intergenic
1093599371 12:21002833-21002855 CTGTGGGGAAAGTTTATGGTTGG - Intergenic
1093827970 12:23718396-23718418 CTGTATGCAAAGATTAAGATAGG - Intronic
1095625950 12:44315598-44315620 CTGTGGTCAGAGCATATGGTGGG + Intronic
1097102488 12:56599411-56599433 ATTTAGGCAGAGATTGTAGTAGG - Intronic
1098367029 12:69714463-69714485 AGGCAGGCAGAGATTATAGTTGG + Intergenic
1098677788 12:73313178-73313200 TTGTGGTCAGAGAATATGGTTGG + Intergenic
1100148436 12:91706359-91706381 CTATAGACACAGCTTATGGTTGG + Intergenic
1100926696 12:99556793-99556815 CTGTGGTCAGAGAGTATGGTTGG + Intronic
1103038089 12:117672696-117672718 CTGGAGGCAGAGGTTGTGGTGGG - Intronic
1103533256 12:121617262-121617284 CGGGAGGCAGAGGTTATAGTGGG + Intergenic
1104207377 12:126652502-126652524 CTATAGGGAGAGATGGTGGTGGG + Intergenic
1104321876 12:127759274-127759296 CTGGAGGCAGGTATTATGGTTGG - Intergenic
1104492377 12:129205811-129205833 CTGTGGTCTGAGAGTATGGTTGG - Intronic
1104719735 12:131038652-131038674 CTGGAGGCAGAGGTGATGGAGGG + Intronic
1106526581 13:30546187-30546209 CGGGAGGCAGAGATTACAGTGGG - Intronic
1107155333 13:37159938-37159960 CTGTATTCTGAGAGTATGGTTGG + Intergenic
1108090779 13:46847443-46847465 CTGTTGGCAGATAAGATGGTAGG + Intronic
1108698380 13:52923012-52923034 CTGTAGGGAGAGATTATTCCTGG + Intergenic
1109003123 13:56833196-56833218 CAGAATGCAAAGATTATGGTTGG - Intergenic
1109308849 13:60669134-60669156 CTGTGGCCTGAGAGTATGGTAGG + Intergenic
1109920667 13:69053631-69053653 CTGTGGTCTGAGATGATGGTTGG - Intergenic
1110498318 13:76195364-76195386 CTGTGGTCTGAGAGTATGGTTGG + Intergenic
1111080279 13:83297088-83297110 CTGTTGTCTGAGACTATGGTTGG + Intergenic
1116283997 14:42948396-42948418 CTGTAGTCTGAGAATATGCTTGG - Intergenic
1116360585 14:43991605-43991627 CTGTAGTCACAGAGTGTGGTAGG + Intergenic
1116522003 14:45860694-45860716 CTGTAGTCTGAGAGTGTGGTTGG + Intergenic
1116746054 14:48820626-48820648 CTGTAGTCTGAGAGTGTGGTTGG - Intergenic
1117020246 14:51563042-51563064 CTGTAGGCAGAGAGCACAGTAGG + Intronic
1117404217 14:55386117-55386139 CTGTTTGCAGAGATAATTGTTGG - Intronic
1117506274 14:56406207-56406229 CTGTAGTCTGAGGGTATGGTTGG - Intergenic
1117889944 14:60409417-60409439 CTGTGGTCTGAGAGTATGGTTGG + Intronic
1118728088 14:68644595-68644617 CTTTAGGCAGAGATTCAGGAAGG - Intronic
1119546975 14:75479173-75479195 CTGAAGGCAGGGATTTTGTTGGG - Intergenic
1119578339 14:75750184-75750206 CTGTAGGCACAGGTTATGAGAGG + Intronic
1123448962 15:20348775-20348797 CTGTTTGCAGAGATTTTTGTTGG + Intergenic
1124898198 15:33797215-33797237 CTGTAGGCAGAGAAGAAGGTTGG - Intronic
1124984367 15:34591831-34591853 CAGGAGGCAGAGGTTGTGGTGGG - Intergenic
1125611864 15:40976786-40976808 CTGTAGGCAGGGATTCTGTGAGG + Intergenic
1125625792 15:41108024-41108046 CGGGAGGCAGAGGTTGTGGTGGG + Intronic
1126555299 15:49980853-49980875 CTGTATACATAGCTTATGGTGGG - Intronic
1127845087 15:62863044-62863066 CTGTAGTCCGAGAGTGTGGTTGG - Intergenic
1127892291 15:63264583-63264605 TTGTAGACAGGGATTATGGTAGG - Exonic
1128035086 15:64517851-64517873 CAGGAGGCAGAGGTTATAGTGGG - Intronic
1128745489 15:70111424-70111446 CTGTAGGCCCAGTTCATGGTGGG - Intergenic
1132522905 16:399604-399626 CTGCAGCGAGAGATAATGGTTGG - Intronic
1132757180 16:1491371-1491393 CTGCAGGCAGAGCTGATGGATGG - Intergenic
1136911678 16:34149189-34149211 CGGGAGGCAGAGGTTGTGGTGGG - Intergenic
1136924089 16:34355285-34355307 CAGGAGGCAGAGGTTGTGGTGGG + Intergenic
1136980484 16:35056521-35056543 CAGGAGGCAGAGGTTGTGGTGGG - Intergenic
1138348877 16:56335913-56335935 CTGCAGGCAGAGATTAGTGTGGG - Intronic
1138864960 16:60806403-60806425 TTGTAGTCAGAGAAGATGGTTGG - Intergenic
1147495515 17:40911711-40911733 CTGCAGGTAGGGATCATGGTGGG - Intergenic
1149360505 17:55890054-55890076 CTGTGGGCGGTTATTATGGTAGG + Intergenic
1149368348 17:55967893-55967915 CGGGAGGCAGAGGTTGTGGTGGG - Intergenic
1150842630 17:68623048-68623070 CTGGAGGCAGAGAGTATGGGTGG - Intergenic
1150885192 17:69077354-69077376 CTGTGGTCTGAGAGTATGGTTGG + Intergenic
1150975987 17:70087631-70087653 CGGGAGGCAGAGGTTGTGGTGGG + Intronic
1151107314 17:71631368-71631390 GTGTAGGCAGAGTTTGTGGATGG - Intergenic
1152339689 17:79717089-79717111 CTGTTTGCAGAGATTTTTGTTGG - Intergenic
1154305076 18:13224551-13224573 CTGGAGGCAGAGCTTACAGTGGG - Intronic
1156074713 18:33259826-33259848 TTGTATGCAGACATTATGGTAGG - Intronic
1156890025 18:42180016-42180038 ATGTAGGCTGAGATCATGGAGGG - Intergenic
1159709752 18:71742239-71742261 CTGTAGTACAAGATTATGGTTGG - Intronic
1159710646 18:71754663-71754685 CTGTAGACTGAGAGTGTGGTTGG - Intronic
1160440514 18:78886720-78886742 CTGTGGTCTGAGAGTATGGTTGG - Intergenic
1161476113 19:4486449-4486471 CGGGAGGCGGAGGTTATGGTGGG + Intronic
1161697530 19:5777799-5777821 CGGGAGGCAGAGATTGTAGTGGG + Intronic
1161765100 19:6203159-6203181 CTGTTGTCTGAGATTATGGTAGG + Intergenic
1162251627 19:9449288-9449310 CTGTGGTCTGAGAGTATGGTTGG - Intergenic
1163161087 19:15464446-15464468 CTGGAGGCAGAGCTGAGGGTGGG - Intronic
1164947670 19:32310114-32310136 GTGAAGGCAGCGCTTATGGTCGG - Intergenic
1165682076 19:37786084-37786106 CTGCAGGCAGAGATGATCTTAGG - Intronic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1168015305 19:53568169-53568191 CGGGAGGCAGAGGTTGTGGTAGG + Intronic
925052489 2:828001-828023 CTGCAGCCAGACATCATGGTTGG - Intergenic
927220540 2:20704134-20704156 CTCTAGACAGAGAATAGGGTAGG + Intronic
928362194 2:30673666-30673688 TTGTGGCCAGAGAATATGGTTGG - Intergenic
929016105 2:37497040-37497062 CTGTAGGCTGAGGATATGCTTGG + Intergenic
930628106 2:53721176-53721198 CTGTGGTCTGAGAGTATGGTTGG - Intronic
932470914 2:71956036-71956058 CTGTGGTCTGAGATTATGGTTGG - Intergenic
933693148 2:85195154-85195176 ATGTAGGCAGAGAAAAGGGTAGG - Intronic
934954519 2:98606506-98606528 CTGTAGGCAGAGATTATGGTTGG - Intronic
935665736 2:105510432-105510454 CGGGAGGCAGAGATTGCGGTGGG + Intergenic
939767470 2:146269003-146269025 TTGAAGGCTGGGATTATGGTGGG + Intergenic
944571586 2:201050516-201050538 CAGTAGGCAGAGGTTACAGTGGG + Intronic
946274876 2:218623754-218623776 CGGGAGGCAGAGGTTGTGGTGGG - Intronic
947253502 2:228135198-228135220 CAGGAGGCAGAGGTTGTGGTGGG + Intronic
948070236 2:235114971-235114993 TGGGAGGCAGAGATTGTGGTGGG + Intergenic
948280280 2:236741665-236741687 CTGTTGGTAGAGATTATATTAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1170163880 20:13343179-13343201 CTGTGGGCAGAGAGAATTGTAGG - Intergenic
1171222268 20:23409758-23409780 CTGTAGGCACGGATTATGGGTGG - Intronic
1171907002 20:30907523-30907545 CGGGAGGCAGAGGTTGTGGTGGG - Intergenic
1176256101 20:64154067-64154089 CTCTAGGCAGAGCTCCTGGTCGG + Intronic
1177393416 21:20504652-20504674 CTGTAGTCTGAGAGTATGCTTGG + Intergenic
1180340412 22:11613523-11613545 CGGGAGGCAGAGGTTGTGGTGGG - Intergenic
1180680507 22:17622890-17622912 CTGGAGGCGGAGGTTGTGGTAGG + Intronic
1181911421 22:26241329-26241351 CTGGAGGCAGAGCTGAGGGTAGG - Intronic
1182066266 22:27433825-27433847 CTGTTGGCAGAGGTCATGGGTGG - Intergenic
1182744975 22:32598557-32598579 CAGGAGGCAGAGATTACAGTGGG - Intronic
1182890753 22:33816952-33816974 CTGTAGGGGCAGATTGTGGTGGG - Intronic
1183895975 22:40969236-40969258 CAGGAGGCGGAGATTGTGGTGGG + Intronic
950798453 3:15530379-15530401 CTGAAGGTGGAGATGATGGTTGG + Intergenic
951401288 3:22234538-22234560 CTATAGGCTAAGATTATGGTGGG - Intronic
951800542 3:26590814-26590836 CAGAAGGCAGAGATTACTGTGGG - Intergenic
953784385 3:45899705-45899727 CTGTGGGCAGAGGTTTTGGAAGG + Intronic
954027734 3:47796282-47796304 CAGGAGGCAGAGGTTGTGGTGGG + Intergenic
954380019 3:50214379-50214401 CTGTAGGCACAGGTCAGGGTGGG - Intronic
958436277 3:94099677-94099699 CTATAGGCAGAGAAAATGATCGG + Intronic
959654386 3:108784574-108784596 CTGTAGTCTGAGAGTATGGTTGG - Intergenic
961099227 3:124184535-124184557 CAGTAGGGAGAGAATATGATAGG - Intronic
962893416 3:139692756-139692778 CTGTACCCAGAGAAAATGGTTGG - Intergenic
963823191 3:149922319-149922341 CGTTAGGCATAGTTTATGGTAGG - Intronic
966833406 3:184030495-184030517 CGGGAGGCAGAGGTTGTGGTGGG + Intergenic
967218744 3:187231578-187231600 CTGTATGTAGATATCATGGTTGG - Intronic
967560902 3:190918712-190918734 CTGTAGTCTGAGAGTATGCTTGG + Intergenic
969361928 4:6669985-6670007 CAGTGGGCACAGATGATGGTAGG - Intergenic
969486177 4:7473654-7473676 CTGGAGGCAGTGATGATGGCTGG + Intronic
969852620 4:9972588-9972610 CTGTGGTCTGAGAGTATGGTTGG - Intronic
970671115 4:18397779-18397801 CCGTAGGCAGGGTTAATGGTTGG - Intergenic
972015200 4:34234846-34234868 CTGCAGCCAGGGATTATGATAGG - Intergenic
972824348 4:42739223-42739245 CTGTAGTCTGAGAGTATGGTTGG - Intergenic
973963400 4:56134679-56134701 CTGTGGGCAGAGGTTATTATAGG + Intergenic
974622969 4:64384906-64384928 CTGCAGGCATAGGCTATGGTGGG + Intronic
975041140 4:69745078-69745100 CTGTGGCCCGAGAGTATGGTTGG + Intronic
975092182 4:70417050-70417072 TTTTAGGCAGAGATTTTGGATGG - Intergenic
975276094 4:72503454-72503476 CTGTGGTCTGAGATTATAGTTGG + Intronic
977332646 4:95657053-95657075 CTGTGGTCTAAGATTATGGTTGG + Intergenic
979052935 4:115957021-115957043 CTGAAGTCTGAGAGTATGGTTGG + Intergenic
979962685 4:127039304-127039326 TTGTGGTCTGAGATTATGGTTGG - Intergenic
980735115 4:136875316-136875338 AAGTAGGCAGAGATTATTGGGGG - Intergenic
981402050 4:144324506-144324528 CTGTAGTCTGAGAGTATGATTGG - Intergenic
981987723 4:150877822-150877844 CTGTGGTCTGAGAATATGGTTGG - Intronic
982160785 4:152567402-152567424 CTGTTGGGAGAGATGAGGGTAGG - Intergenic
982367105 4:154591107-154591129 CTTTATGCAGAAATTAGGGTTGG + Intergenic
983030077 4:162789419-162789441 TTGAAGGCAGAGAAAATGGTAGG + Intergenic
983302513 4:165945456-165945478 CAGAGGGCAGAGATAATGGTAGG + Intronic
987878815 5:23714426-23714448 CTGCATCCAGAGATTTTGGTAGG - Intergenic
988077112 5:26367240-26367262 CTGTAGGCACTAATTGTGGTTGG + Intergenic
988186122 5:27864691-27864713 CTGTGGTCTGAGAGTATGGTTGG - Intergenic
988219939 5:28331537-28331559 CTGTGGTCTGAGAGTATGGTTGG + Intergenic
988255657 5:28817350-28817372 ATGTAGTAAAAGATTATGGTAGG - Intergenic
988816682 5:34840970-34840992 CCGGAGGCAGAGGTTGTGGTGGG + Intronic
990946911 5:61259234-61259256 CAGGAGGCAGAGATTACAGTGGG + Intergenic
991422955 5:66460045-66460067 GTGTAGGCAGAGATTAGGGAGGG + Intergenic
991504587 5:67310954-67310976 CTGTAGTCTGAGAATGTGGTTGG - Intergenic
992542702 5:77780215-77780237 CAGGAGGCAGAGGTTGTGGTGGG + Intronic
993777974 5:92025765-92025787 CTGGAGGCAGAGATTGTTGTGGG + Intergenic
996034535 5:118743560-118743582 CTGTAGTCTGAGAGTATGCTTGG - Intergenic
997901244 5:137767128-137767150 CTGTAGTCAGAGAAGATGCTTGG - Intergenic
998277289 5:140768865-140768887 CTGGAGGAAGATATTATGCTTGG - Intergenic
999066167 5:148687689-148687711 CTGTCTGCAGAAATTATGTTGGG - Intergenic
1001466801 5:171974577-171974599 CTGTAGGCATAGGTTATGCTCGG - Intronic
1004099345 6:12592802-12592824 CTGCAGGCAGAGACCATGTTAGG - Intergenic
1004318112 6:14609486-14609508 AGGCAGGCAGAGATTGTGGTAGG - Intergenic
1004599612 6:17135350-17135372 CTGTAGTCCAAGAGTATGGTTGG - Intergenic
1005833590 6:29690532-29690554 CAGGAGGCAGAGGTTGTGGTGGG - Intergenic
1006373460 6:33659192-33659214 CTGGAGGCAGAGACCATGGCAGG - Intronic
1006489293 6:34372728-34372750 CAGGAGGCAGAGGTTGTGGTGGG + Intronic
1008412545 6:51197107-51197129 CTGTTGACAGAGATTATTTTAGG - Intergenic
1008761049 6:54851544-54851566 CGGGAGGCAGAGGTTGTGGTGGG - Intronic
1010178137 6:73053529-73053551 CTGTAGTCTGAGAGTGTGGTTGG - Intronic
1010466760 6:76176596-76176618 CTGTAGTCAAAGGGTATGGTTGG - Intergenic
1011406859 6:87024719-87024741 CTGCAGGCAGAGAATAAGGGTGG - Intergenic
1012026645 6:94002455-94002477 GTGTAAGTAGAGATTGTGGTTGG + Intergenic
1013171830 6:107643488-107643510 CAGAAGGCAGAGGTTATAGTGGG - Intronic
1013858859 6:114609356-114609378 CTGTAAGTGGAGAATATGGTGGG - Intergenic
1014080679 6:117282800-117282822 CTGCAGGCAGAGCTTTTGGCAGG - Intergenic
1014340989 6:120206547-120206569 CTGTAGACTGAGAGTGTGGTTGG - Intergenic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1019931138 7:4224073-4224095 CTGGAGGCATGGATTATGGGTGG - Intronic
1020618032 7:10484301-10484323 CTTGAGACTGAGATTATGGTGGG - Intergenic
1021733873 7:23623520-23623542 CAGAAGGCAGAGGTTGTGGTGGG + Intronic
1023877018 7:44292067-44292089 CAGAAGGCAGAGATTAGGGCTGG + Intronic
1027783994 7:82556171-82556193 CTGTGGTCTGAGACTATGGTTGG - Intergenic
1029989376 7:104949078-104949100 CAGTGAGCCGAGATTATGGTGGG + Intergenic
1030412607 7:109200808-109200830 CAGGAGGCAGAGATTGCGGTGGG - Intergenic
1031593379 7:123620341-123620363 ATGTATGCAGAGACTATGATTGG - Intronic
1032574040 7:133033691-133033713 CTTAAGGCAGAGATCATGTTGGG - Intronic
1032672101 7:134093716-134093738 CTGTAGTCTGAGAGTATGGTTGG - Intergenic
1033344073 7:140513748-140513770 CAGGAGGCTGAGATTGTGGTGGG - Intergenic
1033349313 7:140549150-140549172 CAGTAGGCAGAGGTTGTGGTGGG + Intronic
1033936011 7:146586385-146586407 CAGTAGGTAGAGATTTTGGTGGG - Intronic
1034240888 7:149609877-149609899 CTGTGGACAGAGATGCTGGTGGG - Intergenic
1036835384 8:12060383-12060405 ATGTAGTCAGAGAGTGTGGTTGG - Intergenic
1038105190 8:24425286-24425308 CTACAGACACAGATTATGGTAGG - Intergenic
1039793854 8:40896133-40896155 CTGTAGGCAGCTATTTTGGGTGG - Intronic
1040582748 8:48710641-48710663 CTGAATGCATGGATTATGGTAGG - Intergenic
1041343580 8:56871639-56871661 CTGGAGGAAGGGATTAGGGTTGG - Intergenic
1041344666 8:56884243-56884265 CAGGAGGCAGAGGTTGTGGTAGG + Intergenic
1042252113 8:66766923-66766945 CGGGAGGCAGAGATTGCGGTGGG - Intronic
1042764531 8:72306422-72306444 CTGTAGTCTGAGAATGTGGTTGG + Intergenic
1042874322 8:73427000-73427022 CGGGAGGCAGAGGTTGTGGTGGG - Intronic
1044955820 8:97478752-97478774 CTGTGGTCTGAGAGTATGGTTGG - Intergenic
1044986929 8:97764059-97764081 CAGTAGGCAGAGGTTGTAGTGGG + Intergenic
1045095546 8:98793838-98793860 CTGTGGTCTGAGAGTATGGTTGG - Intronic
1045760462 8:105600092-105600114 CAGTAGGCAAACATTGTGGTCGG - Intronic
1046251688 8:111640560-111640582 CGGTAGGCAGAGGTTGCGGTGGG + Intergenic
1048321665 8:133405037-133405059 ATGGAGGCAGAGATTAGAGTGGG - Intergenic
1049150956 8:141035200-141035222 CTGGAGGCAGAGATTGGAGTGGG + Intergenic
1050549155 9:6734366-6734388 CGGGAGGCAGAGGTTGTGGTGGG - Intronic
1050878511 9:10671668-10671690 CTGTAGTCCAAGAGTATGGTCGG + Intergenic
1052688109 9:31779322-31779344 CTGTGGTCTGAGACTATGGTTGG - Intergenic
1053144818 9:35705289-35705311 CTGTAGGCCCAGATGAGGGTCGG + Intronic
1055780419 9:79815312-79815334 CGGGAGGCGGAGGTTATGGTGGG - Intergenic
1056617659 9:88182113-88182135 CTGGAGGCGGAGGTTGTGGTGGG + Intergenic
1061302268 9:129712178-129712200 CTGTTGGCAGAGATCACGTTGGG + Intronic
1061375421 9:130221095-130221117 CAGGAGGCAGAGATTGTAGTGGG - Intronic
1062015332 9:134288335-134288357 GTCTTGGCAGAGATGATGGTGGG + Intergenic
1186217234 X:7313095-7313117 CTGTAGGCAGAGAAAAAGGGAGG - Intronic
1190059880 X:47203820-47203842 CAGGAGGCAGAGGTTGTGGTGGG - Intronic
1190657767 X:52626840-52626862 CGGTAGGCAGAGGTTGTAGTGGG - Intergenic
1190974056 X:55382214-55382236 CTGTAGTCAAAGAGTGTGGTTGG - Intergenic
1191017326 X:55823366-55823388 CTGTGGTCTGAGACTATGGTTGG + Intergenic
1192601314 X:72467459-72467481 TTGGAGGCAGAGATGATTGTGGG + Intronic
1192715785 X:73641191-73641213 CTGTGGTCTGAGATTGTGGTTGG + Intronic
1193773621 X:85618010-85618032 CTGCAGACTGAGAATATGGTTGG + Intergenic
1194197219 X:90909559-90909581 CTGCAGCAAGAGATTATGGGTGG + Intergenic
1196195109 X:112831407-112831429 CTGTAGCCAGACATTGTGCTAGG + Intronic
1196608025 X:117677674-117677696 CTTTGGTCAGAGAGTATGGTTGG - Intergenic
1197192963 X:123669391-123669413 CGGGAGGCAGAGATTGCGGTGGG - Intronic
1197293247 X:124685631-124685653 CAGGAGGCAGAGGTTGTGGTGGG - Intronic
1198577819 X:138029273-138029295 CTGTGGTCTGAGATTATGCTTGG - Intergenic
1199216783 X:145268395-145268417 CTGTAGTCTGAGAGTGTGGTTGG - Intergenic
1201125110 Y:10905886-10905908 CTGTAGGCAGAGACTAGAGAAGG - Intergenic