ID: 934965434

View in Genome Browser
Species Human (GRCh38)
Location 2:98717450-98717472
Sequence GAGTCCAATCTAGGATCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934965434_934965438 -1 Left 934965434 2:98717450-98717472 CCATGGGATCCTAGATTGGACTC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 934965438 2:98717472-98717494 CTGGCACAGAAGGACATTAGTGG 0: 1
1: 1
2: 0
3: 19
4: 150
934965434_934965441 24 Left 934965434 2:98717450-98717472 CCATGGGATCCTAGATTGGACTC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 934965441 2:98717497-98717519 ACTCTGGTGAAATTCAAATAAGG 0: 1
1: 0
2: 5
3: 49
4: 240
934965434_934965439 0 Left 934965434 2:98717450-98717472 CCATGGGATCCTAGATTGGACTC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 934965439 2:98717473-98717495 TGGCACAGAAGGACATTAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 116
934965434_934965440 8 Left 934965434 2:98717450-98717472 CCATGGGATCCTAGATTGGACTC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 934965440 2:98717481-98717503 AAGGACATTAGTGGGAACTCTGG 0: 1
1: 1
2: 14
3: 82
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934965434 Original CRISPR GAGTCCAATCTAGGATCCCA TGG (reversed) Intronic
905244531 1:36603352-36603374 AAGGCAAATCTTGGATCCCAGGG + Intergenic
906183097 1:43838417-43838439 GAGTCCTTTCCAGGAACCCATGG - Intronic
909483731 1:76151817-76151839 GACTCCCATCTAGCATCCCTGGG - Intronic
912233446 1:107822215-107822237 GAGATCAATCTTGGAGCCCATGG + Intronic
913971918 1:143422775-143422797 GGGTCAAGTCTATGATCCCACGG - Intergenic
914066297 1:144248388-144248410 GGGTCAAGTCTATGATCCCACGG - Intergenic
914112856 1:144717966-144717988 GGGTCAAGTCTATGATCCCACGG + Intergenic
917663404 1:177199980-177200002 GAATACATTCTAGGATACCATGG - Intronic
919776990 1:201200572-201200594 GACACCAACCTGGGATCCCAGGG - Intronic
1063971372 10:11383365-11383387 GAATCACATCTAGGGTCCCACGG + Intergenic
1067449174 10:46370928-46370950 GAGCCCCATCTAGGATGCCCAGG + Intronic
1067588196 10:47489837-47489859 GAGCCCCATCTAGGATGCCCAGG - Intronic
1067635320 10:47997928-47997950 GAGCCCCATCTAGGATGCCCAGG - Intergenic
1068582568 10:58758887-58758909 AAGTCCAATTTAGCTTCCCAAGG + Intronic
1077307939 11:1876261-1876283 GGGTCAAGTCTAGGACCCCAGGG + Intronic
1079075473 11:17382974-17382996 GTTTCCAATCTGGGATCTCAGGG + Intergenic
1088540387 11:110907713-110907735 GAGTGCAATCTAGTATTACATGG + Intergenic
1096281541 12:50258988-50259010 GACTCCAGTCTAGCATCACAAGG + Intronic
1096840775 12:54378353-54378375 GTGTCCAAGCCAGCATCCCAGGG - Intronic
1101585977 12:106086311-106086333 GCATCCAATCTAGGGTACCACGG - Intronic
1104050339 12:125190268-125190290 GACTCCATACAAGGATCCCAAGG + Intronic
1117496336 14:56309235-56309257 GAGTGAAATCTAGGCTCCTAAGG + Intergenic
1122367039 14:101200482-101200504 GAATGGAATCGAGGATCCCAGGG + Intergenic
1129320252 15:74770823-74770845 GAGGCCAATCCAGGATCCCCAGG + Intergenic
1142342117 16:89530560-89530582 GTCTCCATCCTAGGATCCCAAGG - Intronic
1143112552 17:4560457-4560479 GACTCCAAGCTTGGCTCCCAGGG + Exonic
1146476277 17:33165118-33165140 GGGTCCAGAATAGGATCCCAGGG - Intronic
1148519160 17:48253226-48253248 GAGTCCCCTCTAAGATTCCAGGG + Intronic
1148579788 17:48735537-48735559 GAGTCCTATCCAGTATCCCAGGG - Intergenic
1149623254 17:58061702-58061724 GAGGACAACCTAGGACCCCAGGG - Intergenic
1161201204 19:3015800-3015822 CAATGCAATCTAGGAGCCCAGGG - Intronic
1165486051 19:36096856-36096878 GAGTCAAATATCGCATCCCACGG + Intronic
1166081362 19:40445755-40445777 GGATCCATTCTAGGATTCCATGG + Intergenic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
926961929 2:18366616-18366638 GAGTTACATCTAGGATCTCAAGG + Intergenic
934176610 2:89583707-89583729 GGGTCAAGTCTATGATCCCACGG - Intergenic
934609678 2:95725565-95725587 GAGTCCAAAGTACCATCCCAGGG - Intergenic
934965434 2:98717450-98717472 GAGTCCAATCTAGGATCCCATGG - Intronic
942373186 2:175308302-175308324 CAGTACAATCCAGCATCCCATGG + Intergenic
943965100 2:194321971-194321993 GCGTCCATTCAGGGATCCCAAGG - Intergenic
1173342504 20:42165142-42165164 GTGATGAATCTAGGATCCCAAGG - Intronic
1174943046 20:54953243-54953265 GAGTGCAATCTTGGTTGCCAAGG + Intergenic
1183804719 22:40198684-40198706 GATTCCGATCTAGCATCACAGGG - Intronic
949174654 3:1045265-1045287 GATTCCAAACTGGGAACCCAAGG + Intergenic
952433042 3:33244555-33244577 GATTCCAATCTAGCAACCCAGGG - Intergenic
953083456 3:39643488-39643510 GAATCCAATGGTGGATCCCAGGG - Intergenic
955570616 3:60301020-60301042 GAGTCCATTCTAGATTCCCCCGG + Intronic
961936422 3:130589344-130589366 GACTCCAATTTAGAATGCCAAGG - Intronic
963769215 3:149372082-149372104 GACCCCAATCTAGGATTACATGG + Intronic
964612361 3:158627871-158627893 GAGTCCAATCTACGATTCCGTGG - Intergenic
965117434 3:164510170-164510192 TAGTCCAATCCACGATACCATGG - Intergenic
966569897 3:181429865-181429887 AAGTCTAATGTAGGATACCAAGG + Intergenic
969918982 4:10519229-10519251 GAGTCCAGTCAAGCACCCCAGGG - Intronic
970307259 4:14746439-14746461 ATGTGCAATCTAGGACCCCATGG - Intergenic
971171040 4:24233008-24233030 GTGTCCACACAAGGATCCCAAGG + Intergenic
977324194 4:95554161-95554183 GGTTCCACTCTAGGATCCCTAGG + Intergenic
988139375 5:27216641-27216663 GCTTCCAAGCTTGGATCCCAAGG + Intergenic
998484052 5:142486401-142486423 GAGTGCAAACCATGATCCCAGGG - Intergenic
999804422 5:155068616-155068638 GAGTCGAATGTAGGTTACCAGGG - Intergenic
1006313846 6:33279033-33279055 GAGGCCATTCTAGGATCGGAGGG - Intronic
1008588108 6:52967320-52967342 GAGCCTAATTTAGAATCCCATGG - Intergenic
1015810930 6:137161622-137161644 GAGTCCAATCAAGGATCTGTTGG - Intronic
1017251202 6:152281836-152281858 GAGTCCACCCAAGGAGCCCATGG - Exonic
1021737558 7:23654549-23654571 GAGTCCAATCTCTGGTTCCATGG + Intergenic
1030802204 7:113865743-113865765 AATTACAATCTATGATCCCAAGG + Intergenic
1037034985 8:14155116-14155138 GAATCCAATCTAGAATCACGTGG + Intronic
1039305038 8:36252154-36252176 GAGTCCTATATAGGTTCCCCAGG + Intergenic
1041124440 8:54621270-54621292 GAGTCCTACCTATGTTCCCACGG + Exonic
1045041659 8:98230289-98230311 GAGACCAGTCAAGGACCCCAGGG - Intronic
1058166251 9:101622581-101622603 GATCCCAAACAAGGATCCCAAGG + Intronic
1060164609 9:121399904-121399926 GGATCCAATCTGGGGTCCCACGG + Intergenic
1062105946 9:134754863-134754885 GAGCACAATCTGGGCTCCCAGGG - Intronic
1187265597 X:17729798-17729820 GAGTTCCATCTAGGTTCCCGAGG - Intronic
1188886669 X:35559955-35559977 GAGTCTAATCTGTGATCCAAGGG - Intergenic
1191947746 X:66554020-66554042 GAGTCCAAGCTAAGATCCACTGG + Intergenic
1192142693 X:68659256-68659278 GAGTCCAAGCTATGGGCCCAGGG - Intronic
1198103552 X:133441697-133441719 GAGTCAAAACTGGGATGCCATGG + Intergenic