ID: 934966796

View in Genome Browser
Species Human (GRCh38)
Location 2:98730926-98730948
Sequence GGCTGGCGGCCCCGGGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 549}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934966796 Original CRISPR GGCTGGCGGCCCCGGGCTGC GGG (reversed) Intronic