ID: 934954746

View in Genome Browser
Species Human (GRCh38)
Location 2:98608348-98608370
Sequence CGCGTGCGCGGGCCTGAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934954746_934954756 17 Left 934954746 2:98608348-98608370 CCTCCTTCAGGCCCGCGCACGCG 0: 1
1: 0
2: 1
3: 4
4: 78
Right 934954756 2:98608388-98608410 CTCATAATACTTAGGCATGACGG 0: 1
1: 0
2: 0
3: 9
4: 116
934954746_934954754 9 Left 934954746 2:98608348-98608370 CCTCCTTCAGGCCCGCGCACGCG 0: 1
1: 0
2: 1
3: 4
4: 78
Right 934954754 2:98608380-98608402 GGCTTGTCCTCATAATACTTAGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934954746 Original CRISPR CGCGTGCGCGGGCCTGAAGG AGG (reversed) Exonic