ID: 934977544

View in Genome Browser
Species Human (GRCh38)
Location 2:98815337-98815359
Sequence TTTTATGCATGTGCAGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934977542_934977544 22 Left 934977542 2:98815292-98815314 CCTTCTAAAATTCTCAAAAGGTT 0: 1
1: 0
2: 1
3: 27
4: 315
Right 934977544 2:98815337-98815359 TTTTATGCATGTGCAGCTCAGGG 0: 1
1: 0
2: 0
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934977544 Original CRISPR TTTTATGCATGTGCAGCTCA GGG Intronic
904147903 1:28409623-28409645 TTTTATGCCAGTGCAGCTTGAGG + Intronic
906027698 1:42687916-42687938 TTTTCTGCAGGTGCTGCTAAGGG + Intronic
908056065 1:60288685-60288707 TTTTATGCTCGTGTAGCTGAAGG + Intergenic
911491981 1:98581252-98581274 TCTTATGCAAGGTCAGCTCAAGG - Intergenic
915806949 1:158864121-158864143 TTCTATACATGTTCAGTTCAAGG - Intergenic
917144940 1:171879930-171879952 TTTTATGGAAGTGGCGCTCATGG + Intronic
917288433 1:173445840-173445862 TTCCATGCATGCACAGCTCAGGG - Intergenic
917795352 1:178529118-178529140 TTTTCTGCATCTTCAGCTAACGG - Intronic
919059714 1:192616756-192616778 TTTTTTTCATCTGCAGCCCAGGG + Intergenic
920767328 1:208846061-208846083 TTTTATCAATGAGGAGCTCAAGG + Intergenic
921809589 1:219497529-219497551 CTTTGGGCATGTGCAGCTCAGGG - Intergenic
922897359 1:229110812-229110834 ATTTTTGCATGTGCTGCTCCTGG - Intergenic
924261588 1:242237083-242237105 TTTTATGAGACTGCAGCTCAGGG + Intronic
1066093211 10:32046875-32046897 TTTGATGCATTTTCAGCTTAGGG - Intronic
1066111911 10:32204990-32205012 GTTTTTGCATATGCAGCTAATGG + Intergenic
1066145908 10:32558391-32558413 CTTTATGCATATGTAGTTCAGGG + Intronic
1076990083 11:268214-268236 TTTTACGCATGTGCAGAGCGTGG + Intergenic
1077706003 11:4486160-4486182 TTTATTGCATGGGCACCTCAGGG + Intergenic
1078546054 11:12247796-12247818 TTCTATCCTGGTGCAGCTCAGGG + Intronic
1084782434 11:71419062-71419084 CTTTCTGCATGTGTATCTCAGGG - Intergenic
1085982479 11:81741773-81741795 TTTTATTCATCTGTAGCGCAGGG + Intergenic
1086849978 11:91798202-91798224 TTTTATGCAAGTACAGGGCATGG - Intergenic
1087460428 11:98438504-98438526 TTTGATGCATGTGAACCTAAAGG + Intergenic
1088692785 11:112342140-112342162 TTGTATGCATGTACAGAGCATGG + Intergenic
1088829463 11:113523053-113523075 TTTTATTGATGAGCAGCTTAGGG - Intergenic
1092844583 12:12572239-12572261 TTTTAAGCATGTCAAGTTCAAGG + Intergenic
1095626740 12:44323482-44323504 TTTTATGAACATCCAGCTCACGG + Intronic
1096487696 12:51994771-51994793 TTCTGTGCATGTGCAGGTCGGGG + Intronic
1098825871 12:75296601-75296623 TTTTATGCAGGTGCATCTATGGG + Intronic
1098948423 12:76613960-76613982 ATTTATGCATGTGCACCTTGGGG + Intergenic
1100154098 12:91776974-91776996 TTTCATACATGTCCTGCTCAGGG + Intergenic
1101575337 12:105992125-105992147 TTCTATGGATGTGCAGGTCATGG + Intergenic
1102544542 12:113645254-113645276 TTTTATGTAGGTCCAGCACATGG - Intergenic
1106669267 13:31887612-31887634 TTTTCTGGATGTGTTGCTCAAGG + Intergenic
1108148953 13:47511388-47511410 TTTTATGCATTTGGACATCAAGG + Intergenic
1108762210 13:53581911-53581933 TTTTATTCATATGAAGTTCAAGG - Intergenic
1109994982 13:70111420-70111442 TATGATGCCTGTGCAGCTCCAGG - Intergenic
1112148282 13:96726886-96726908 TCATATGCTTGTGCTGCTCAGGG + Intronic
1113225175 13:108151862-108151884 TTTTTTGTACATGCAGCTCATGG - Intergenic
1114854160 14:26417436-26417458 TTTTATGCATGTGCTGGCAATGG - Intergenic
1116052948 14:39826928-39826950 TTTTGTGCATGCGCCTCTCAGGG + Intergenic
1116261369 14:42631848-42631870 TTTTATGCATGTGCATGTTTGGG + Intergenic
1118442686 14:65826570-65826592 TTTTAAGGATGTGCAGACCAAGG + Intergenic
1121811839 14:96898232-96898254 TTCTATGTATGTGAAGCTTAGGG + Intronic
1124950475 15:34314522-34314544 TTTGATCCATCTGCAGCTTATGG + Intronic
1125097184 15:35868393-35868415 ATTAATGCATGTGAAGCACATGG - Intergenic
1130016226 15:80188565-80188587 TTTTATCCATGTGCAGGTGAGGG - Intergenic
1133112637 16:3557706-3557728 TTTTAGGCATGCACATCTCATGG + Intronic
1137929317 16:52571792-52571814 TTTTATGCATGAGGAGAACAAGG - Intergenic
1140287416 16:73617569-73617591 TTTTAGGCATGTACATCTCATGG - Intergenic
1141277111 16:82598340-82598362 TTTTGTGAATTTGGAGCTCAGGG + Intergenic
1143919012 17:10315920-10315942 CTTTCTGCATGTTCAGATCATGG + Exonic
1145754174 17:27378784-27378806 TTTCATGCATGTGTGGTTCAGGG + Intergenic
1149228375 17:54502407-54502429 TTGTATATATGTGCAGGTCATGG - Intergenic
1149330298 17:55574369-55574391 TCTTATTCAGGTGTAGCTCAGGG - Intergenic
1151333766 17:73427626-73427648 TTTTTTGCATGTGGATGTCAAGG - Intronic
1155295412 18:24380417-24380439 TTTGCTGCATGTCCAGCTGAGGG + Intronic
1156111439 18:33732019-33732041 TTCTTTGCATATGCAGCACAAGG + Exonic
1156609372 18:38708341-38708363 TCTTATGCATGTGAAAGTCATGG - Intergenic
1157531588 18:48425641-48425663 CTTTCTGCATGTACAGCTCAAGG + Intergenic
1159050499 18:63417030-63417052 TTCTAGGCATGGGTAGCTCAAGG - Intronic
1159226349 18:65542324-65542346 TTATTTGTATGTGCAGTTCAAGG - Intergenic
1160477446 18:79205087-79205109 TGCAATGCAGGTGCAGCTCAGGG - Intronic
1160585010 18:79909338-79909360 ATCTATGCATGTGTAGTTCAAGG + Intronic
1162343799 19:10108068-10108090 TGGTATGCATGTGAAGCTCATGG + Exonic
1163483456 19:17572574-17572596 CTTCATGCATGTGCAGCTGGAGG + Exonic
1164791012 19:30980754-30980776 CTTTATGCATGTGTGGCTGAGGG + Intergenic
1166763572 19:45239185-45239207 TTATAAGCTTGTGCAGATCAAGG - Intronic
925299196 2:2798342-2798364 TTCTAGGCTTGTGCAGCACATGG - Intergenic
928039695 2:27862294-27862316 TTTTATGCATGTACATATCATGG - Intronic
930534026 2:52624928-52624950 ATCCATGCATGTGCAGCTCAGGG - Intergenic
931357686 2:61551593-61551615 TTTTGTGAATGTGAAGCTTAAGG + Intergenic
931664380 2:64599829-64599851 GTTTATGCATGAGCCCCTCAGGG + Intergenic
933667921 2:84979598-84979620 TTTTATGAATATGCAGTTTAGGG - Intronic
933842911 2:86302060-86302082 ATTAATGGATGTGCAGCTAATGG + Intronic
934977544 2:98815337-98815359 TTTTATGCATGTGCAGCTCAGGG + Intronic
936157304 2:110056704-110056726 GTTTATGTATGTGCACATCAAGG + Intergenic
936187390 2:110314740-110314762 GTTTATGTATGTGCACATCAAGG - Intergenic
937469023 2:122159350-122159372 TTTTATGGATGTGTAAGTCAAGG + Intergenic
941247238 2:163114115-163114137 TTTTGTGCATGTACAGTTTAAGG - Intergenic
942616833 2:177800065-177800087 TTTTTTACCTGTGCATCTCAGGG - Intronic
943551419 2:189345020-189345042 CTTTATGCATGTGCTGCAAAAGG + Intergenic
946492971 2:220167871-220167893 TTTGATGCATTTCCAGCACAGGG - Intergenic
1170678067 20:18500560-18500582 TTTTAAATATGTGCAGCTTAAGG + Intergenic
1172184072 20:33020536-33020558 TTTCAGGGATGTCCAGCTCACGG + Exonic
1173009385 20:39168011-39168033 TTTGGTGCCTGTGCAGCTAATGG - Intergenic
1173596419 20:44261308-44261330 TTTTATGAATGTGAAGGTCAAGG - Intronic
1174734621 20:52954247-52954269 CTTCATGCATGTCCACCTCATGG + Intergenic
1181324326 22:22033042-22033064 TTTTATATATGTGGAGCTCTGGG - Intergenic
1183568379 22:38633039-38633061 TTTTGTCCTTGTGGAGCTCAGGG + Intronic
1185084660 22:48733845-48733867 GTATATGCATTTGCAGCTCTGGG - Intronic
951996114 3:28731223-28731245 TCTTATGCATGTGAAGTTAAGGG - Intergenic
952147034 3:30544268-30544290 TTTTATGTGTGTGGAGATCATGG + Intergenic
952768185 3:36973649-36973671 TTTTAAGCATGAGCATGTCAAGG - Intergenic
953559789 3:43978334-43978356 TTTTATGTCTTTGAAGCTCAAGG + Intergenic
953675508 3:44998521-44998543 TTTAATGAATGTGCAGATAAAGG + Intronic
953849286 3:46453887-46453909 TTGTATACATGTCTAGCTCAGGG - Intronic
954153327 3:48670630-48670652 CCTTATGCATGTGCAGCTTATGG + Intergenic
955238604 3:57161278-57161300 TTTCATTCACTTGCAGCTCATGG - Intronic
956062337 3:65360141-65360163 TTTAATTCAGATGCAGCTCAAGG - Intronic
956538859 3:70311397-70311419 TTTTACGCATGCGGAGCCCATGG + Intergenic
960928827 3:122823308-122823330 ATATATGCATGTGGAGCTGAAGG - Intronic
961313920 3:126021424-126021446 TTTTAAGCATGTGCAGTGAAAGG - Intronic
967315910 3:188152424-188152446 TTTTATGAATCAGTAGCTCATGG + Intergenic
967616696 3:191577603-191577625 TTTTATGCTTGGGCATCTCTGGG + Intergenic
972149318 4:36068812-36068834 TTTTATGTATGTTCACCTTATGG + Intronic
972913905 4:43852326-43852348 TTTTAAGCCTGTGCTGTTCAAGG + Intergenic
974466525 4:62263801-62263823 TCTTAAGCAGGTGCAGCTCTGGG + Intergenic
977007136 4:91582011-91582033 GTTTATGTATATGCACCTCAAGG + Intronic
978075592 4:104525592-104525614 TTGTATGTACGTGGAGCTCAGGG - Intergenic
978751004 4:112247444-112247466 TTGTATGAATGTCAAGCTCAAGG + Intronic
978841378 4:113217513-113217535 TTTTATCCATGAGCAGCGGATGG + Intronic
978887770 4:113785249-113785271 GATTATGTATGTGCAGCTCCTGG - Intergenic
979835691 4:125364665-125364687 TTGTATGCGTTTCCAGCTCATGG - Intronic
981449591 4:144880855-144880877 TTGTGTGCATTTGCAGTTCAGGG - Intergenic
981785834 4:148478675-148478697 TTTTATAAATGTGCAACTTATGG + Intergenic
984797938 4:183682893-183682915 TCTTATGCATGTGCAGCCAATGG - Intronic
986260521 5:6141959-6141981 ATTTAAGACTGTGCAGCTCATGG - Intergenic
988026010 5:25690831-25690853 GATTATGCATGTTCAGCTGATGG - Intergenic
989128568 5:38080922-38080944 TCTTATACAGGTGCAGTTCATGG - Intergenic
989322131 5:40147991-40148013 TTTTATGCTTGTGTAGCTGAAGG - Intergenic
989452452 5:41602837-41602859 TTTTTTCCATGAGCAGCTAATGG - Intergenic
992130691 5:73689541-73689563 TTTTCTGCAACTGCAACTCAGGG - Intronic
993771641 5:91935128-91935150 CTTAATACATGTACAGCTCAAGG + Intergenic
996005628 5:118418023-118418045 GTTTAAGCATGTGTTGCTCAGGG - Intergenic
996257066 5:121417327-121417349 TTTTATGCATGCAAAGCTCAGGG + Intergenic
997040813 5:130251265-130251287 TTTTCAACATTTGCAGCTCAAGG + Intergenic
997247067 5:132358769-132358791 TTTTATGTATGTGAAGGTGAAGG - Intergenic
998705857 5:144759299-144759321 TTTTATACATGAGGAGATCAAGG + Intergenic
1000312605 5:160059721-160059743 TCTTATGCGGGTGCAGTTCATGG + Intronic
1001545210 5:172566835-172566857 TTTTATAGATGGGCAGCTGAGGG - Intergenic
1003012640 6:2439946-2439968 ATTCATTCGTGTGCAGCTCACGG - Intergenic
1003173821 6:3740243-3740265 TTTAATTAATGTGCAGCTCTTGG + Intronic
1005673273 6:28128481-28128503 ATTTTTGCAGGTGCACCTCAGGG - Intronic
1006260196 6:32861415-32861437 TCACACGCATGTGCAGCTCAGGG - Intergenic
1006925666 6:37653626-37653648 TTTTCTGCTTGTGCAGCTTTAGG - Intronic
1011288366 6:85749312-85749334 TTTTATGCATGCCCATCTCAGGG - Intergenic
1011389125 6:86832501-86832523 TTTGATGCCTGTGCAAGTCATGG - Intergenic
1016754342 6:147667070-147667092 TTTAATGATGGTGCAGCTCATGG - Intronic
1019474516 7:1237498-1237520 ATTTATGCATCTGCGGCTCCCGG + Intergenic
1021334453 7:19381371-19381393 TTTATTGCATGTCCAGCTTAAGG + Intergenic
1024584630 7:50831336-50831358 TGTTGAGCATGTGCAGTTCAAGG - Intergenic
1026108791 7:67442103-67442125 TTTTATGCATGTGGAAATTAGGG + Intergenic
1028538458 7:91915790-91915812 TTTTATGCTTGTACAGCACAGGG - Intergenic
1028766278 7:94563472-94563494 TTTTATCCTTGTGCAACTTAAGG + Intergenic
1032507430 7:132446128-132446150 TGTTATCCACGTGTAGCTCAGGG - Intronic
1035638882 8:1167459-1167481 TTTTATGCATGTCAAACCCATGG + Intergenic
1036970733 8:13352240-13352262 TTCTATGCATGTGCATGTGACGG - Intronic
1039875426 8:41580721-41580743 TGTTATGCATGTCCAGTTTATGG + Intronic
1041009468 8:53527602-53527624 TTTGAAGCATTTTCAGCTCATGG - Intergenic
1042704601 8:71652705-71652727 TTTTATGCAGAAACAGCTCAGGG - Intergenic
1042901069 8:73728150-73728172 TGTTTTGCATGTGCATCTCCAGG + Intronic
1044074814 8:87807319-87807341 TTTGATCCATCTTCAGCTCATGG - Intergenic
1044490177 8:92804435-92804457 ATTTGTGCATGTGAAGCCCATGG - Intergenic
1044513410 8:93110387-93110409 GTTTCTGCATGAGCATCTCATGG - Intergenic
1046533838 8:115482995-115483017 GTTTATGCATTTACAGTTCAAGG - Intronic
1046859456 8:119073857-119073879 TTATATGTATGTGAAGATCATGG + Intronic
1046965360 8:120159103-120159125 TTCTATGAATTTGCAACTCAAGG + Intronic
1048533029 8:135267955-135267977 TTGTATACACATGCAGCTCAGGG + Intergenic
1049207880 8:141371829-141371851 TTTTATACATGTGGAGATGAAGG + Intergenic
1049609103 8:143544680-143544702 TGCTCTGCATGTGCTGCTCATGG - Intergenic
1052435752 9:28426664-28426686 TTTAAGCCATGTGCACCTCAGGG - Intronic
1057095996 9:92310255-92310277 TTTTCTGTCTGTGTAGCTCATGG - Exonic
1057587942 9:96346408-96346430 GTTTATGCAGATGCATCTCAGGG + Intronic
1058544665 9:106048194-106048216 TTTTATTCATGTGCACATAAGGG + Intergenic
1059174721 9:112158817-112158839 TATTATGAATGAGCCGCTCAAGG + Intronic
1059825958 9:118029409-118029431 TTTTTTGAACGTGCAACTCATGG - Intergenic
1189251049 X:39600913-39600935 TGTTATGCATGTTCAGTTCTGGG - Intergenic
1192285861 X:69735583-69735605 TTCTGTGCATGTACAGCTTAGGG + Intronic
1197021955 X:121701386-121701408 TTTTATGCATGTGTATATCCAGG + Intergenic
1198043112 X:132874208-132874230 TTTTTTGCAGGGGCAGCTCTAGG - Intronic
1198070160 X:133140253-133140275 ATTAATGCATGTGCAGCACTGGG - Intergenic
1198189800 X:134291220-134291242 ATCTATGCACGTGCAGGTCAAGG - Intergenic