ID: 934959569

View in Genome Browser
Species Human (GRCh38)
Location 2:98659057-98659079
Sequence GATGCTTCTACCCTCCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934959569_934959571 -7 Left 934959569 2:98659057-98659079 CCAGCATGGAGGGTAGAAGCATC 0: 1
1: 0
2: 0
3: 13
4: 105
Right 934959571 2:98659073-98659095 AAGCATCAGAAGAGGATGCCTGG 0: 1
1: 0
2: 2
3: 26
4: 215
934959569_934959574 22 Left 934959569 2:98659057-98659079 CCAGCATGGAGGGTAGAAGCATC 0: 1
1: 0
2: 0
3: 13
4: 105
Right 934959574 2:98659102-98659124 TGACGTTCAACAGTAAGAATTGG 0: 1
1: 0
2: 0
3: 4
4: 59
934959569_934959572 -1 Left 934959569 2:98659057-98659079 CCAGCATGGAGGGTAGAAGCATC 0: 1
1: 0
2: 0
3: 13
4: 105
Right 934959572 2:98659079-98659101 CAGAAGAGGATGCCTGGAAGAGG 0: 1
1: 1
2: 5
3: 59
4: 542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934959569 Original CRISPR GATGCTTCTACCCTCCATGC TGG (reversed) Intronic
904888060 1:33756630-33756652 CCTGCTTCTACCTACCATGCTGG - Intronic
905456093 1:38088829-38088851 CCTGCCTCCACCCTCCATGCAGG + Intergenic
906031024 1:42720226-42720248 GATGCTTCCACCCAGCATCCTGG + Intergenic
911708773 1:101044853-101044875 CATACTTCTTCCCTCCCTGCAGG + Intergenic
916716844 1:167453918-167453940 CATGCCACTACCCTCCATCCTGG + Intronic
923655677 1:235914035-235914057 GGTGCTGCTACACTCCAGGCTGG + Intergenic
924705533 1:246498816-246498838 AATGCTTATACCCCCCAGGCTGG + Intronic
1063631790 10:7740777-7740799 GATGATAATACCCTCCCTGCAGG + Intronic
1064359620 10:14651999-14652021 TATGGTGCTACCCTCCATCCTGG - Intronic
1064519685 10:16188073-16188095 GATGGTTCTACACTCCCTCCAGG + Intergenic
1067225535 10:44373695-44373717 GATGCTGCTGCCCTGCATCCTGG + Intronic
1069490598 10:68857336-68857358 GATGCTTCCTCCCTCCTTTCAGG - Intronic
1071160819 10:82743234-82743256 GATGCTCCTACCTTCCACGGAGG - Intronic
1071602474 10:86965057-86965079 GCTGCTTCTGACCTCCCTGCAGG + Intronic
1071945294 10:90637281-90637303 GAAGCTTCTACTCTCCATACAGG + Intergenic
1077184248 11:1229278-1229300 GCTGCTTCTGCCCCCCAGGCAGG + Exonic
1077705787 11:4483988-4484010 GATGCTTAGAACCTCCATTCTGG + Intergenic
1081614103 11:44580189-44580211 CCTGCTTCTACCCTCCACACCGG + Intronic
1085026375 11:73239011-73239033 TGTGCTGCTACCTTCCATGCAGG + Intergenic
1086556575 11:88118198-88118220 CATGCTCCTACCTTGCATGCTGG - Intronic
1087035856 11:93755707-93755729 CATGCTACTACCCTCCAGTCTGG + Intronic
1087484696 11:98746990-98747012 CATGCTGCTGCCCTCCAGGCTGG - Intergenic
1089596162 11:119581917-119581939 CATGCTACTACCCTCCAGCCTGG + Intergenic
1090760845 11:129835723-129835745 GATTCCTCTACCCTAAATGCTGG - Intronic
1092367019 12:7884800-7884822 GATGTTTCTCCTCTCCCTGCGGG + Intronic
1094383382 12:29867651-29867673 GATACATCTTCACTCCATGCTGG - Intergenic
1097275512 12:57810756-57810778 CTTTCTTCTTCCCTCCATGCTGG - Intronic
1097493893 12:60304190-60304212 GATTCTTCTAACCTCCACTCTGG - Intergenic
1097764725 12:63512462-63512484 GATGCTTGTGGCTTCCATGCTGG + Intergenic
1099281041 12:80646566-80646588 GATGCTTCTAGCCTGGATGCAGG + Intronic
1099787998 12:87292187-87292209 TATGCTTCTGCCTTCCATCCTGG - Intergenic
1101494795 12:105243488-105243510 GATGCTACTGCCCTCCAGCCTGG + Intronic
1101519578 12:105469000-105469022 GATGCTTCTGTCATCCATGCAGG + Intergenic
1105872541 13:24518382-24518404 CATGCGTCTACACTCCAGGCTGG - Intergenic
1107739438 13:43433753-43433775 GATGCTTCAACATTCCCTGCTGG + Intronic
1107914778 13:45138306-45138328 GATGCTTCTGCCCTCCGTGGAGG + Intronic
1111991351 13:95120524-95120546 GATGCTACTGCACTCCAGGCTGG + Intronic
1116334539 14:43640240-43640262 GAGGCTGCTACACTCCAAGCTGG - Intergenic
1117780067 14:59223025-59223047 GATGATTCTGCACTACATGCAGG - Intronic
1122808859 14:104277766-104277788 GGTGCTTCTTCCGTCCATCCGGG + Intergenic
1122934302 14:104948871-104948893 CATGAGTCTCCCCTCCATGCAGG - Exonic
1126125156 15:45289038-45289060 GATGCTGCTTCCCACCACGCTGG + Intergenic
1129328873 15:74816610-74816632 GCTGCTTCTCACCTCCCTGCAGG + Exonic
1131010758 15:89016607-89016629 GATGCTTCAACACTCTATGGGGG - Intergenic
1132011383 15:98279613-98279635 GATGCTTGGACCCTCCAGGAGGG - Intergenic
1136641218 16:31567224-31567246 GATGCATCTAACCTCAATGGTGG - Intergenic
1137598731 16:49742182-49742204 AATGACTCTACCCTCCCTGCAGG + Intronic
1138594095 16:58020320-58020342 GATGCTTCTAGCCTCCCAGTAGG + Exonic
1139013823 16:62665517-62665539 AATGCTTCTATTCTCCATGTGGG + Intergenic
1140389996 16:74577655-74577677 GATGCCACTACCCTCCATCCTGG - Intronic
1140901201 16:79369746-79369768 AATGCTTCCACCCTCCATGATGG + Intergenic
1140954178 16:79847107-79847129 GATGCTTATACCCTCCACGGTGG - Intergenic
1143370047 17:6433954-6433976 GATCCTGCTTACCTCCATGCGGG - Exonic
1145289823 17:21534322-21534344 GATGCTGGAGCCCTCCATGCTGG - Exonic
1149298984 17:55286851-55286873 GCTGCTTCTTCCTTCCATGATGG + Intronic
1154325706 18:13389240-13389262 GATACTCCTCCCCTCCAGGCAGG + Intronic
1154325719 18:13389282-13389304 GATACTCCTCCCCTCCAGGCAGG + Intronic
1157524805 18:48372766-48372788 CATGATTCTACCCTATATGCAGG + Intronic
1158335526 18:56412057-56412079 GAAGCTTCAAACCCCCATGCTGG + Intergenic
1166371407 19:42303234-42303256 CCTTCTTCTACCCTCCAAGCAGG - Intronic
927715265 2:25347770-25347792 GATCCTTCTACCCGCCTTCCAGG + Intergenic
928111025 2:28508932-28508954 GATGCTTCTTCCTTTCATCCAGG + Intronic
931679867 2:64737072-64737094 GATGCTGCCACCCTCCATACTGG - Intronic
933070162 2:77846883-77846905 GATACTTTTACCCTCAATACAGG + Intergenic
934959569 2:98659057-98659079 GATGCTTCTACCCTCCATGCTGG - Intronic
935394103 2:102587415-102587437 GATTCTTCTACCCACAATGAAGG - Intergenic
935618305 2:105108088-105108110 GATGCTACTGCCCTGCCTGCAGG - Intergenic
947832245 2:233149786-233149808 GATGCTGCTACTATCCCTGCTGG - Intronic
1171098279 20:22354487-22354509 GATGCTCCTATCATGCATGCAGG - Intergenic
1172468181 20:35172482-35172504 GATTCTCCTACCCTCTCTGCTGG - Intronic
1172991150 20:39037970-39037992 CAAGCTTGTACCCTCCATGTGGG + Intronic
1173465930 20:43281422-43281444 AATGCTTCTAGCCTGCATGCAGG - Intergenic
950100158 3:10351807-10351829 GCTGCTTCTACACTCCAAGGAGG + Intronic
952592035 3:34967489-34967511 GATGCCTCTATCCTCCAGGTAGG - Intergenic
952955667 3:38555806-38555828 GATCCTGGTGCCCTCCATGCTGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
961578857 3:127861253-127861275 AATGCTACTACCCACCATGGAGG + Intergenic
966464322 3:180212977-180212999 TACTCTTCTACCTTCCATGCTGG + Intergenic
967108952 3:186275906-186275928 TATGCTTCTGCCAGCCATGCGGG - Intronic
967232921 3:187357666-187357688 GATGCTTCTACTATCCAAGTAGG + Intergenic
969828131 4:9774420-9774442 CGTGCTTCCACCCTGCATGCTGG + Intronic
970271069 4:14348253-14348275 GCTGCTTCTGCCCTGCAGGCAGG + Intergenic
977578666 4:98701349-98701371 GCTGCTGCTTGCCTCCATGCCGG + Intergenic
978414261 4:108458963-108458985 CATCCTTCTACACTCCATGCTGG - Intergenic
983880923 4:172931632-172931654 GATCCTGCTACACTCCATGTGGG - Intronic
986289411 5:6387773-6387795 GATGGTTCTTCCAGCCATGCTGG - Intergenic
987110127 5:14678194-14678216 GCTGCTCCCTCCCTCCATGCAGG - Intronic
987328081 5:16830462-16830484 GTTGCTTATACCCACTATGCAGG + Intronic
992109527 5:73479737-73479759 GACACTTCTACACTCCATTCAGG + Intergenic
992156025 5:73956064-73956086 CATGCTCCTACCCTCCATTCTGG - Intergenic
995219070 5:109627731-109627753 GATGCCTCCACCTTCCATTCTGG + Intergenic
999550798 5:152685366-152685388 GAGACTTCTACCCCCCATGGTGG + Intergenic
1003453927 6:6262984-6263006 GATGCTTCAGTCCCCCATGCAGG - Intronic
1006699291 6:35958695-35958717 AATGCCTCCACCCGCCATGCAGG - Intronic
1014274343 6:119369688-119369710 CTTGCTTCTAACCTCCAAGCTGG - Intergenic
1014892257 6:126856873-126856895 CCTGCTTCTCCCCTCCATACAGG + Intergenic
1020344598 7:7149277-7149299 GAGCCTTTTACCCTCCATGTAGG - Intergenic
1022467699 7:30662545-30662567 GCAGCTACTTCCCTCCATGCTGG - Intronic
1022776090 7:33529184-33529206 GAGGCTCCTACAGTCCATGCTGG - Intronic
1024240639 7:47432689-47432711 GCTGCTTCCACCCACAATGCAGG - Intronic
1028885456 7:95927928-95927950 GACGCTGCTACCCTCCATCCTGG - Intronic
1029662319 7:101970900-101970922 GATGCCTCTACACTCCAAGGAGG - Intronic
1035346394 7:158202491-158202513 GACTCCTCTGCCCTCCATGCTGG + Intronic
1037372677 8:18196708-18196730 GATGCACCTTCCCTCCCTGCTGG - Intronic
1049191844 8:141292604-141292626 GAGGCTTCACCCCTCCTTGCTGG + Intronic
1049997213 9:1044873-1044895 GCAGCTTCCATCCTCCATGCTGG - Intergenic
1052545553 9:29873592-29873614 TTTGCTTCTAACCTCCATGCTGG + Intergenic
1058143902 9:101388699-101388721 GATGCGTTTACCCTCCTTGTTGG + Exonic
1059448945 9:114357975-114357997 GATGCCGCTTCCCTCCAGGCTGG + Exonic
1059676295 9:116543762-116543784 GATGCTTCTCAGCTCCTTGCTGG + Intronic
1061385116 9:130285140-130285162 CATGCTTCTGCCCTCCAGGGAGG + Intronic
1062631335 9:137464482-137464504 AAGGCTTCCACCCTCCCTGCGGG + Intronic
1186274246 X:7922671-7922693 GATGGTTATACCCACCCTGCAGG - Intronic
1187095463 X:16143195-16143217 AAAGCTTGTTCCCTCCATGCAGG + Intronic
1194758530 X:97766211-97766233 CTTGCTTCTAGCCTCCAAGCTGG - Intergenic
1195765533 X:108292903-108292925 GATGCCACTACCCTCCAGCCTGG + Intronic
1196812267 X:119638165-119638187 GAAGCTTCTACCATCCAGGTGGG - Intronic
1199040641 X:143111458-143111480 GATGCTTCTGCACAACATGCAGG + Intergenic
1201448071 Y:14080158-14080180 GATGGTTATACCCACCTTGCAGG + Intergenic