ID: 934972371

View in Genome Browser
Species Human (GRCh38)
Location 2:98773831-98773853
Sequence TCACCCCGATGCCTTGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934972371_934972374 -4 Left 934972371 2:98773831-98773853 CCCTGGGCAAGGCATCGGGGTGA No data
Right 934972374 2:98773850-98773872 GTGACTGTTGCGGAGTGTCCAGG No data
934972371_934972375 6 Left 934972371 2:98773831-98773853 CCCTGGGCAAGGCATCGGGGTGA No data
Right 934972375 2:98773860-98773882 CGGAGTGTCCAGGCTCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934972371 Original CRISPR TCACCCCGATGCCTTGCCCA GGG (reversed) Intergenic