ID: 934976454

View in Genome Browser
Species Human (GRCh38)
Location 2:98806087-98806109
Sequence TAGTATATCCATCATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934976444_934976454 14 Left 934976444 2:98806050-98806072 CCCAGTGGCAGCATTTATTTACG 0: 1
1: 0
2: 1
3: 7
4: 89
Right 934976454 2:98806087-98806109 TAGTATATCCATCATGGGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 67
934976445_934976454 13 Left 934976445 2:98806051-98806073 CCAGTGGCAGCATTTATTTACGA 0: 1
1: 0
2: 1
3: 5
4: 69
Right 934976454 2:98806087-98806109 TAGTATATCCATCATGGGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934976454 Original CRISPR TAGTATATCCATCATGGGGT GGG Intronic
907356227 1:53876740-53876762 TAGTATCTCCCTCATGAAGTTGG + Intronic
911547486 1:99236576-99236598 TAGTATCTACCTCATAGGGTAGG + Intergenic
913162777 1:116160377-116160399 TAATATCTACCTCATGGGGTTGG + Intergenic
913551918 1:119924622-119924644 TAGTATAAATATCAAGGGGTAGG - Intronic
916237061 1:162600605-162600627 TAGGATGTCATTCATGGGGTGGG + Intergenic
920794240 1:209123429-209123451 GAGTATCTCCACCATGGTGTTGG + Intergenic
922363315 1:224842425-224842447 AAGTATATGCATCATGTGGGAGG + Intergenic
922532080 1:226352421-226352443 CATAATATCCCTCATGGGGTTGG + Intergenic
924645334 1:245872381-245872403 GAGGACATCCATCCTGGGGTCGG - Intronic
924645353 1:245872466-245872488 GAGGACATCCATCCTGGGGTCGG - Intronic
1066222581 10:33350047-33350069 TAGTATCTTCCTCATAGGGTTGG + Intergenic
1069049638 10:63778945-63778967 CAGTTTTTCCATAATGGGGTGGG - Intergenic
1078897879 11:15613959-15613981 TAGTATTTACTTCATGGGGTTGG + Intergenic
1080801727 11:35616674-35616696 TGGTATAGCCACCATGTGGTTGG + Intergenic
1080890186 11:36402536-36402558 TAAAATATCCATAATGGGCTGGG - Intronic
1081023796 11:37983004-37983026 TAATATATGCATCAACGGGTTGG + Intergenic
1081757553 11:45555393-45555415 TAGTATCTACCCCATGGGGTGGG + Intergenic
1086830016 11:91550678-91550700 TACTATATCCACAATTGGGTGGG + Intergenic
1089570603 11:119406276-119406298 TAGTATAACCATTATGCTGTGGG + Intergenic
1090968000 11:131615274-131615296 CAGTATCTGCATCATGGGGTTGG + Intronic
1109453585 13:62551845-62551867 TAGGATTCCCATAATGGGGTGGG + Intergenic
1112750088 13:102574068-102574090 TAGTAGCTGCTTCATGGGGTTGG - Intergenic
1115254305 14:31382365-31382387 TAGTATATCCACCATAGTGTAGG - Intronic
1118175886 14:63439763-63439785 TAGGATGTCCATCATGGAGATGG + Intronic
1120125756 14:80740961-80740983 TAGTATTTCCAGTTTGGGGTAGG - Intronic
1140296810 16:73716910-73716932 AAGTAAATCCATCATAAGGTTGG + Intergenic
1140769504 16:78190523-78190545 CACTGTAGCCATCATGGGGTCGG - Intronic
1145857428 17:28174843-28174865 CAGGATATGCATCATGTGGTTGG - Intronic
1146681951 17:34814964-34814986 CTGTTTATCCATCCTGGGGTTGG - Intergenic
1146919142 17:36698271-36698293 CAGTCTATACATCATGGGGTGGG - Intergenic
1149135937 17:53364201-53364223 TAGTACCTCTCTCATGGGGTTGG - Intergenic
1150600813 17:66649451-66649473 TAGTATTTACTTCATGGGATTGG - Intronic
1150964557 17:69952929-69952951 TAGTCTATCCAACATGGACTGGG - Intergenic
1155267840 18:24111273-24111295 TAAGATATCCATCATGGGCTGGG + Intronic
1158444276 18:57505263-57505285 TAGTATTTCCAAAATGGAGTTGG - Intergenic
1166648370 19:44550006-44550028 TAATATATCCATCACCGGCTGGG + Intergenic
925310667 2:2879267-2879289 TTTTATATCCATTCTGGGGTGGG - Intergenic
930524958 2:52516850-52516872 TAATATATACATCATGAGCTTGG - Intergenic
930974093 2:57433427-57433449 AATTATATCCATGGTGGGGTGGG + Intergenic
934976454 2:98806087-98806109 TAGTATATCCATCATGGGGTGGG + Intronic
935293781 2:101630827-101630849 TTGGATTTCCAGCATGGGGTGGG - Intergenic
935297107 2:101659455-101659477 TGGAATATCCAGCATGAGGTTGG + Intergenic
940498549 2:154465269-154465291 TAGTATTTCTATCAAGGGGGTGG - Intergenic
942164488 2:173228770-173228792 TAGTATAAAAATCATAGGGTAGG - Intronic
943963098 2:194293030-194293052 TAGTATATCCATCTTGGAGGAGG - Intergenic
944379446 2:199091301-199091323 TAAAATATCCATGATGGGGTGGG + Intergenic
944818360 2:203403178-203403200 TAGTTTTTCCACCATGGGTTTGG - Intronic
1175352555 20:58335392-58335414 GATTATATCCATCATGGTGCAGG + Intronic
954521378 3:51229548-51229570 TAGTACATCCATGATCCGGTCGG - Exonic
959190114 3:103100285-103100307 AAGTATTTGCATCATGGGGGTGG + Intergenic
960334609 3:116400932-116400954 TAGTAGATCCATCCTGTGGTAGG - Intronic
964888361 3:161510610-161510632 CAGAATATCCATCTTTGGGTGGG - Intergenic
968600601 4:1507307-1507329 TAGTCTTTCCATCCTGGGATGGG + Intergenic
973540627 4:51931769-51931791 TAGAAAATCCATTATGGGGTAGG + Intergenic
974782711 4:66574614-66574636 TGGTAGATCCAACATGGAGTAGG + Intergenic
975947828 4:79729187-79729209 TAGTATATGCATCATGGCATAGG + Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
982993403 4:162309206-162309228 TAGGATAGTGATCATGGGGTTGG + Intergenic
984167693 4:176321471-176321493 TAGTATCCCCTTAATGGGGTAGG + Intronic
986801165 5:11261654-11261676 CCCTATATCCATCTTGGGGTGGG - Intronic
989151712 5:38306463-38306485 TATAATAGCCATCATGGGGGAGG - Intronic
989505586 5:42223626-42223648 TAGCATCTCCATCATACGGTTGG + Intergenic
994316318 5:98338140-98338162 CAATATATTCATCATGGTGTAGG - Intergenic
996650002 5:125864420-125864442 TAGCATACCCATCATGGGATAGG - Intergenic
1000005064 5:157175770-157175792 TGGTATATCCATCATTGGCTGGG + Intronic
1012424751 6:99101570-99101592 AAGCACATCCATCATGGGGCAGG - Intergenic
1014573352 6:123039264-123039286 TAGTATATCAATAATGGATTGGG - Intronic
1015746046 6:136510803-136510825 TAGTATATACATATAGGGGTTGG + Intronic
1024023770 7:45394040-45394062 GATTATATTCATCATTGGGTGGG - Intergenic
1031779901 7:125947878-125947900 TAGAAAATCCAGCATGGGATGGG + Intergenic
1032390676 7:131553527-131553549 GAGTATATATATCATGGGCTTGG - Intronic
1033117339 7:138637133-138637155 AAATATATACATCATGGGCTGGG + Intronic
1033709292 7:143924178-143924200 CAGTATATCCCTTTTGGGGTTGG - Intergenic
1039655838 8:39404803-39404825 TAGTCTATCCAACATTTGGTAGG - Intergenic
1041627100 8:60042676-60042698 GAATCTATCCAACATGGGGTGGG + Intergenic
1044018578 8:87076142-87076164 TAATATATCCAGCATGAAGTGGG + Intronic
1044699259 8:94950972-94950994 CAGTATCTCCATCATGAAGTGGG + Intronic
1046270915 8:111897146-111897168 TATTATAAAAATCATGGGGTGGG - Intergenic
1055423124 9:76164389-76164411 TAGTATATACCTCACAGGGTTGG + Intronic
1187281555 X:17861322-17861344 TACTATATACACCAAGGGGTGGG + Exonic