ID: 934954603

View in Genome Browser
Species Human (GRCh38)
Location 2:98607256-98607278
Sequence GCTGCCGTTCAGCCAGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 179}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934954603_934954609 1 Left 934954603 2:98607256-98607278 CCAGGAGCTGGCTGAACGGCAGC 0: 1
1: 0
2: 1
3: 13
4: 179
Right 934954609 2:98607280-98607302 CCAGTGAGTAAGGGGCAGAAGGG 0: 1
1: 0
2: 3
3: 31
4: 332
934954603_934954613 20 Left 934954603 2:98607256-98607278 CCAGGAGCTGGCTGAACGGCAGC 0: 1
1: 0
2: 1
3: 13
4: 179
Right 934954613 2:98607299-98607321 AGGGACACAGCCCTGGACAGGGG 0: 1
1: 0
2: 3
3: 75
4: 525
934954603_934954604 -9 Left 934954603 2:98607256-98607278 CCAGGAGCTGGCTGAACGGCAGC 0: 1
1: 0
2: 1
3: 13
4: 179
Right 934954604 2:98607270-98607292 AACGGCAGCACCAGTGAGTAAGG 0: 1
1: 0
2: 0
3: 9
4: 86
934954603_934954612 19 Left 934954603 2:98607256-98607278 CCAGGAGCTGGCTGAACGGCAGC 0: 1
1: 0
2: 1
3: 13
4: 179
Right 934954612 2:98607298-98607320 AAGGGACACAGCCCTGGACAGGG 0: 1
1: 0
2: 6
3: 49
4: 357
934954603_934954605 -8 Left 934954603 2:98607256-98607278 CCAGGAGCTGGCTGAACGGCAGC 0: 1
1: 0
2: 1
3: 13
4: 179
Right 934954605 2:98607271-98607293 ACGGCAGCACCAGTGAGTAAGGG 0: 1
1: 0
2: 2
3: 7
4: 105
934954603_934954610 13 Left 934954603 2:98607256-98607278 CCAGGAGCTGGCTGAACGGCAGC 0: 1
1: 0
2: 1
3: 13
4: 179
Right 934954610 2:98607292-98607314 GGGCAGAAGGGACACAGCCCTGG 0: 1
1: 0
2: 2
3: 50
4: 490
934954603_934954606 -7 Left 934954603 2:98607256-98607278 CCAGGAGCTGGCTGAACGGCAGC 0: 1
1: 0
2: 1
3: 13
4: 179
Right 934954606 2:98607272-98607294 CGGCAGCACCAGTGAGTAAGGGG 0: 1
1: 0
2: 1
3: 7
4: 112
934954603_934954611 18 Left 934954603 2:98607256-98607278 CCAGGAGCTGGCTGAACGGCAGC 0: 1
1: 0
2: 1
3: 13
4: 179
Right 934954611 2:98607297-98607319 GAAGGGACACAGCCCTGGACAGG 0: 1
1: 1
2: 1
3: 51
4: 332
934954603_934954607 0 Left 934954603 2:98607256-98607278 CCAGGAGCTGGCTGAACGGCAGC 0: 1
1: 0
2: 1
3: 13
4: 179
Right 934954607 2:98607279-98607301 ACCAGTGAGTAAGGGGCAGAAGG 0: 1
1: 0
2: 2
3: 20
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934954603 Original CRISPR GCTGCCGTTCAGCCAGCTCC TGG (reversed) Intronic
900130298 1:1084541-1084563 GCTGAGGTTGAGGCAGCTCCTGG - Intronic
901008074 1:6181174-6181196 GCTGGCGGTCGGCCAGCCCCTGG - Intergenic
901640242 1:10689380-10689402 GCTGCAGCTCAGCCAGATTCTGG + Intronic
901777424 1:11569924-11569946 GCAGCAGCTCAGCAAGCTCCTGG - Intergenic
901801056 1:11708194-11708216 GCTCCGGCTCCGCCAGCTCCAGG + Intronic
902509520 1:16958618-16958640 CCTGCAGCTCCGCCAGCTCCCGG - Exonic
904000363 1:27335403-27335425 GCTGCCCTTCATCCTTCTCCTGG + Exonic
904045353 1:27605018-27605040 GCAGCAGTTCAGCCATCTCCGGG - Intergenic
904274210 1:29369712-29369734 GCTGCTGTCCAGCCCCCTCCTGG + Intergenic
904423754 1:30410377-30410399 GCTGCTGTCCAGCCCCCTCCTGG - Intergenic
907108872 1:51908529-51908551 TCTGCTGTTCAACCTGCTCCAGG + Exonic
907372932 1:54014583-54014605 TCTGCCATTCAGCCAGCTGTGGG - Intronic
910613889 1:89175820-89175842 GCTGCAGCTGAGCCAGCTACAGG - Intronic
916040596 1:160957974-160957996 TCTGCATTTCAGCCAGTTCCTGG - Intergenic
916790274 1:168119490-168119512 TCTGCCCTCCATCCAGCTCCTGG - Intronic
917449175 1:175132672-175132694 GCTGACCCTCAGCCAGCTCATGG - Intronic
918340366 1:183563483-183563505 GCTCCCCTACAGCCAGGTCCGGG - Exonic
919539787 1:198831907-198831929 GATGCCTTTCAGCCAGCTCTTGG - Intergenic
919847161 1:201649403-201649425 GCTGCTCTTCAGCCAGATGCTGG + Exonic
922778247 1:228227528-228227550 GCTGACGTTCAGCAAGTGCCTGG + Intronic
922889086 1:229046643-229046665 GCAGATGTCCAGCCAGCTCCAGG - Intergenic
923043070 1:230333578-230333600 GCTCGCGTTCAGCCACGTCCTGG - Intronic
1065843876 10:29728918-29728940 GCTGTCGCCCAGCCACCTCCCGG - Intronic
1065976648 10:30847780-30847802 GCTGCAGGCCAGGCAGCTCCAGG - Intronic
1066214969 10:33277387-33277409 GCTACCGTGCAGCCCCCTCCAGG - Intronic
1066389079 10:34964356-34964378 GCTGCCGCTCTGCCTGCACCTGG - Intergenic
1067368398 10:45658333-45658355 CATGCCTTTCACCCAGCTCCTGG - Intronic
1068388296 10:56360099-56360121 GCTGCTCTGCAGCCAGCTTCAGG - Exonic
1068763064 10:60733580-60733602 GCTGCGCTGCACCCAGCTCCCGG + Intergenic
1070494983 10:77013316-77013338 GCTGGGATTCAGCCAGCCCCAGG + Intronic
1072659828 10:97357015-97357037 GCTGCCTTGCCACCAGCTCCAGG - Exonic
1077298538 11:1837069-1837091 GGTGCCCTTCAGCCAGGTCCAGG + Exonic
1078062880 11:8059839-8059861 ACTGCAGTTCTGCCTGCTCCAGG - Intronic
1078896370 11:15600553-15600575 CCAGCCCTTCAGACAGCTCCAGG + Intergenic
1081801963 11:45866188-45866210 GCTGCCTCTCAGGCAGCTCAAGG - Intronic
1083063409 11:59898286-59898308 TCTGCCGCTCGGCCTGCTCCTGG + Intergenic
1083622298 11:64055215-64055237 GCTGCCCCTCACCCTGCTCCCGG - Intronic
1083675542 11:64322921-64322943 GCTGCCTCTCAGCCACCTACAGG + Intergenic
1083994115 11:66263829-66263851 GCTTCCGTTCTCCCACCTCCAGG + Exonic
1085404177 11:76252071-76252093 ACTGCCCTTCAGCCAGTTCTAGG - Intergenic
1099417545 12:82410555-82410577 GCTACAGTTCAGCTAGATCCTGG + Intronic
1101162510 12:101993728-101993750 GTTGCCCTACACCCAGCTCCAGG - Intronic
1102034230 12:109761740-109761762 GCTGCCCAACTGCCAGCTCCAGG - Intronic
1104768311 12:131344996-131345018 GCTGCTGGTCACTCAGCTCCTGG + Intergenic
1104811737 12:131623593-131623615 GCTGCTGGTCAGTCAGCTCCTGG - Intergenic
1105787116 13:23760187-23760209 GCTGCGATTCAGCCACCTCGTGG - Exonic
1106406621 13:29480256-29480278 GCAGCCGCTCCTCCAGCTCCTGG - Exonic
1113448874 13:110391769-110391791 GCTGCCTTTTAGCGAGCACCTGG - Intronic
1118220655 14:63852732-63852754 GCTCCTGTTCACCCAGCCCCGGG + Intergenic
1118391862 14:65302657-65302679 GCTGCCGTGTCGCCAGCTCGTGG + Intergenic
1120953464 14:90062101-90062123 CCCGGCGCTCAGCCAGCTCCCGG - Exonic
1121466545 14:94119163-94119185 GAGTCAGTTCAGCCAGCTCCTGG - Intergenic
1122878548 14:104679694-104679716 GCTGCCGTAGTGTCAGCTCCAGG + Intergenic
1124363230 15:29054019-29054041 GCCGCAGGGCAGCCAGCTCCAGG - Exonic
1129205054 15:74032610-74032632 GCTGGGCTTCAGCCAGCCCCAGG - Exonic
1129476336 15:75786616-75786638 CCTGCCGATGAGCCCGCTCCAGG + Intergenic
1129711214 15:77821003-77821025 GCTCCCGGTCAGCCTGATCCTGG + Intergenic
1131180111 15:90233753-90233775 GCCGCCCCGCAGCCAGCTCCCGG + Intronic
1132521617 16:392806-392828 GCTGCTGCTCCGCCACCTCCTGG - Intergenic
1132760738 16:1507447-1507469 GCTGCCTGTCAGCCACCTCGAGG - Intronic
1132859287 16:2062060-2062082 GCTGCACTTCACCCAGCACCCGG - Intronic
1133740830 16:8649936-8649958 GCTGCAGTTTAACAAGCTCCCGG + Intergenic
1133829380 16:9307591-9307613 TCTGGAGTTCTGCCAGCTCCAGG - Intergenic
1134018622 16:10906644-10906666 GCTGCCGTTCTGCCCAGTCCGGG - Exonic
1136613749 16:31382782-31382804 GCTGCAGCTCACCCAGCCCCAGG + Exonic
1137933604 16:52611982-52612004 GCTTCTGTTCACCCAGCTCCAGG + Intergenic
1139289436 16:65844133-65844155 GCTGCTGCACAGCCAGCTGCTGG - Intergenic
1139476991 16:67207733-67207755 GCAGGCGTGCAGGCAGCTCCGGG - Exonic
1140399492 16:74659267-74659289 CCTGACAGTCAGCCAGCTCCTGG + Intronic
1141282928 16:82645170-82645192 GGGGCCCTTCACCCAGCTCCAGG + Intronic
1141660905 16:85440971-85440993 GCACACGTCCAGCCAGCTCCCGG + Intergenic
1142111851 16:88336863-88336885 CCTGCCGTTCCCCCAGCCCCTGG + Intergenic
1142375789 16:89706573-89706595 ACTGCCCCCCAGCCAGCTCCTGG + Intergenic
1145970710 17:28955022-28955044 AGTGGCTTTCAGCCAGCTCCTGG + Exonic
1147356901 17:39905479-39905501 GCTGCTCTTCAGACAGCTCTGGG + Exonic
1147836674 17:43337786-43337808 GCTGTAGCGCAGCCAGCTCCAGG - Intergenic
1148779392 17:50112937-50112959 GCTGCCGCGCAGCCTTCTCCTGG + Exonic
1149567684 17:57651604-57651626 GCTGGAATTAAGCCAGCTCCCGG + Intronic
1151987799 17:77555379-77555401 GCTCCCGGGCACCCAGCTCCCGG - Intergenic
1152070403 17:78131378-78131400 TCTGCCGCTCTGCCACCTCCGGG - Exonic
1152572450 17:81126777-81126799 ACTGCCCCTCAGCCAGCCCCGGG + Intronic
1152642129 17:81453713-81453735 GCTGCCTTCTAGCCAGATCCTGG - Intronic
1153808917 18:8734739-8734761 GCTACCGTGCAGCCAGGGCCTGG - Intronic
1155003100 18:21705010-21705032 GCTGCCGATCCGTCAGCTCTCGG - Intronic
1160083465 18:75753111-75753133 GCTGCGGGGCAGGCAGCTCCAGG + Intergenic
1160792622 19:929582-929604 GCTGCCGGGCCTCCAGCTCCTGG - Exonic
1161459613 19:4389046-4389068 GCTGCTGTTGAGCCACCACCAGG + Intronic
1162737578 19:12755082-12755104 GCCGCCGTTGACACAGCTCCAGG - Intronic
1162907149 19:13830807-13830829 GGCGCCGCTCTGCCAGCTCCTGG + Exonic
1165313980 19:35043783-35043805 GCTGTCCTTCCGGCAGCTCCAGG - Intronic
1165436212 19:35796931-35796953 GCTGCGGCTCAGTCGGCTCCTGG + Intergenic
1165438875 19:35812550-35812572 GCTCCCTGTCACCCAGCTCCAGG - Exonic
1167592088 19:50409561-50409583 GCTGCCGTCCATCCAGGACCTGG - Exonic
1168306108 19:55437139-55437161 GCTGCCGTTCTACCAGCTCAGGG - Intronic
1168710795 19:58498870-58498892 GCTGCTGTGCAGCTAGCCCCCGG - Exonic
1168710950 19:58499604-58499626 GCTTCCGTTCCGACAGCTCTCGG + Exonic
925780617 2:7378509-7378531 GATGCTGTGCCGCCAGCTCCTGG + Intergenic
926268157 2:11344585-11344607 GCAGTCCCTCAGCCAGCTCCCGG + Exonic
927980443 2:27371307-27371329 GGTGCGCTACAGCCAGCTCCTGG + Exonic
929438613 2:41948225-41948247 GCTGCTGTTCAGCAAGCAGCAGG + Intronic
932438856 2:71719136-71719158 GCTGCTCCTCAGCCAGCTCCTGG + Intergenic
934650504 2:96088898-96088920 GCCACCGTCCTGCCAGCTCCAGG - Intergenic
934954603 2:98607256-98607278 GCTGCCGTTCAGCCAGCTCCTGG - Intronic
936248853 2:110852031-110852053 GCTGCCCTTCTGCCAGGGCCAGG + Intronic
939339038 2:140869299-140869321 CCTGCAGTTCAGCGAACTCCAGG - Intronic
940396170 2:153195440-153195462 GCTGCAGGGCAGGCAGCTCCAGG + Intergenic
940783004 2:157953038-157953060 ACTGCCACTCTGCCAGCTCCTGG - Intronic
943847416 2:192669692-192669714 GCTGCTGCTTGGCCAGCTCCCGG - Intergenic
945750805 2:213780141-213780163 GCTGCTCTTCAGCCAGCTCTGGG + Intronic
946072460 2:217046262-217046284 GATGCCGTGCAGTCAACTCCTGG - Intergenic
946167243 2:217871788-217871810 TCTGCCTTCCAGCCAGCCCCGGG - Intronic
947542290 2:230987410-230987432 GGTGACGCTCAGCCAGCGCCGGG + Intergenic
947808503 2:232984620-232984642 GCTGCAGTTCATGCAGCTCACGG - Intronic
948372563 2:237498906-237498928 GCTGCTGATCGGGCAGCTCCTGG - Intronic
949014779 2:241702785-241702807 GCTGCCGAGCAGCCTGCTCAGGG + Intronic
1174311817 20:49662043-49662065 CCTGCCCTTCAGCCACCTCTTGG + Intronic
1174905337 20:54544594-54544616 TCTCCTGTTCAGCCAGCTCTGGG - Intronic
1175247655 20:57591417-57591439 GCACCCGTGCAGCCAGTTCCAGG - Intergenic
1176188215 20:63793131-63793153 GCCGCCGTTGAGGCAGCACCTGG - Intronic
1176215514 20:63945957-63945979 GCTGCTGCTCAGTCAGCACCTGG + Exonic
1180785058 22:18542522-18542544 CCTGCCCTTCTGCCTGCTCCAGG + Intergenic
1180965247 22:19784763-19784785 GCTGCCCCTCTGACAGCTCCTGG + Exonic
1181004750 22:20007717-20007739 CCTGCCCTTCTGCCACCTCCTGG + Intronic
1181241961 22:21481876-21481898 CCTGCCCTTCTGCCTGCTCCAGG + Intergenic
1183750228 22:39715890-39715912 GCTGCCGCTGAGACTGCTCCAGG - Intergenic
1184660392 22:45962978-45963000 CCTGCCGCTCAGCCAAGTCCAGG - Intronic
1185022985 22:48391226-48391248 GCTGTCCTCCAGACAGCTCCTGG - Intergenic
1185331660 22:50254764-50254786 GCTGCCCTTCCGCCATGTCCAGG - Intronic
953771640 3:45782143-45782165 GCTGCCCCACAGCCAGTTCCAGG + Exonic
954820362 3:53321177-53321199 GCTGCTGTTCTGCCAGTTCTGGG + Intronic
957638209 3:82814920-82814942 GCAGCAGGTCAGGCAGCTCCAGG + Intergenic
961609198 3:128123398-128123420 GCGGCCCCTCACCCAGCTCCAGG + Intronic
963717709 3:148822543-148822565 TCTCCCATTCAGCCAGCTCTGGG - Intronic
966631871 3:182085158-182085180 ACTGACGTTCAACCAGCTTCAGG - Intergenic
968891610 4:3372305-3372327 GCGGCCGTTCAGCCAGCCTGTGG + Intronic
985222598 4:187723726-187723748 ACTGGGGTTCAGCCAGCTCCTGG + Intergenic
985805183 5:2038545-2038567 GCCGCCGCACAGCCACCTCCCGG + Intergenic
985810097 5:2076290-2076312 GCCCCAGTTCAGGCAGCTCCAGG + Intergenic
986710249 5:10483473-10483495 GCTGCCAAACAGCCAGCCCCAGG + Intergenic
987092621 5:14521704-14521726 TCTGCCTTTCATCCAGCTCTAGG + Intronic
988555937 5:32236153-32236175 GCTGCTGTTCACCCAGCCCTTGG - Intronic
989368310 5:40680027-40680049 GCTGCCGCTGAGGCCGCTCCTGG - Exonic
989565145 5:42894325-42894347 TCTGCAGTTCAGGCCGCTCCCGG + Intergenic
995047976 5:107671409-107671431 GCTGCCGCTTAACCAGTTCCAGG - Intergenic
995146126 5:108788258-108788280 GCTGCAGGACAGGCAGCTCCAGG - Intronic
995273879 5:110256522-110256544 TCTGCCATCCACCCAGCTCCTGG - Intergenic
997201555 5:132012768-132012790 GCTGTGGCTCAGCCAGCTCCTGG - Intergenic
997527796 5:134564638-134564660 CATGCCTCTCAGCCAGCTCCTGG - Intronic
997585527 5:135040845-135040867 GCTGCCGCGCTGCCATCTCCCGG - Intronic
1002082432 5:176745482-176745504 CTTGCCATTCAGCCAGCACCTGG - Intergenic
1002455706 5:179344681-179344703 GCTCCCGCTCAGCCCGCTGCCGG + Intronic
1002992262 6:2248902-2248924 GCTGCATCTCAGCCAACTCCAGG + Intergenic
1004903131 6:20212153-20212175 GCACCCGCTCAGCGAGCTCCTGG - Exonic
1006442431 6:34060716-34060738 GCCACCGCTCAGCCAGCTCCTGG - Intronic
1007386952 6:41526664-41526686 GCTGAGGTCCAGCCAGCTACTGG - Intergenic
1011750114 6:90446993-90447015 CCTGCCCTTCAGCCAGCCTCAGG - Intergenic
1013287031 6:108690729-108690751 CCTGCCCTTCAGCCTGCCCCAGG + Intergenic
1017927481 6:158922754-158922776 GTTGCCCGTGAGCCAGCTCCGGG + Intergenic
1018380657 6:163255380-163255402 GCTGCCCGTCAGTCACCTCCTGG - Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019356531 7:582791-582813 GCTGCCTTTCAGCCAGACCTGGG - Intronic
1020233851 7:6340500-6340522 TTTGCCCTTCAGCCAACTCCAGG - Intronic
1021853899 7:24834524-24834546 GCTGGAGTACAGCGAGCTCCTGG - Exonic
1022471070 7:30682214-30682236 GCAGCTCTTCAGCCAGCGCCAGG + Intronic
1032265603 7:130368033-130368055 ACTGCCCTGCAGCCAGCCCCAGG - Intronic
1032823110 7:135542985-135543007 GCTGCCCTCCTGCTAGCTCCTGG - Intergenic
1032844655 7:135742105-135742127 GCTGGAGTGCAGCCAGCTCTAGG + Intronic
1033849255 7:145474619-145474641 GCTGCCATTCTGCCAGCTCCAGG - Intergenic
1035056575 7:156040146-156040168 GCTGTCACTCAGCCAGGTCCTGG - Intergenic
1036788854 8:11704672-11704694 GCTGCCGTGCAGCCTGTCCCGGG - Intronic
1037589934 8:20303926-20303948 GCTGCCAACCCGCCAGCTCCAGG + Exonic
1042864449 8:73345076-73345098 GATCCCTTTCAGCCAGCTCCTGG - Intergenic
1045251233 8:100484897-100484919 GCTGCAGCTCAGGCAGCTCAGGG + Intergenic
1045305352 8:100952527-100952549 GCTCCCGTTCAGCAACATCCGGG + Intronic
1048018568 8:130518930-130518952 GCTGGCTTTCAGCCACCTACAGG + Intergenic
1048254907 8:132898343-132898365 CCAGCCCTTCAGCCAGGTCCCGG + Intronic
1049214376 8:141401036-141401058 GATGCCGTTCCGTCAGGTCCTGG - Intronic
1049748730 8:144273771-144273793 GCCGCAGCTCAGCCGGCTCCTGG + Intronic
1049757622 8:144317801-144317823 GCTGTTCTTCACCCAGCTCCAGG - Exonic
1050182445 9:2935091-2935113 GCTGCCGGACAGGCAGCTCCAGG - Intergenic
1053391851 9:37741548-37741570 GCTGCAGCTCTCCCAGCTCCTGG - Intronic
1053442602 9:38128434-38128456 GCTGCCGCTGAACTAGCTCCTGG - Intergenic
1056055474 9:82818338-82818360 GCTGCCCTTGAGGTAGCTCCTGG - Intergenic
1056235612 9:84590902-84590924 GCTGCAGCTCAGCCAGCCACTGG - Intergenic
1056618681 9:88191624-88191646 GCTGCCTTTGAGCCACCTGCTGG + Intergenic
1059506697 9:114805832-114805854 CCTGCTTGTCAGCCAGCTCCGGG - Exonic
1061105075 9:128523714-128523736 GCTGCAGCTCAGCCAGCAGCTGG + Exonic
1062397910 9:136359928-136359950 GCTGCCGCCCACCCAGCACCCGG + Intronic
1062468790 9:136693020-136693042 GCTGGGCTTCAGCCAGCACCAGG + Intergenic
1193417536 X:81241892-81241914 GCTGTCGGGCAGGCAGCTCCAGG - Intronic
1195854093 X:109311476-109311498 CCTGAAGTTCAGCCATCTCCGGG + Intergenic
1197050746 X:122056205-122056227 GCTTCCATTTTGCCAGCTCCTGG + Intergenic
1197615100 X:128681996-128682018 CCTGCCCTTTAGCCAGTTCCTGG - Intergenic
1201240518 Y:11953669-11953691 GCAGCCCTGCAGGCAGCTCCCGG + Intergenic