ID: 934972371 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:98773831-98773853 |
| Sequence | TCACCCCGATGCCTTGCCCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 934972371_934972374 | -4 | Left | 934972371 | 2:98773831-98773853 | CCCTGGGCAAGGCATCGGGGTGA | No data | ||
| Right | 934972374 | 2:98773850-98773872 | GTGACTGTTGCGGAGTGTCCAGG | No data | ||||
| 934972371_934972375 | 6 | Left | 934972371 | 2:98773831-98773853 | CCCTGGGCAAGGCATCGGGGTGA | No data | ||
| Right | 934972375 | 2:98773860-98773882 | CGGAGTGTCCAGGCTCTCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 934972371 | Original CRISPR | TCACCCCGATGCCTTGCCCA GGG (reversed) | Intergenic | ||