ID: 934975299

View in Genome Browser
Species Human (GRCh38)
Location 2:98798041-98798063
Sequence CCAACTCTATATGGTTTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934975299_934975307 17 Left 934975299 2:98798041-98798063 CCTTTGAAACCATATAGAGTTGG 0: 1
1: 0
2: 0
3: 20
4: 139
Right 934975307 2:98798081-98798103 TGCCTGTAATCCCAACTCTCTGG 0: 2
1: 340
2: 11936
3: 128640
4: 322955
934975299_934975312 29 Left 934975299 2:98798041-98798063 CCTTTGAAACCATATAGAGTTGG 0: 1
1: 0
2: 0
3: 20
4: 139
Right 934975312 2:98798093-98798115 CAACTCTCTGGAAGGCCAAGAGG 0: 1
1: 0
2: 13
3: 255
4: 2140
934975299_934975305 -10 Left 934975299 2:98798041-98798063 CCTTTGAAACCATATAGAGTTGG 0: 1
1: 0
2: 0
3: 20
4: 139
Right 934975305 2:98798054-98798076 ATAGAGTTGGCCGGGTGCGGTGG 0: 2
1: 12
2: 203
3: 1486
4: 8782
934975299_934975313 30 Left 934975299 2:98798041-98798063 CCTTTGAAACCATATAGAGTTGG 0: 1
1: 0
2: 0
3: 20
4: 139
Right 934975313 2:98798094-98798116 AACTCTCTGGAAGGCCAAGAGGG 0: 1
1: 0
2: 67
3: 1297
4: 15638
934975299_934975309 21 Left 934975299 2:98798041-98798063 CCTTTGAAACCATATAGAGTTGG 0: 1
1: 0
2: 0
3: 20
4: 139
Right 934975309 2:98798085-98798107 TGTAATCCCAACTCTCTGGAAGG 0: 1
1: 38
2: 2376
3: 45461
4: 356691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934975299 Original CRISPR CCAACTCTATATGGTTTCAA AGG (reversed) Intronic
902811655 1:18891417-18891439 CCATCTCTCTCTGGTGTCAATGG + Intronic
904997596 1:34643067-34643089 CCAAGTCTCTATGATTTCAAAGG - Intergenic
905682696 1:39885494-39885516 CCAGCTCTATATGACTCCAAAGG - Intergenic
909244872 1:73268942-73268964 CCCACTCTCTGTGGTTTCAATGG - Intergenic
911008258 1:93250910-93250932 CCCACTCTATGTGTTTTAAATGG + Intronic
917003968 1:170391111-170391133 CCAACTCTATAGGAATTAAAAGG - Intergenic
921282719 1:213583461-213583483 GCAAATCTATATGGTGTCCATGG - Intergenic
924756254 1:246943955-246943977 CCTACTCCATCTTGTTTCAATGG + Intergenic
1063636696 10:7788699-7788721 CCAGCACTACAGGGTTTCAAAGG - Intronic
1069354549 10:67568820-67568842 CAGCCTATATATGGTTTCAAAGG + Intronic
1070171529 10:73936683-73936705 CCAAATATATCTGGTTCCAAGGG - Intergenic
1073532152 10:104242710-104242732 CCAACTCCATTTGGTTCCAGGGG - Intronic
1073725682 10:106227382-106227404 CCAACTCTATATGGATGCTAGGG + Intergenic
1074237546 10:111601144-111601166 CTATCTTTATATAGTTTCAAAGG + Intergenic
1074478809 10:113799368-113799390 CCAACTCTATGTGCTTTTTATGG - Intergenic
1078504853 11:11929179-11929201 ACAGATATATATGGTTTCAAAGG + Intronic
1079876452 11:25863604-25863626 CCAATTTGATATTGTTTCAAAGG - Intergenic
1080016256 11:27509843-27509865 CCAACTGTATTAGGTTTCTAGGG + Intergenic
1080577598 11:33614336-33614358 CCTGCTCTATATGGTCTCACAGG + Intronic
1080593222 11:33742463-33742485 CCAGCTCAGTATGGTTTTAATGG + Intronic
1081370735 11:42299097-42299119 ATAACACTATATGGTTTCACAGG + Intergenic
1082645418 11:55718706-55718728 CCAACAATATATGTTTTCAAGGG + Intergenic
1082724178 11:56715383-56715405 GCATCTCTAGATGGGTTCAATGG - Intergenic
1083102754 11:60327071-60327093 CCAAATATATATGGTTTCTATGG + Intergenic
1088673226 11:112164594-112164616 CAAGCTCAATATGGTGTCAAAGG + Intronic
1091431896 12:443102-443124 CCAACACTAGATGATTTCAAAGG - Intergenic
1093186556 12:16026695-16026717 CCAGCTCTAGATGGCTTCATTGG + Intronic
1098580072 12:72089076-72089098 GCAACTCTATCTAGTTTCCAAGG + Intronic
1099055489 12:77834514-77834536 ACAAGTCTGTATGGATTCAATGG + Intronic
1099296168 12:80830768-80830790 CCAAGTCTTTAAGGTTTGAAGGG - Intronic
1102428482 12:112862986-112863008 CCAGCTCTATCTGGGTTCACTGG + Intronic
1102562290 12:113770614-113770636 CCAACTCTTTTTGGTGTCAAAGG + Intergenic
1105335312 13:19461962-19461984 CCAACTCTATATCTTTTAATTGG + Intronic
1105859606 13:24397427-24397449 CCAACTCTATATCTTTTAATTGG - Intergenic
1106283106 13:28295066-28295088 CCAACGTTACATGATTTCAAGGG - Intronic
1106715101 13:32380312-32380334 TCAATTCTATATTATTTCAAGGG + Intronic
1107756312 13:43626652-43626674 CATACTCTATACGGTTTCAATGG + Intronic
1108630521 13:52277310-52277332 CCAACTCTATATCTTTTAATTGG + Intergenic
1110108014 13:71704232-71704254 TCAACTCTATGTTGTCTCAAAGG - Intronic
1112110712 13:96295203-96295225 GCAAATCTGTAAGGTTTCAATGG - Intronic
1112278801 13:98044790-98044812 CCAAGGCCATCTGGTTTCAAAGG + Intergenic
1113569498 13:111343692-111343714 CCAAGTCTATTTGGTAACAATGG - Intronic
1116702778 14:48261699-48261721 CCAAAACTATATGGCTTCACGGG - Intergenic
1121699066 14:95938294-95938316 TCTACTCTATCTGGTTTAAATGG + Intergenic
1124133015 15:27006801-27006823 CCAACTCTATGTTGTTGTAAAGG + Intronic
1130286001 15:82555189-82555211 CCATCTCTATATATTTTAAAAGG - Intronic
1137032872 16:35541001-35541023 TCAACTCAATATGGATTAAAAGG + Intergenic
1141359203 16:83379215-83379237 ACAACTGTATATGGTTTAGAAGG + Intronic
1142586330 17:976733-976755 CCACATCTCTTTGGTTTCAAGGG + Intronic
1144960343 17:19041095-19041117 CCAACTGGATATGCTTTAAATGG - Intronic
1144974816 17:19133429-19133451 CCAACTGGATATGCTTTAAATGG + Intronic
1149293232 17:55237220-55237242 CCAACTCTAAGTGGCTTGAACGG - Intergenic
1151076175 17:71275352-71275374 CCAACACTAAATGGTTCTAAAGG + Intergenic
1153456556 18:5288876-5288898 CCATGACTATGTGGTTTCAAAGG + Intergenic
1153574405 18:6506408-6506430 CCAAAGCTGTAGGGTTTCAAAGG - Intergenic
1155089920 18:22497276-22497298 CCATCTCCAGATGGTTTCACTGG + Intergenic
1155218085 18:23661173-23661195 CCACCTTTATATGGTTCCACTGG + Intronic
1157854312 18:51091288-51091310 CCATTTCTATATGCTTTCACTGG - Intergenic
1158058902 18:53314856-53314878 CCTACTGTATATGGTTGGAAGGG + Intronic
1159516398 18:69463892-69463914 TTAACTTTATTTGGTTTCAATGG - Intronic
1161198192 19:2998998-2999020 CCAACCCTTTATATTTTCAAAGG - Intronic
1165587008 19:36925923-36925945 CCAATTCTACATGGTTTCCTAGG + Intronic
1166371902 19:42306602-42306624 CCAACTGTATAAGTTTTCTAGGG + Intronic
1168206228 19:54852377-54852399 CCAACTGTATTTGGGGTCAAGGG + Intronic
926587500 2:14704299-14704321 CCAACTCAAGATGGAATCAATGG - Intergenic
926875311 2:17470130-17470152 CCTAGCCTATATGGTTTCCATGG + Intergenic
932520018 2:72402109-72402131 CCAAGACTAGATGGTTTCAGTGG - Intronic
933563225 2:83915392-83915414 CCAAGTCTATATGGCTTTATTGG - Intergenic
933853403 2:86390141-86390163 CCAACTCCACATGGCTTCACTGG - Intergenic
934880753 2:97975650-97975672 CCAAGCCTAGATGGCTTCAATGG + Intronic
934975299 2:98798041-98798063 CCAACTCTATATGGTTTCAAAGG - Intronic
935386956 2:102509908-102509930 CAAGCTCTATTTGGTTCCAAGGG + Intronic
942734962 2:179099150-179099172 TCAACTCTATATATTTTCAAAGG + Intergenic
944165956 2:196721402-196721424 CCAACTAATTATTGTTTCAATGG + Intronic
945006269 2:205410834-205410856 CAAACTCTATATGATTTGAAAGG + Intronic
945466477 2:210175440-210175462 CCAGCTCTTTATCCTTTCAAAGG - Intergenic
945718982 2:213394833-213394855 CCAAGTCCATATGGTTTCACTGG - Intronic
947919393 2:233856059-233856081 ACAACTCTATCTGGTAACAATGG - Intergenic
1171111570 20:22488477-22488499 CCAATCCCAGATGGTTTCAATGG - Intergenic
1171118226 20:22545698-22545720 CCTATTTTATATGGTTTCTAGGG - Intergenic
1171122222 20:22577548-22577570 ACAACTTTATGAGGTTTCAAGGG + Intergenic
1172747611 20:37224837-37224859 CCAACTCTATGTGATTTAAAAGG - Intronic
1173035671 20:39407220-39407242 CTAACTCTAGATGGTCTCTATGG - Intergenic
1173642115 20:44610640-44610662 CTAAGTCTATATTTTTTCAATGG - Intronic
1176100658 20:63362998-63363020 CCAACCCTCGATGGTTTCAAGGG + Intronic
1176738264 21:10573025-10573047 CCAACTCTATATCTTTTAATTGG - Intronic
1177657638 21:24039834-24039856 CCAACTGGATATGATTCCAAAGG + Intergenic
951684074 3:25325170-25325192 GCTACACTATATGGTTTAAAAGG - Intronic
951790895 3:26483514-26483536 CCAACCTCATATGTTTTCAAAGG + Intergenic
952223079 3:31344352-31344374 CCAAGTCCAGATGGTTTCACAGG + Intergenic
953831972 3:46306904-46306926 CCAGGTCTATATGGTTTCACTGG - Intergenic
954963156 3:54584013-54584035 CCAATCCTACATGGTTTCAGTGG + Intronic
955618890 3:60839752-60839774 CCAACTCTAGATGCTTCTAAGGG - Intronic
955796742 3:62645140-62645162 CCAAAGCTATAAGGATTCAAAGG + Intronic
957963072 3:87285171-87285193 TTAACTCTATATACTTTCAAGGG + Intergenic
958010497 3:87872822-87872844 CCAACACTAGATGGCTTCACAGG + Intergenic
960848825 3:122030546-122030568 CCAACTATGGATGGTTTTAATGG + Intergenic
962992715 3:140593533-140593555 CCAACTCTATGAGCTTTCTATGG + Intergenic
966222478 3:177564641-177564663 CCCACTCCATGTGGTTTAAATGG - Intergenic
967447324 3:189581975-189581997 TCAAATCCATATTGTTTCAAAGG + Intergenic
967753669 3:193143541-193143563 CCAACTCCTTATACTTTCAAGGG + Intergenic
972403741 4:38727969-38727991 CCAATTCAATATGGTCACAACGG + Intergenic
972623074 4:40768083-40768105 CCAACTCTATCTGCCTTCTAGGG + Intronic
976481342 4:85549905-85549927 CCAGCTCTATGTTGTTGCAAAGG + Intronic
978406738 4:108387441-108387463 CCAAATCCAGATGGTTTCACTGG + Intergenic
980788175 4:137581522-137581544 CCACCTTTATGTGGGTTCAAGGG - Intergenic
981477444 4:145201060-145201082 CCAACTGTATATGGTGCCTAAGG + Intergenic
985515209 5:340143-340165 CCAGGTCTAAATGGTTTCACTGG - Intronic
986318196 5:6605314-6605336 GCAGCTCTACATGGTTTCTAAGG - Exonic
987878763 5:23713664-23713686 GCAACTCTATATGTTTTAAGTGG - Intergenic
989755216 5:44944180-44944202 CCAAATCTCAATGGTTTCTATGG - Intergenic
990497753 5:56365840-56365862 TCAACTACATATGGTATCAAGGG - Intergenic
990611667 5:57463473-57463495 CCAACTTTATATAATTTCCATGG + Intergenic
992481835 5:77159061-77159083 CCTACTCTATGTGGTCTCAATGG + Intergenic
993579381 5:89640140-89640162 TCATCTCTATATGGTTTCTTTGG - Intergenic
995410936 5:111856183-111856205 CCAAATCTAGCTGCTTTCAAAGG + Intronic
996127458 5:119743069-119743091 CCAACAAATTATGGTTTCAATGG - Intergenic
998779564 5:145641363-145641385 CCATCTCTTTATGGTATTAATGG - Intronic
998944089 5:147318800-147318822 CCAAATCCATATGCTTTTAAAGG + Intronic
999929962 5:156421109-156421131 ACAACTCCAAATGGTCTCAATGG + Intronic
1001161224 5:169316467-169316489 CCAAGCCTAGATGGTTTCACTGG + Intergenic
1001635873 5:173210041-173210063 CCAACTCTATTTATTTTAAATGG - Intergenic
1001804473 5:174571456-174571478 CCAACTCAAAATGGTTTAAAAGG - Intergenic
1003771649 6:9310342-9310364 CCATCACTATTTGGTTTCATAGG + Intergenic
1004112208 6:12730019-12730041 CAAACTCAATATGCTTTAAATGG - Intronic
1006292624 6:33151675-33151697 CCATCTCAAGATGGTTTTAATGG - Intergenic
1009835918 6:69001637-69001659 CCAAATCTAAACTGTTTCAAGGG - Intronic
1009973667 6:70651229-70651251 CCAACTCTATATCACTTCAATGG + Intergenic
1010347760 6:74832253-74832275 CCAGGTCTAGATGGTTTCATAGG - Intergenic
1012135422 6:95550042-95550064 CCAATTATATGTGGTTTCCAAGG - Intergenic
1012155091 6:95809480-95809502 CCAACTCAAGATGGATTGAAGGG - Intergenic
1012304488 6:97635511-97635533 CCAAGTCCAGATGTTTTCAAAGG - Intergenic
1013295875 6:108757899-108757921 CCATCTCTATATTTTTTAAAAGG + Intergenic
1023405778 7:39832864-39832886 ACCATTCTATATGGTGTCAATGG + Intergenic
1027891453 7:83981454-83981476 ACAACTATATATTGGTTCAACGG - Exonic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1030367986 7:108668380-108668402 CCAAGTCTATTTGGTTTGACAGG - Intergenic
1033948178 7:146748445-146748467 CCAAATCTATATGGTTTTTAAGG + Intronic
1041360997 8:57054164-57054186 CCAGCTCCTTATGGTATCAATGG - Intergenic
1042580692 8:70275999-70276021 ACAATTCTAGATGTTTTCAAAGG - Intronic
1050290809 9:4152355-4152377 CCAACTCTATAACATCTCAAAGG + Intronic
1057089293 9:92242191-92242213 GAAACTGGATATGGTTTCAAGGG + Exonic
1060331947 9:122680626-122680648 TCATCTCTAGATGGTTTCTAGGG + Intergenic
1061755838 9:132812068-132812090 CCTAATGTATATAGTTTCAAGGG - Intronic
1186076677 X:5887220-5887242 CCAACTCTTTTAGGTTGCAAAGG - Intronic
1187650721 X:21402199-21402221 ACAACTCTATATTGTGTCATTGG + Intronic
1188119987 X:26292551-26292573 CCAGACCCATATGGTTTCAAAGG + Intergenic
1188613985 X:32134675-32134697 CCAGCGCTATATTATTTCAAAGG + Intronic
1189851200 X:45177801-45177823 CCAACTCTATACAGTTTCACTGG - Intronic
1190079394 X:47343937-47343959 CCAAATCTAGATGGTTTCACTGG - Intergenic
1190175311 X:48144012-48144034 CAAATTCCATTTGGTTTCAAGGG + Intergenic
1190180779 X:48190447-48190469 CTAACTGAATATGGTTTCCAGGG + Intronic
1190552983 X:51603963-51603985 TAAAGTTTATATGGTTTCAATGG + Intergenic
1191035245 X:56018752-56018774 GCAATTCTATATGGTTACACTGG + Intergenic
1194092459 X:89595581-89595603 ACATCTCTTTATGTTTTCAATGG + Intergenic
1194406717 X:93505262-93505284 CAAATTCTCTAAGGTTTCAAGGG - Intergenic
1195700298 X:107700404-107700426 ATAAGTCTATGTGGTTTCAAAGG - Intergenic
1196072200 X:111538611-111538633 CCAGGTCTATATGGCTTCACTGG + Intergenic
1200445095 Y:3251617-3251639 ACATCTCTTTATGTTTTCAATGG + Intergenic
1202015001 Y:20395211-20395233 CCAACTCTATGTTGCTTCCAAGG - Intergenic