ID: 934972121

View in Genome Browser
Species Human (GRCh38)
Location 2:98772234-98772256
Sequence GTGGCACGTTAGCAAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934972121_934972124 19 Left 934972121 2:98772234-98772256 CCTTCCATTTGCTAACGTGCCAC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 934972124 2:98772276-98772298 CTCTGATCTCACTCCTCCAGTGG 0: 1
1: 0
2: 2
3: 15
4: 240
934972121_934972125 25 Left 934972121 2:98772234-98772256 CCTTCCATTTGCTAACGTGCCAC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 934972125 2:98772282-98772304 TCTCACTCCTCCAGTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934972121 Original CRISPR GTGGCACGTTAGCAAATGGA AGG (reversed) Intergenic
901705693 1:11071367-11071389 GTGGCATGTGAGAAAAGGGAAGG - Intronic
905991789 1:42343758-42343780 GTGGTGTGTTAGCAAAAGGAGGG - Intergenic
906841059 1:49139661-49139683 GTGTCAAGTGAACAAATGGATGG + Intronic
907407219 1:54261014-54261036 GTGGCCCGTTGGGAAATGGCAGG - Intronic
913014886 1:114722700-114722722 GCAGCACGTTAGGAGATGGAAGG + Intronic
918419646 1:184351634-184351656 GTGGCAATTTAGCGAAAGGAAGG + Intergenic
922337280 1:224627965-224627987 GTTGCTGGTCAGCAAATGGAGGG + Intronic
923188379 1:231596268-231596290 TTGACACCTTAGGAAATGGAGGG + Intronic
1067280975 10:44872461-44872483 GTGGGAAGTTAAAAAATGGATGG - Intergenic
1067839350 10:49663664-49663686 GTGGCATTTTAGTAAATTGATGG - Intronic
1070748590 10:78950378-78950400 GTTGCAGGTGTGCAAATGGATGG + Intergenic
1071979344 10:90987930-90987952 CTGGGACAATAGCAAATGGATGG - Intergenic
1080966952 11:37224413-37224435 GTGGTACCTGAGCAAGTGGAGGG + Intergenic
1083463767 11:62832172-62832194 GTGGCGCCTTAGCCAATGGGAGG - Intergenic
1090422002 11:126581845-126581867 GTGGCACGGAAGGGAATGGAAGG + Intronic
1093662329 12:21772101-21772123 GTAGTTCCTTAGCAAATGGAAGG + Intronic
1118289716 14:64508371-64508393 GTGGGGAGTTAGCAGATGGAAGG + Intronic
1118622073 14:67622578-67622600 GTGGCAAGTTAACTAATGGGAGG + Intronic
1120685143 14:87529258-87529280 GTGATACGTTAGCAATGGGAGGG - Intergenic
1121879416 14:97486831-97486853 GTGGCTCTTTAGGAAAGGGAGGG + Intergenic
1131892055 15:96983744-96983766 GTGGCACAATTGCAAATCGAGGG - Intergenic
1134742904 16:16563963-16563985 GTGGCACGAGAGCAGATGCAGGG - Intergenic
1134924656 16:18148497-18148519 GTGGCACGAGAGCAGATGCAGGG + Intergenic
1136530629 16:30866274-30866296 CTAGCAGGTTAGCAAAGGGAAGG + Intronic
1137791508 16:51178675-51178697 CTGGCATGTTACCAAATAGAAGG + Intergenic
1141690001 16:85591306-85591328 GTGACAGGGTAGCAACTGGAGGG - Intergenic
1152005138 17:77675898-77675920 GGGGGAGGTCAGCAAATGGAGGG - Intergenic
1156198551 18:34804153-34804175 GTGGCATCTTGACAAATGGATGG + Intronic
1160222708 18:76988960-76988982 GGAGCCCGTTAGGAAATGGACGG - Intronic
1161329136 19:3678137-3678159 ATGGCAGGATAGAAAATGGAGGG + Intronic
1162843371 19:13372478-13372500 GTGGCTCTTTAACAAATGGCAGG + Intronic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
927869545 2:26614863-26614885 GAGGCAGTTTAGCAAATGGAAGG - Intronic
930182554 2:48377758-48377780 TTGGTATGTTAGCAAGTGGAAGG - Exonic
932414602 2:71566030-71566052 GTGGCATGTGAGCAGGTGGATGG - Intronic
933247091 2:79987553-79987575 CTGGGACTTTAGTAAATGGAAGG + Intronic
934972121 2:98772234-98772256 GTGGCACGTTAGCAAATGGAAGG - Intergenic
935549259 2:104434622-104434644 GCAGCACGGGAGCAAATGGAAGG - Intergenic
1168876271 20:1174322-1174344 GGGGGAGGTTAGCAAGTGGAAGG - Intronic
1170059045 20:12240357-12240379 ATGGGAAGTTAGCAAATGGGAGG - Intergenic
1172992567 20:39047468-39047490 GTGGCACCTGTGCACATGGAAGG - Intergenic
1173197452 20:40927705-40927727 GTGGCATGTCAGGAAATGAAGGG - Intergenic
1176034726 20:63030662-63030684 GTGACACGTTAGCAATGGGAGGG - Intergenic
950872210 3:16239320-16239342 GTGGGAAGTTGGCAGATGGATGG + Intergenic
951693144 3:25418032-25418054 GGGGCAAGATAGCAAGTGGAAGG + Intronic
953091009 3:39726136-39726158 GTCACATGTCAGCAAATGGATGG - Intergenic
955552878 3:60102919-60102941 ATGGCACCTTCGCAAATGCATGG - Intronic
958443535 3:94185884-94185906 GAGTCACTATAGCAAATGGAAGG - Intergenic
962916465 3:139908791-139908813 GTGGGACGTTAGTAATAGGAAGG - Intergenic
963801428 3:149679825-149679847 GTGGCAGGCTTGCAGATGGAAGG - Intronic
969474108 4:7411538-7411560 GTGGATGGATAGCAAATGGAAGG - Intronic
971390163 4:26178301-26178323 ATGGCCCCTTATCAAATGGAGGG + Intronic
972428268 4:38955669-38955691 GTGTCATATTAACAAATGGATGG + Intergenic
981776365 4:148372632-148372654 GTGGCTTGTTTCCAAATGGAAGG + Intronic
981944890 4:150330216-150330238 GTGGCATGGTAGAAAATGTAAGG - Intronic
983406333 4:167335692-167335714 GTGGCCCGCTAGCACATGGGAGG + Intergenic
984222425 4:176994505-176994527 GTTGCACTTTAGTAAAGGGAAGG + Intergenic
987428295 5:17798641-17798663 GAGGTACATTATCAAATGGAGGG - Intergenic
990068011 5:51742300-51742322 GGGGCACATTAGCATATGAAGGG - Intergenic
990617576 5:57523068-57523090 TTGGCTTGTTTGCAAATGGAAGG + Intergenic
992609107 5:78492097-78492119 GTGGCACCTTAGGACCTGGAGGG - Intronic
994817151 5:104598452-104598474 CTGGCAAGTTTCCAAATGGAAGG - Intergenic
995950976 5:117713648-117713670 GTGGCATGAAAGCAAATGTACGG - Intergenic
996359376 5:122628557-122628579 TTGCCATGTTAGCAAATGAAAGG - Intergenic
1008373052 6:50758401-50758423 GTGGGACATTGGGAAATGGAAGG - Intronic
1008699755 6:54084793-54084815 GAGTCACGGGAGCAAATGGATGG + Intronic
1011893570 6:92196565-92196587 GTGACACATTAACAAATGGATGG - Intergenic
1018584616 6:165343423-165343445 GTGGCCCGTTACAAAATTGACGG - Exonic
1018947226 6:168356372-168356394 GAGGCACGGAAGCAAAGGGAAGG - Intergenic
1031335070 7:120518996-120519018 GTTGCTGGTTTGCAAATGGAGGG + Intronic
1034625496 7:152489075-152489097 GTGGCACGTTAGAATAAAGATGG - Intergenic
1036481310 8:9141977-9141999 GTGGCACATTTGCCAACGGAAGG - Intronic
1037464137 8:19142643-19142665 ATAGCACTGTAGCAAATGGAAGG + Intergenic
1041957601 8:63573270-63573292 GTGGCACAACAGCATATGGAAGG + Intergenic
1047796962 8:128267532-128267554 GTGGCAGGTGAGCAAAAGGAGGG + Intergenic
1051418224 9:16865077-16865099 GGGGCACTTTGGCAAATGTAAGG + Intronic
1052339941 9:27355051-27355073 TTTGCACGTTAGTAAATGCAGGG + Intronic
1060822230 9:126668096-126668118 CTGGCAGGTTAGGAAACGGAGGG + Intronic
1188226368 X:27602950-27602972 TTTGCACATTAGCAAATGAAAGG - Intronic
1196296649 X:114004891-114004913 GGGGCACATTAGAAAATGTAGGG - Intergenic
1200906241 Y:8485565-8485587 GTTGCAGGTGAGCTAATGGAAGG - Intergenic
1201199123 Y:11523255-11523277 ATGGAATGTTACCAAATGGAAGG + Intergenic
1201210918 Y:11679835-11679857 ATGGCATGTTATCCAATGGAAGG + Intergenic
1202304777 Y:23457175-23457197 GTGGCTTGTTAGCTAATTGAAGG - Intergenic
1202566033 Y:26213416-26213438 GTGGCTTGTTAGCTAATTGAAGG + Intergenic