ID: 934961824

View in Genome Browser
Species Human (GRCh38)
Location 2:98682497-98682519
Sequence AAATGCATGCTAAAACTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934961822_934961824 12 Left 934961822 2:98682462-98682484 CCATCATAGCAATAACTGACTCA 0: 1
1: 0
2: 3
3: 25
4: 198
Right 934961824 2:98682497-98682519 AAATGCATGCTAAAACTAACAGG 0: 1
1: 0
2: 2
3: 28
4: 293
934961820_934961824 26 Left 934961820 2:98682448-98682470 CCACCACTTTGCAACCATCATAG 0: 1
1: 1
2: 4
3: 20
4: 146
Right 934961824 2:98682497-98682519 AAATGCATGCTAAAACTAACAGG 0: 1
1: 0
2: 2
3: 28
4: 293
934961821_934961824 23 Left 934961821 2:98682451-98682473 CCACTTTGCAACCATCATAGCAA 0: 1
1: 1
2: 6
3: 33
4: 195
Right 934961824 2:98682497-98682519 AAATGCATGCTAAAACTAACAGG 0: 1
1: 0
2: 2
3: 28
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934961824 Original CRISPR AAATGCATGCTAAAACTAAC AGG Intronic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
905041126 1:34959261-34959283 AAAGGCAGGCTAAAAGTAAAAGG + Intergenic
905607273 1:39313371-39313393 CAATGGATGCTAAAACTAGTTGG - Intronic
905714774 1:40139434-40139456 TAATGGATGCTAAAACTACTAGG - Intergenic
905928598 1:41770249-41770271 AGATGAATGCTAAAATTAAAAGG + Intronic
911024146 1:93419204-93419226 AAAAGTGTGCTAAAACTGACAGG - Intergenic
911173129 1:94791626-94791648 AAATCCTAGGTAAAACTAACTGG + Intergenic
911703604 1:100984631-100984653 AATTGCATCCTGAAGCTAACAGG + Intergenic
911801996 1:102152543-102152565 TAATGGATGCTAAAACTAGTGGG - Intergenic
918581861 1:186140650-186140672 AAATGGATGCTAAAACTAGTGGG - Intronic
919180029 1:194068929-194068951 AAAAGCATTCTAAAAATCACAGG + Intergenic
919342002 1:196322414-196322436 AAACACAGGCTGAAACTAACCGG + Intronic
919970825 1:202576654-202576676 AAAGGGATACTAAAAATAACTGG - Intronic
923811060 1:237316670-237316692 AAATGGATTTGAAAACTAACTGG - Intronic
923913786 1:238480615-238480637 AAATTCATGAGAAAATTAACAGG + Intergenic
1063682604 10:8204085-8204107 AAATGTAAGTTACAACTAACTGG + Intergenic
1063770345 10:9190550-9190572 AAATGCATGACAGAACTCACTGG + Intergenic
1063777248 10:9277805-9277827 TAATGCTTGCTTAGACTAACTGG + Intergenic
1064525005 10:16246020-16246042 AAAGGCATGTTAAAAGTAAAGGG + Intergenic
1064566304 10:16642273-16642295 AAATGTATGCAAAACCAAACAGG + Intronic
1067350262 10:45469316-45469338 AAATTCATTCTTAAAATAACAGG + Intronic
1068031091 10:51706152-51706174 AAATGCATGCTTTAACTAACTGG - Intronic
1068031754 10:51713244-51713266 AAATGCAGCATAAAACTGACAGG + Intronic
1068140780 10:53004400-53004422 AAATGAATGCTAATTCTAATGGG - Intergenic
1069152368 10:64979817-64979839 AAATTCATGCTAAAATTTAAGGG - Intergenic
1069246840 10:66217507-66217529 AAATGAATGGTTAAACGAACTGG - Intronic
1071735283 10:88291964-88291986 AATTGTATGCTAAAAATATCAGG + Intronic
1072183569 10:93012285-93012307 GAATTCATGTTAAAACTACCAGG + Intronic
1072300038 10:94051534-94051556 ATATGCATCCCAAAACTAGCCGG + Intronic
1072863846 10:99036687-99036709 AAATGCATGCTTAAATTAGTGGG + Intronic
1073131753 10:101193629-101193651 CAATGGATGCTAAAACTATTGGG + Intergenic
1074699137 10:116078115-116078137 ACATGCAGGGTATAACTAACTGG - Intronic
1076682963 10:132184536-132184558 AAATTTATGCAAAAACTAACCGG + Exonic
1078173326 11:8947633-8947655 CAATGCATCCTAGAACAAACTGG - Exonic
1078573708 11:12481142-12481164 AAATGGATGCAAAAACTAGAGGG - Intronic
1078770659 11:14348406-14348428 AAATGGATCTTAAAACTAAGTGG - Intronic
1079149960 11:17889163-17889185 CAATGCATGTTAAAACTACTGGG + Intronic
1079274637 11:19023471-19023493 CAATGCATGCTAAAACCAGTGGG - Intergenic
1080232052 11:30027244-30027266 TAATGCATGATAAAACTAACTGG + Intergenic
1080514020 11:33002956-33002978 AAATGTAAACTAAAAGTAACAGG + Intergenic
1081276565 11:41156864-41156886 AAACTCATGCTGAAACTACCAGG + Intronic
1083975430 11:66115688-66115710 ACATGCAGGCAAAACCTAACAGG - Intronic
1085045609 11:73351324-73351346 AACTGCAGGCTAAAAAAAACAGG - Intronic
1085373375 11:76033766-76033788 AAATGCATGTTAAAACCAGAAGG + Intronic
1085832898 11:79920952-79920974 AAATTCATGGCCAAACTAACTGG + Intergenic
1086202162 11:84217067-84217089 GAATGTTTCCTAAAACTAACTGG + Intronic
1087331453 11:96786325-96786347 AAATGCATTCTTAAATTAAGTGG + Intergenic
1087448044 11:98280104-98280126 AAATGCAAGCTAAAACTGTCAGG - Intergenic
1088065206 11:105709420-105709442 CAATGGATGCTAAAATTAATAGG + Intronic
1088092108 11:106054167-106054189 TAATGCATGATCAAACAAACTGG + Exonic
1091414131 12:265829-265851 CAATGAATGCTAAAACTAGTGGG + Intergenic
1091902033 12:4152154-4152176 AACTGCACACTAAAAATAACAGG - Intergenic
1092699093 12:11206956-11206978 CAATGGATGCTAAAATTAATAGG + Intergenic
1093098711 12:15001755-15001777 ACAAGCATGCTAAAAATAGCCGG - Intergenic
1093589267 12:20881286-20881308 AAATGCATTCAAATTCTAACAGG - Intronic
1094503539 12:31041248-31041270 AATTGCCTGCTAAAATTACCAGG - Intergenic
1095222053 12:39627207-39627229 AAGTGCATGCTAAAATTATCAGG - Intronic
1095531746 12:43194973-43194995 TAATTCATGATAAAACTACCAGG + Intergenic
1095726560 12:45460150-45460172 AAATGCTTCCTAAATCTATCAGG - Intergenic
1095758667 12:45801376-45801398 CAATGGATGCTAAAACTAGCAGG + Intronic
1096380361 12:51152007-51152029 ATCTGAATGCTAAAATTAACAGG + Intronic
1096588548 12:52642236-52642258 GAATTCATACTAAAACTCACAGG + Intergenic
1098602294 12:72346388-72346410 AAATGCATGCTAAAATCCAGCGG + Intronic
1099009095 12:77270389-77270411 AAATGCAGCCTAGAAATAACAGG - Intergenic
1099489116 12:83266698-83266720 AAGTTCATGCCTAAACTAACTGG - Intergenic
1102364968 12:112325211-112325233 AATTGAATGCTAAATATAACTGG - Intronic
1102368017 12:112356244-112356266 AAATGATTGCTAAAAATAAAGGG + Intronic
1104244118 12:127021018-127021040 CAATGCATGTTAAAATTAACAGG - Intergenic
1104251703 12:127100637-127100659 AAATGCATTCTTAAAATACCAGG - Intergenic
1104393506 12:128411292-128411314 AAGAGGATGCTAAAACTATCCGG - Intronic
1105749632 13:23410352-23410374 AAATGAATCCTGAAACTAAGAGG + Intronic
1105872868 13:24523336-24523358 AACTGCATAAAAAAACTAACTGG + Intergenic
1106648904 13:31667149-31667171 TAATGGATGCTAAAATTAATGGG + Intergenic
1106798159 13:33229137-33229159 AAATGCATACTCAATCTAAAAGG + Intronic
1107370981 13:39747375-39747397 AACTGCCTGCTAAAGCCAACAGG - Intronic
1108189738 13:47925148-47925170 CAATGGATGCTAAAACCAAGGGG + Intergenic
1108411862 13:50157383-50157405 AAATACATGCTATATCTAAATGG + Intronic
1109248547 13:59988514-59988536 AATTTCATGCAAAAACTCACTGG + Intronic
1109266989 13:60212743-60212765 AAATGCATGGTTAAATAAACTGG + Intergenic
1109525921 13:63575680-63575702 AAATCCATGCCAAAATTAAATGG - Intergenic
1109682588 13:65772216-65772238 AAATCCATAATAAAACTCACTGG + Intergenic
1111558897 13:89917774-89917796 AAATGAATGCTAAAGTTAAATGG + Intergenic
1111789857 13:92840599-92840621 AAATTCATTCTAAAACTCATAGG - Intronic
1112153301 13:96788493-96788515 AACTGCATACTAAAAATTACAGG - Intronic
1112189501 13:97162480-97162502 GTATGCATGTTAAAAGTAACAGG - Intergenic
1113628748 13:111865754-111865776 AAATGCTTTCTAAAACGAATTGG - Intergenic
1114899768 14:27043076-27043098 AAATTAATGCAAAAACTAACAGG + Intergenic
1116116564 14:40659118-40659140 AAATTCATTCTAAAACTTACTGG + Intergenic
1116175920 14:41470170-41470192 AAATACATCCTATAACCAACAGG - Intergenic
1116255602 14:42550462-42550484 TACTGCATGCTACAACTATCAGG - Intergenic
1117337860 14:54770087-54770109 AAATGCCTGCAAAAACAAACAGG - Exonic
1117915857 14:60677171-60677193 AAAAGAATGATAAAAATAACAGG - Intergenic
1119358521 14:74027508-74027530 CAATGGATGCTAAAACCTACTGG + Intronic
1119707408 14:76792109-76792131 AAGTGAATGCTATAAATAACTGG + Intronic
1121206267 14:92171061-92171083 CAATGGATGCTAAAAGTAAAGGG - Exonic
1121479271 14:94248640-94248662 CAATGGATTCTACAACTAACAGG - Intronic
1124551735 15:30687390-30687412 CATTGCATGCTAAAACCAATGGG + Intronic
1125104250 15:35952254-35952276 CAATGTATGCTAAACCTAAGTGG - Intergenic
1125500439 15:40237300-40237322 AAATGCAAACTAAAACAAAAGGG - Intergenic
1125570964 15:40717814-40717836 ATAGACATGCTAAAATTAACTGG + Intronic
1126291893 15:47090450-47090472 TAATGAATGCTAAAACTATTAGG - Intergenic
1126897586 15:53275751-53275773 ACATGCACGCTAAAGCTAAACGG - Intergenic
1129895240 15:79100328-79100350 AAAGGCATGCTAAAGGTCACAGG + Intergenic
1131213038 15:90514018-90514040 CAATGCATACTAAAACTAGTGGG + Intergenic
1133563206 16:6968607-6968629 AAATGCAAACTGAAACTGACAGG - Intronic
1134480357 16:14613729-14613751 CAATAGATGCTAAAACTAACTGG + Intronic
1135727397 16:24867334-24867356 AACAGCATGCTAAAACTTATGGG + Intronic
1135874158 16:26182011-26182033 AAATGAATGCAAAAACTCAGAGG - Intergenic
1139047026 16:63074118-63074140 AACTACATGCTAAATCTAATAGG - Intergenic
1140700571 16:77577758-77577780 AATTCCTTGCTAAAACAAACAGG + Intergenic
1141261268 16:82455897-82455919 AAATGCATTCTAAATCCAATAGG + Intergenic
1144113666 17:12064497-12064519 AAATGCAGACTAAAACAAAAAGG + Intronic
1144325666 17:14177428-14177450 AAATTCATCCTAAAACTTCCAGG + Intronic
1144347857 17:14366262-14366284 TAATGCATTCTAAAATTAACTGG + Intergenic
1144474540 17:15574316-15574338 AAATTCATCCTAAAACTTCCAGG + Intronic
1144492516 17:15726162-15726184 CAATGGATGCTAAATCTAAGGGG + Intergenic
1144907959 17:18653025-18653047 CAATGGATGCTAAATCTAAGGGG - Intronic
1146191229 17:30768514-30768536 AAAAGCATGCTAAATCTCTCTGG - Intergenic
1146336388 17:31975162-31975184 AAAAGCATGCTAAATCTCTCTGG - Intronic
1152994577 18:394624-394646 AACTGCATAGTAAAACTAATGGG + Intronic
1153336154 18:3927203-3927225 CAATGGATGCTAAAACTAGTGGG + Intronic
1155473718 18:26216802-26216824 GAATGGATGCTAAAATTAATAGG + Intergenic
1155558791 18:27052162-27052184 TAATTCATGATAAAACTAATAGG - Intronic
1157450801 18:47786994-47787016 GAATGAATGCTAACATTAACAGG + Intergenic
1159185938 18:64974448-64974470 AAATGAATGAAAAAACAAACCGG + Intergenic
1159361498 18:67410441-67410463 AAATGCAAGGGAAAACTAACAGG - Intergenic
1160314311 18:77826514-77826536 AAATGCATGTTAAAACCAAGAGG - Intergenic
1164869900 19:31633938-31633960 AAATGCCTGCCAAAAGAAACTGG + Intergenic
1165889990 19:39106036-39106058 GAATGGATGATAAAACTAGCAGG - Intronic
1168430466 19:56275241-56275263 AGATGGATGCTAAAATTAATGGG - Intronic
928057259 2:28070038-28070060 AAATTCATTCTTAAAGTAACAGG + Intronic
928110101 2:28500454-28500476 CAATGGATGCTAAAAATCACTGG - Intronic
929634658 2:43505743-43505765 AAAAGAATGCAAAAATTAACAGG + Intronic
930127174 2:47810521-47810543 AACTGCATGGTAAAATTCACAGG + Intronic
930521489 2:52472731-52472753 AAATGAGTGCTAATACTAATAGG - Intergenic
930632615 2:53770223-53770245 AAATGTATGAGAAGACTAACAGG + Intronic
931098673 2:58971208-58971230 AAATGCATTCTAAGACCAAATGG - Intergenic
931718648 2:65049970-65049992 TAATGAATGCTAAAACTATTGGG - Intergenic
931765748 2:65454671-65454693 CAATGGATGCTAAAACTAGTGGG + Intergenic
933779682 2:85792747-85792769 ACATGCATGAAAAAACAAACAGG + Intergenic
934131057 2:88949238-88949260 AAATGCATCCTCAAAAGAACAGG + Intergenic
934146706 2:89101810-89101832 AAATGCATCCTCAAAAGAACAGG + Intergenic
934222559 2:90098782-90098804 AAATGCATCCTCAAAAGAACAGG - Intergenic
934961824 2:98682497-98682519 AAATGCATGCTAAAACTAACAGG + Intronic
936045797 2:109186916-109186938 AAAAGCGTGCTAGAACTAATTGG + Intronic
937113640 2:119387385-119387407 AACTGCAAGCTACAACTTACCGG - Intergenic
937327587 2:121000685-121000707 AAAAGCATCCCAAAACTCACAGG + Intergenic
941288793 2:163648821-163648843 AATTGCAAGCTAAAAGTTACTGG - Intronic
941744834 2:169076007-169076029 CAATGGATGCTAAAACTAGTGGG - Intronic
943409322 2:187526551-187526573 AAAAGCATGATACAACTAGCAGG + Intronic
944043771 2:195385371-195385393 AAACTCAGGCTAAAACTAGCTGG - Intergenic
945897046 2:215495317-215495339 AAAATCAAGCTAAAACTAGCAGG + Intergenic
948054545 2:235001257-235001279 AACTGCATGCTAAACTTTACGGG + Intronic
1169483958 20:6010742-6010764 AAATGCATTATAAAACTGGCTGG + Intronic
1170266671 20:14473865-14473887 AAATGCATATAAAAACTAAAAGG - Intronic
1170840297 20:19919943-19919965 ACACCAATGCTAAAACTAACTGG + Intronic
1170963502 20:21046391-21046413 AACAGCATGCCAAAACTTACTGG - Intergenic
1171120992 20:22568694-22568716 AAATGCCTGCTAAATGTCACTGG - Intergenic
1171537468 20:25908095-25908117 TAATGAATGCTAAAACTATTAGG + Intergenic
1171803598 20:29652555-29652577 TAATGAATGCTAAAACTATTAGG - Intergenic
1173264186 20:41463328-41463350 CAATGGATGCTAAAACCAATGGG + Intronic
1173693235 20:44982463-44982485 CAAAGCATGCTAAAAATCACTGG - Intronic
1173754253 20:45501101-45501123 CAATGTATGCTAAAACTAGTGGG - Intergenic
1174544072 20:51312141-51312163 AAGAGCATTCTAAAATTAACTGG - Intergenic
1175669198 20:60887249-60887271 AAATGAAAGATAAAACTACCAGG + Intergenic
1177724101 21:24944717-24944739 AAATGCAAGCTAAAACAACAAGG + Intergenic
1178272816 21:31208601-31208623 ACATGGATGCTAAAAATAAATGG - Intronic
1178302723 21:31466453-31466475 GGATTCTTGCTAAAACTAACTGG + Intronic
1183177405 22:36234264-36234286 AAATTCACACTCAAACTAACAGG + Intronic
1185240350 22:49739575-49739597 AAATGAGTGCTAAGCCTAACGGG - Intergenic
949657824 3:6241408-6241430 AAATGCATGTTACAAGTCACTGG - Intergenic
949924865 3:9032980-9033002 AAATGCATTCTAAATCTTAGGGG + Intronic
950059760 3:10060677-10060699 AAATGCATTCTAAAAGAATCAGG - Intronic
951078118 3:18422271-18422293 AAAGCCATGCTAATACAAACTGG - Intronic
951457962 3:22914384-22914406 TAATGCAGGCTAAAAATACCTGG - Intergenic
952880386 3:37982071-37982093 AAATCCATGCTACACCTAAGTGG - Exonic
953602632 3:44383010-44383032 AAATGCAAATTAAAACTAATGGG + Intronic
953616424 3:44494499-44494521 GAAGGCTTGCTAAAAGTAACTGG - Intergenic
954546476 3:51440278-51440300 AATTACATGCTAAAACACACAGG + Intronic
956140403 3:66140852-66140874 AAAGGCATGATTGAACTAACAGG + Intronic
956879008 3:73491447-73491469 CAATGGATGCAAAACCTAACTGG - Intronic
956984765 3:74686099-74686121 AAATAGATGCTAAAACTAATGGG - Intergenic
957391991 3:79587031-79587053 AAATGGATTCTAAGAATAACTGG - Intronic
959771551 3:110104999-110105021 AAATGCACACTGAAACTTACTGG - Intergenic
959850583 3:111082202-111082224 AAATGCATGTGAAACCTTACTGG - Intronic
960183643 3:114612314-114612336 AATTAGATCCTAAAACTAACTGG - Intronic
960655073 3:119994415-119994437 TAATGCATACTAAAACTAGTTGG + Intronic
961310269 3:125993514-125993536 CAATGGATGCTAAAACTATGGGG + Intergenic
961631770 3:128306069-128306091 AAATGCATGACAAAACAAAGAGG - Intronic
962157940 3:132968655-132968677 AAATGCATGCTATAAGTGTCAGG + Intergenic
962633225 3:137301023-137301045 AAACGCATCCTAAAACTTAGTGG - Intergenic
963190119 3:142461231-142461253 TAATGGATGCTAAAATTAATAGG - Intronic
963717454 3:148820324-148820346 AAATGTATTCTCAAAATAACTGG + Intronic
964139718 3:153383683-153383705 ATATGCATATTAGAACTAACAGG - Intergenic
965560762 3:170060374-170060396 AAACGGATGCTAAAACTATCAGG + Intronic
965652683 3:170949881-170949903 AAATGCATGGTAGAATTCACCGG + Intergenic
965823954 3:172711859-172711881 AAATGAATGCTAAAACTAGAGGG + Intergenic
965852243 3:173042047-173042069 CAATTCATTCTAAAACTCACGGG + Intronic
965966965 3:174503933-174503955 AAATGCATTTTAAAAACAACTGG - Intronic
967996006 3:195167252-195167274 CAATGGAGGCTAAAACAAACAGG - Intronic
969039086 4:4280419-4280441 AAATCCATCCTAAAACTCACAGG + Intronic
972258964 4:37388993-37389015 TAATGCCTGCTAATACTAAAAGG + Intronic
972521147 4:39858230-39858252 AAATGCAACCTAAAATTCACAGG + Intronic
973928276 4:55762238-55762260 AAATTTATTCTAAAACTCACTGG + Intergenic
974712336 4:65615298-65615320 AAATGCCTGCTGAAACCAATTGG + Intronic
975896047 4:79092193-79092215 CAATGGATGTTAATACTAACAGG - Intergenic
976055302 4:81058488-81058510 ACATGCCTGCTAAAAATCACTGG - Intergenic
976377061 4:84357715-84357737 ATATGCATCTCAAAACTAACAGG - Intergenic
980222101 4:129930677-129930699 AAATGCATACTAAAAATAAGAGG + Intergenic
980948144 4:139343804-139343826 CAATGAATGCTAAAACTAGATGG - Intronic
981704372 4:147643534-147643556 CAATGGATGCTAAAACTAGTAGG + Intronic
981741949 4:148011843-148011865 CAATTAATGCTAAAACTAACTGG - Intronic
982912879 4:161166785-161166807 AAATGTATGATAAAAATCACAGG + Intergenic
983115493 4:163811051-163811073 AAAAGCAGGCAAAAACTGACAGG - Intronic
983885790 4:172979067-172979089 AAATCACTGCCAAAACTAACAGG - Intronic
984232316 4:177114154-177114176 AAATGCATTTTAAAACACACAGG + Intergenic
984929284 4:184832416-184832438 AAGTGCATGTTAAAACTAAAAGG - Intergenic
986120159 5:4827724-4827746 AAATGCATTCTAGTACTCACTGG - Intergenic
986834154 5:11616303-11616325 AAATGCATGAGAAAAATAAAAGG - Intronic
986988170 5:13522407-13522429 AAAGGAAGGCTAAACCTAACAGG - Intergenic
988036081 5:25829148-25829170 ACAGGGATGCTAAAACTAAGAGG - Intergenic
990916931 5:60917061-60917083 AACTGCATGATAGAACTAAAAGG + Intronic
991379968 5:66010519-66010541 CAATGCATGCTAAAACTAGTGGG - Intronic
991658346 5:68925761-68925783 CAATGGATGCTAAAACTAGTGGG + Intergenic
992200982 5:74383674-74383696 ATATTCATGATAAAACAAACAGG + Intergenic
993390618 5:87316302-87316324 AAATGCATTCTGAAACCAACTGG - Intronic
994899739 5:105756587-105756609 TGATGGATGCTAAAACTAATGGG + Intergenic
995967294 5:117922942-117922964 AACTCAATGCTAAAACAAACGGG + Intergenic
996280513 5:121724810-121724832 AAAAGCATACAAAAACTAGCTGG + Intergenic
999293312 5:150441761-150441783 ACATGCCATCTAAAACTAACTGG - Intergenic
1005123392 6:22417078-22417100 AAATGAATGAAAAAATTAACAGG - Intergenic
1005176451 6:23050824-23050846 CAATGCATTCTAAAAATCACTGG - Intergenic
1005564598 6:27078270-27078292 CAATGGGTGCTAAAACTAATAGG - Intergenic
1008376006 6:50792932-50792954 AAATGAATGTCAAAAGTAACTGG - Intergenic
1008412618 6:51198164-51198186 AAATACCATCTAAAACTAACTGG - Intergenic
1010935392 6:81854472-81854494 CAGTGCATGCTAAAACTACTGGG + Intergenic
1010942168 6:81931699-81931721 AAATCCATGGTAAAAGTAATGGG - Intergenic
1011347532 6:86388565-86388587 AAATGCAACCTAATACTCACAGG + Intergenic
1012071291 6:94620499-94620521 AGATGCATGCTAAAGTTAATAGG - Intergenic
1012144387 6:95663507-95663529 ATATGAAGGCTCAAACTAACTGG + Intergenic
1013353665 6:109328627-109328649 AACTGTATGCAAAAACTAATGGG - Intergenic
1013861957 6:114646490-114646512 AATTGTAAACTAAAACTAACTGG - Intergenic
1013936611 6:115603802-115603824 AAATTCATTTTAAAATTAACTGG + Intergenic
1014425428 6:121299497-121299519 ATGTGCATGCTAAAATTAAAAGG + Exonic
1017659813 6:156662943-156662965 TAATGCATTTTAAAACTTACAGG - Intergenic
1018022393 6:159773909-159773931 GAATGAATGCTAAAACTAGTGGG + Intronic
1020784063 7:12552088-12552110 AGATGCATGTTAAAACTCAAAGG + Intergenic
1020798803 7:12708169-12708191 CAATGAATGCTAAAACTAATGGG - Intergenic
1021364108 7:19754870-19754892 AAATGCCTGCTAAAAATGAGTGG - Intronic
1021395307 7:20140219-20140241 AAATGCGTGTTAAGACTTACAGG - Exonic
1022835372 7:34108607-34108629 AAATCCATGCTAAAGTTTACAGG - Intronic
1022876419 7:34536616-34536638 AAATAAAGGCTAAAACTAAATGG + Intergenic
1024167090 7:46746153-46746175 AAATGTCTGTTAAAACTAAAGGG - Intronic
1024720023 7:52125743-52125765 AAATGAATGTTAATATTAACAGG - Intergenic
1025218836 7:57086575-57086597 ATATACATGCTAACACTAAAAGG + Intergenic
1025652514 7:63483864-63483886 ATATACATGCTAACACTAAAAGG - Intergenic
1027982229 7:85239982-85240004 AAATGAATGTTAGACCTAACAGG - Intergenic
1028072131 7:86463681-86463703 GAATGCAAATTAAAACTAACTGG + Intergenic
1028736359 7:94217394-94217416 AATTGCATGCTATAACAAAAGGG + Intergenic
1028895515 7:96036865-96036887 AATTGCATGCAAAACTTAACAGG + Intronic
1029044324 7:97612127-97612149 AAATGCAGGCCAAAACAAAATGG - Intergenic
1029594907 7:101532497-101532519 AAATGCATTCTAAAAGAAAAAGG - Intronic
1030225708 7:107147756-107147778 AAATGCATGTCAAAACTAGTGGG - Intronic
1030494213 7:110276967-110276989 AAATGCAAATTAAAACTAAAGGG - Intergenic
1031692604 7:124808478-124808500 ACATGCATGCCAAAAATTACAGG - Intergenic
1032549919 7:132775395-132775417 AATTGCATGTTAAAACTAGGGGG - Intergenic
1033376880 7:140770119-140770141 AAATGCAAGGTAAAACAAAAAGG - Intronic
1035895099 8:3391054-3391076 CCATGCATGCTAACACTCACAGG - Intronic
1036505900 8:9355557-9355579 AAATACAAGCCTAAACTAACTGG - Intergenic
1037128205 8:15375372-15375394 AAATGCATGCTACTCATAACTGG - Intergenic
1037169272 8:15871453-15871475 AAATACAAGTAAAAACTAACAGG + Intergenic
1039202109 8:35106709-35106731 AAATGCATGAAAAAAAAAACAGG - Intergenic
1039399306 8:37255215-37255237 AATTTCAGGCTAAAACTAACAGG + Intergenic
1040585212 8:48734758-48734780 AAATAAATGCTAAAACCAACTGG - Intronic
1040769824 8:50960285-50960307 AAAGGCATGCTACATTTAACAGG - Intergenic
1040889025 8:52296053-52296075 AAATGCAAGCCAAACTTAACAGG + Intronic
1041816052 8:61972641-61972663 AAATGAATGCCAAAAATAAAAGG + Intergenic
1042105808 8:65325350-65325372 AAAAGCTTGCTAAAACTGATTGG + Intergenic
1042178022 8:66056629-66056651 ACCTGCATGCTAAACCTAAAGGG + Intronic
1042651250 8:71044053-71044075 AAATTCATGGCAAAACTCACTGG + Intergenic
1043103253 8:76074108-76074130 TAAAGCATGCTCAAACTGACTGG - Intergenic
1043280628 8:78461241-78461263 CAATGAAAGCTAAAACTAAAGGG - Intergenic
1044780006 8:95734407-95734429 GAATGCAGGCTGAAACCAACAGG + Intergenic
1045244417 8:100430426-100430448 CCATGCATGCTAAGACTAAGTGG - Intergenic
1045513184 8:102831332-102831354 CAATAGATGCTAAAACTAATGGG + Intronic
1046260635 8:111763088-111763110 AAATGCATTTTTAAACAAACTGG + Intergenic
1046280844 8:112028729-112028751 AAATGCATGAGTAAACTAACAGG - Intergenic
1047455874 8:125010724-125010746 AAATAAATGCTAAAAATATCAGG - Intronic
1048392135 8:133977303-133977325 AAATAAATCCTAAAACTAAAAGG + Intergenic
1050684682 9:8154572-8154594 AAATGCATGCAAAAGATTACAGG - Intergenic
1050910128 9:11057268-11057290 AAATGCATGTTAAAAATGGCAGG - Intergenic
1051309990 9:15759318-15759340 AAATGCATACTAAAACAAGAGGG - Intronic
1051553952 9:18361834-18361856 TAATGCAGGCTAAAACTTGCTGG - Intergenic
1051803173 9:20960494-20960516 TAGTGAATGCTAAAACTAATCGG - Intronic
1051885504 9:21888639-21888661 AAATGGATGCCAAAACAAGCAGG - Intronic
1055184882 9:73439082-73439104 CAATGGATGCTAAAACTAATTGG + Intergenic
1056031388 9:82557234-82557256 AAAGGCATGCAAAAAAGAACAGG - Intergenic
1056072669 9:83005388-83005410 AAATACATGGTAAAACTATGTGG + Intronic
1057970599 9:99553814-99553836 AAATGCATGAGAAAACTAGAAGG + Intergenic
1058502379 9:105634039-105634061 AAAAGAAAGCTAAAACTAGCAGG - Intronic
1058693270 9:107537068-107537090 AAATGCAAATTAAAACTACCAGG - Intergenic
1059125315 9:111679185-111679207 AAATGCATGACATAACTAAGAGG + Intergenic
1059307383 9:113365272-113365294 CAATGGATGCTAAAACTATTGGG - Intronic
1060063162 9:120479345-120479367 AAAAGGATGCTAAAACTAGTAGG + Intronic
1061657075 9:132100435-132100457 AAATGCATACAGGAACTAACAGG - Intergenic
1185652593 X:1659786-1659808 AAATGCATACAGACACTAACAGG - Intergenic
1185966164 X:4606533-4606555 AAATGACTGCTTAAACTAAAGGG + Intergenic
1186281883 X:8002077-8002099 AAATGCATGCTAAAATATTCAGG - Intergenic
1186391682 X:9166332-9166354 AAATGCAAGTTAAAACTACATGG - Intergenic
1186450045 X:9664607-9664629 AAAAGCATTCTAAGACTCACTGG - Intronic
1187794751 X:22991134-22991156 AAATACCTCCTAGAACTAACAGG - Intergenic
1188554612 X:31397926-31397948 AAATGCATGAACAAAGTAACGGG + Intronic
1190124122 X:47688194-47688216 AAATGGATGCTAAAATTTGCAGG - Intergenic
1192576791 X:72249234-72249256 AAATGCAATTTAAAACTAAAAGG + Intronic
1194429616 X:93785211-93785233 ACATGCATGTTGAAAATAACAGG + Intergenic
1195383122 X:104289682-104289704 AAATGCATTCTAAGAGTAATGGG + Intergenic
1196965036 X:121046635-121046657 TAATGCATGTTAAAAATCACAGG - Intergenic
1198239280 X:134767187-134767209 CAATGAATGCTAAAACTAGGGGG + Intergenic
1198386546 X:136134535-136134557 CAATGAATGCTGAAACTATCAGG + Intergenic
1199049970 X:143226127-143226149 ACATGCCTACTAAAACTAACAGG + Intergenic
1200420270 Y:2957462-2957484 ACATGAATGTTAAAAATAACAGG - Intronic
1201440117 Y:13999347-13999369 AAATGCATGCTAAAATATTCAGG - Intergenic
1201444454 Y:14043361-14043383 AAATGCATGCTAAAATATTCAGG + Intergenic
1202194286 Y:22281266-22281288 AAATTCATATTAAAAGTAACAGG - Intergenic