ID: 934979133

View in Genome Browser
Species Human (GRCh38)
Location 2:98825907-98825929
Sequence AGCTGGAGACAGTTGGGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934979133_934979140 -1 Left 934979133 2:98825907-98825929 CCCTAGCCCAACTGTCTCCAGCT 0: 1
1: 0
2: 1
3: 26
4: 207
Right 934979140 2:98825929-98825951 TGAGGCACCCAGCTTGCCCTGGG 0: 1
1: 0
2: 0
3: 33
4: 277
934979133_934979139 -2 Left 934979133 2:98825907-98825929 CCCTAGCCCAACTGTCTCCAGCT 0: 1
1: 0
2: 1
3: 26
4: 207
Right 934979139 2:98825928-98825950 CTGAGGCACCCAGCTTGCCCTGG 0: 1
1: 0
2: 2
3: 25
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934979133 Original CRISPR AGCTGGAGACAGTTGGGCTA GGG (reversed) Intronic
900079858 1:847809-847831 AGGTGGAGACATTGGGGCTCAGG + Intergenic
900728315 1:4233564-4233586 AGCTGGCAACAGTTGGGGTATGG - Intergenic
902239603 1:15079776-15079798 AGCTGGAGAAAGATGGGCTTCGG + Intronic
903610211 1:24605917-24605939 ATGTGGACACAGTTGGGGTAGGG - Exonic
904400771 1:30254922-30254944 AGCTGGGGACTGTTGGGCCGGGG + Intergenic
904678848 1:32215135-32215157 AGCTGGAGACAGTTATGATGAGG - Intronic
904743336 1:32695390-32695412 AGCTGGAGAGAGATGGCCTAAGG - Exonic
905239135 1:36571221-36571243 AGATGGGGACAGCTGGGCTGAGG - Intergenic
905239264 1:36571701-36571723 AGGTGGGGACAGCTGGGCTGAGG - Intergenic
905239394 1:36572117-36572139 AGGTGGGGACAGCTGGGCTGAGG - Intergenic
906467125 1:46092205-46092227 ATCTGTAGGGAGTTGGGCTAAGG - Intronic
909003639 1:70249617-70249639 AGCTGGAGTGAGTTGTGATAGGG - Intronic
909857940 1:80563404-80563426 AGAAGGCGACAGTTTGGCTAGGG - Intergenic
910367931 1:86486572-86486594 TGCTGCAGACAGTTGAGCTGGGG + Exonic
911055144 1:93702370-93702392 GTCAGGAGACAGTTGGGCTGAGG - Intronic
911648608 1:100361854-100361876 AGGTGGGGTCAGTTAGGCTATGG + Intronic
911713136 1:101097988-101098010 AGCGGGAGGTAGTTGGGTTATGG + Intergenic
912908802 1:113735823-113735845 AGTGGGAGAAAGTTGGGTTAAGG - Intronic
913058790 1:115185884-115185906 TGCTGGAGGCAGTCGGGGTAGGG - Intergenic
915337032 1:155150257-155150279 AACTGGATACAGTTAGGCTTGGG + Intergenic
915438369 1:155926706-155926728 AGCTGGAGACAACTGAGCGATGG + Exonic
916445071 1:164864520-164864542 ATCTGAAGACAGTTGGGGTTGGG - Intronic
921046539 1:211481769-211481791 AGCTGGAAACACATGGACTATGG + Intronic
922222519 1:223619254-223619276 AGCTGGAGGAGGTTGGGCCAAGG + Intronic
922243269 1:223770929-223770951 AGCAGGAGACTGCTGGGCTTTGG + Intronic
922665951 1:227469278-227469300 AGCTGGAGACAGGAGAGGTAAGG + Intergenic
922775646 1:228213205-228213227 AGCAGGAGGCAGAGGGGCTAAGG - Intronic
922952605 1:229571604-229571626 AGCTGGATACAGTTTGGCTTGGG + Intergenic
923188710 1:231598947-231598969 AGCAGGAGCAAGTTGGGGTAGGG + Intronic
1063043468 10:2368146-2368168 AGCTGGAGCCATGTGGGCCACGG - Intergenic
1067365370 10:45622889-45622911 AGCTGGATACAGTTTGGTTTCGG + Intronic
1070751461 10:78966418-78966440 AGCTGGAGACAGATGGGCACTGG - Intergenic
1071439843 10:85680331-85680353 AGCTGTAGACTCCTGGGCTAGGG - Intronic
1072422020 10:95297193-95297215 AGATGGTGACACTTGGGCTGTGG - Intergenic
1072599747 10:96914536-96914558 AGATGGATACAGTTTGGCTTTGG - Intronic
1073458670 10:103652997-103653019 AGCTGGGGACAGGTGGGCCTTGG - Intronic
1073518486 10:104101625-104101647 AGATGGAGACTGTTCTGCTAAGG + Intergenic
1074978390 10:118599474-118599496 AGCAAGAGACATTTGGGGTAAGG - Intergenic
1076615516 10:131751836-131751858 AGCTGCAGACAGCGGGGCTGTGG + Intergenic
1076712427 10:132345716-132345738 ACCTGGAGACAGCTGGGACAAGG + Intronic
1078363939 11:10691648-10691670 AGGTGAGGACAGTGGGGCTAGGG - Intronic
1081581075 11:44352394-44352416 AGCAGGAGGCAGCTGGGGTAGGG + Intergenic
1081751617 11:45515245-45515267 ACCTGGATACAGTTTGGCTTTGG + Intergenic
1083581859 11:63830169-63830191 AGTTGGAGAAAGTGGGGCTGAGG + Intergenic
1084473842 11:69377838-69377860 TACTAGAGACAGTTGGGCGAAGG + Intergenic
1084867499 11:72071132-72071154 AATTGGAGGCAGTTGGGATATGG - Intronic
1085453782 11:76654688-76654710 CACTGGAAACAGTTGGGCTGTGG - Intergenic
1085508430 11:77073248-77073270 AGGTGGAGACTGTTGGGCAGGGG - Intronic
1091103925 11:132900726-132900748 AGCTGGAGTTAGTTTGGCTAGGG - Intronic
1092898949 12:13040564-13040586 AGCTGGAGACAGAAGGGCCTGGG + Intergenic
1096111664 12:49032433-49032455 AGCTGCAGAGAGCTGGGCTGAGG + Exonic
1096234598 12:49917655-49917677 AGCTGGAGACAGCTGGGAACAGG + Intergenic
1096490374 12:52009620-52009642 AGCTGGACACAGCCTGGCTAAGG - Intronic
1097974493 12:65670022-65670044 ACCAGGAGACAGATGGGGTAGGG + Intergenic
1099782315 12:87212346-87212368 AGCTGGATACAGATGGAGTAGGG - Intergenic
1100208902 12:92380874-92380896 AGATGGAGACACTTGGGGAAGGG - Intergenic
1100564883 12:95785998-95786020 ATCTGGAGACATTTTTGCTAGGG - Intronic
1101235199 12:102781619-102781641 AGATAGAGACAGATGGACTAGGG - Intergenic
1103161816 12:118735495-118735517 AGCTGGTGAGAGTAGGGCTGGGG + Intergenic
1104649985 12:130524478-130524500 AGCTACAGACAGCTGGGCTCTGG + Intronic
1104915568 12:132262682-132262704 AGGTGCAGACAGATGAGCTATGG - Intronic
1104915584 12:132262759-132262781 AGGTGCAGACAGATGAGCTATGG - Intronic
1104996933 12:132664115-132664137 AGCTGGACACAGATGGTATATGG - Exonic
1114511237 14:23263104-23263126 AGCTGGATACAGTTTGGCTTAGG - Intronic
1114749796 14:25190400-25190422 AGCTGGAGACAGGTATGCAAGGG - Intergenic
1117814817 14:59586339-59586361 AGCTAGAGACAGTAGGGAGAGGG + Intergenic
1117984157 14:61370923-61370945 AGCTGGAGACAGTTGGGACAGGG + Intronic
1118317059 14:64731897-64731919 AGATGGAGACACTGGGGCTTGGG - Intronic
1118823164 14:69358211-69358233 CTCTGGAGACAGTTGCTCTAGGG + Intergenic
1119632842 14:76248961-76248983 AGCTGGTGACAGTTGGAAAAGGG + Intronic
1119875981 14:78059802-78059824 TTCTGAAGACAGTTGGGCAATGG - Intergenic
1120132472 14:80823585-80823607 AGCTGGATACAGTTTGGCTTGGG + Intronic
1122044749 14:99015638-99015660 AGCTAGAGATAGCTGGACTAAGG - Intergenic
1122620785 14:103056814-103056836 GGCTGGAGAGAGATGGGCTGCGG + Intronic
1122844665 14:104486280-104486302 ATCTGGTGACTGTTGGGCTAGGG + Intronic
1124027166 15:25977265-25977287 GGCCAGAGACAGTTGGGCTTCGG - Intergenic
1125394991 15:39236960-39236982 AGGTAGAGACAGTTGGATTATGG + Intergenic
1125936253 15:43638873-43638895 AGCTGGGGACAGCTGGGTGAGGG - Intronic
1126154893 15:45556708-45556730 AGCTGGATACAGTTTGGCTTGGG + Intergenic
1128365634 15:67000001-67000023 AGCTGGATACAGTTTGGCTTGGG - Intergenic
1128504287 15:68255696-68255718 AGCTGGATACAGTTTGGCTTGGG + Intronic
1128651615 15:69419244-69419266 AAGTGGAGGCAGTTGGGCTTTGG - Intronic
1129419996 15:75417118-75417140 AGCTGGATACAGTTTGGCTGGGG + Intronic
1132139136 15:99376104-99376126 AGCTAGAGACAGTAGTGCTGAGG - Intronic
1132392718 15:101450656-101450678 AGCTGGACACAGATGGGATGGGG - Intronic
1133969546 16:10557902-10557924 AACTGGAGAGAGTGGGGCTGTGG + Intronic
1134518522 16:14906333-14906355 AGCTGGCCAGAGTTGGGCAATGG - Intronic
1134706193 16:16304986-16305008 AGCTGGCCAGAGTTGGGCAATGG - Intergenic
1134815498 16:17202258-17202280 AGATGGAGACTGTGGGGCTGGGG + Intronic
1134961347 16:18407124-18407146 AGCTGGCCAGAGTTGGGCAATGG + Intergenic
1134965647 16:18489727-18489749 AGCTGGCCAGAGTTGGGCAATGG + Intronic
1135495958 16:22951343-22951365 AGCTGGAGATGGTTGGGGCAAGG - Intergenic
1138578274 16:57922807-57922829 AGCTGCAGACAGTAGGCCTGGGG - Intronic
1142150187 16:88509288-88509310 AGCTGGACCCAGCTGGCCTATGG + Intronic
1142233882 16:88912343-88912365 AGATGGGGACAGATGGGCTGGGG + Intronic
1143195963 17:5076685-5076707 AGTTGCAGACAGTAGGGCAAGGG + Intergenic
1143907845 17:10223816-10223838 CGCTGGAGACCTTTGGGATATGG - Intergenic
1144640250 17:16932850-16932872 ACCTGGAGGCAGTTGGGGTCAGG + Intronic
1145976665 17:28987897-28987919 AGCAGTAGACAGCTGAGCTATGG - Intronic
1146931887 17:36783485-36783507 AGCTGGATAAACTTGGGCTCTGG - Intergenic
1148496778 17:48057671-48057693 AGCTGGAGACAGGTAGGGTTTGG + Intronic
1148797919 17:50206059-50206081 AGCTGGAGAGAGAAGGGCTGGGG + Intergenic
1149662543 17:58342498-58342520 AGATGGAGGCAGTGGGGCAATGG - Intergenic
1149711583 17:58747244-58747266 GGCTGGAATCAGTTGGGCAATGG - Intergenic
1152032661 17:77853760-77853782 AGCTGTAGACTGTTGGGGTGGGG - Intergenic
1152253024 17:79221578-79221600 AGCTGGACACAGTTGGGTTGGGG - Intronic
1154389202 18:13922182-13922204 ATCTGCACACAGTGGGGCTAAGG - Intergenic
1155965588 18:32032544-32032566 AGCTGGATAAAGTTTGGCTTGGG - Intronic
1156690599 18:39702497-39702519 AGCAGAAGACAGTTGGTCTTGGG + Intergenic
1160425501 18:78776270-78776292 AGCTGGAGACAGATGAGCTCAGG - Intergenic
1161778110 19:6274834-6274856 ATCTGGGGACAGTTAGGCTTGGG + Intronic
1163716973 19:18878532-18878554 AGCTGGTGGCAGTGGGGCTGGGG - Exonic
1165485238 19:36091454-36091476 ATCTGGAGACAGGTGGGACATGG + Exonic
1165560216 19:36672575-36672597 AGCTGTAGCCAGTTTGGCTTTGG - Intergenic
1166107295 19:40603741-40603763 AGCTGGAGACAGCTGTGCGGAGG - Intronic
1166994758 19:46714773-46714795 AGCTGGTGGCAGTGGGGGTACGG - Intronic
1167169081 19:47819132-47819154 AGCTGGAAAAAGTGGGGTTAAGG - Intergenic
925265206 2:2562130-2562152 TGCTGGACACAGGTGGGCTCTGG - Intergenic
925295427 2:2773339-2773361 AGCTGGAGATAGTTGAGTCACGG - Intergenic
926417672 2:12665736-12665758 GGCTGGTGACAGGTGGGCTAAGG - Intergenic
926999313 2:18775948-18775970 AGTTTGAGACAGTTGAGATAAGG + Intergenic
927588539 2:24332335-24332357 AGCTGGATACAGTTTGGCTTGGG + Intronic
927719312 2:25372813-25372835 GGCTGGGGACAGTGGGGCTGAGG - Intergenic
928332016 2:30364881-30364903 AGGTGGAGACAGCTGGCCCAGGG + Intergenic
929437842 2:41941767-41941789 CCCTGGAGAAAGTTGGGCTTTGG - Intronic
929527617 2:42720604-42720626 ATCTGGAGACAGTTCTGCAAGGG - Intronic
933357948 2:81237708-81237730 AGCAGCAGACAGTTGGGACATGG + Intergenic
934196837 2:89844344-89844366 AGTTGGAGTCAGGTGGGCTCAGG + Intergenic
934658732 2:96131970-96131992 GGCTGGAGGCAGGTGGGCTGTGG - Intronic
934979133 2:98825907-98825929 AGCTGGAGACAGTTGGGCTAGGG - Intronic
935130508 2:100257672-100257694 AGCTGGAGAAATTTGGGGCAAGG + Intergenic
935168402 2:100589925-100589947 AGCTGCATACAGTTTGGCTTGGG - Intergenic
937067224 2:119026446-119026468 AGCAGGAGAAAGGTGGGCCAGGG + Intergenic
938150705 2:128880010-128880032 AGCTGGGGACAGCTGGACTCTGG - Intergenic
938967840 2:136404345-136404367 AGATGGAGACAGCTGGTCCATGG - Intergenic
940015493 2:149100107-149100129 AGCTGGGGAGAGATGGGCTGTGG + Intronic
942360586 2:175167999-175168021 GGCTGGAGACTGTAGGGATACGG - Intronic
942449920 2:176102320-176102342 AACTGAAGTCAGTTGGGCTAAGG - Intergenic
1168862501 20:1055878-1055900 AGCTGTGAACAGTTGGACTAGGG - Intergenic
1168906146 20:1405348-1405370 AGGTGGAGACTGTTGGGGGAGGG - Intergenic
1170739688 20:19044265-19044287 AGCTGGAGATGGGTGGGCTTGGG + Intergenic
1171184125 20:23112652-23112674 AGCTGGAGACATCTGAGCTGTGG - Intergenic
1173209567 20:41021656-41021678 AGCTGGAGGCAGCTGGACTCAGG + Intergenic
1173364686 20:42374174-42374196 AGAGTGAGACAGATGGGCTATGG - Intronic
1175322659 20:58100323-58100345 AGCAGGAGACAGCCGGGCTCAGG - Intergenic
1175696157 20:61104673-61104695 AAATGGAGAAAGTTGTGCTAAGG + Intergenic
1178938936 21:36888756-36888778 AGCTGAAGACAGTAAGGCTCAGG + Intronic
1180958217 22:19750657-19750679 AGCTGGAGACAGCTGCGGGAGGG - Intergenic
1182129808 22:27842605-27842627 AGCTGGGCACAGCTGAGCTATGG + Intergenic
1182461943 22:30489611-30489633 AGCTGGAGGCAGCTGGGTGAGGG - Exonic
1182733182 22:32511714-32511736 AGCTGGAGACTGGTAGGCTCAGG - Intergenic
1183629056 22:39022244-39022266 AGCTGGGGACAGTTGGAGCAGGG - Intronic
1183933491 22:41249101-41249123 AGCTGAGGACAGTGGGGCTCAGG - Intronic
1184274647 22:43403505-43403527 AGCTGGAAACATTTGGAGTAGGG + Intergenic
950006669 3:9695934-9695956 AGATGGAGAAACTTGGGCTCAGG - Intronic
950080747 3:10220298-10220320 ATCTGGAGACGGTTAGGATAGGG + Intronic
950778907 3:15374252-15374274 AGCTGGATACAGTTTGGCTTGGG - Intergenic
955441216 3:58956936-58956958 AGGTGGAGACAGTTGGATCATGG - Intronic
958100213 3:88999317-88999339 AGCTGGGGACAGTTGGACTCTGG + Intergenic
959660246 3:108860303-108860325 GGCTGGAGATAGGTGGTCTAAGG - Intergenic
959809208 3:110595056-110595078 AGCTGGAGCCAGAGGGGCTGGGG + Intergenic
961806453 3:129492685-129492707 AGCCAGAAACAGTAGGGCTAGGG - Intronic
962640744 3:137383540-137383562 AGCTGTGGACAGATGGACTATGG + Intergenic
963131631 3:141863868-141863890 AGCTGGATACAGTTTGGCTTGGG - Intergenic
964445263 3:156751551-156751573 TGCTGGAGACAGTTTGGCAGCGG + Intergenic
968457621 4:707055-707077 ACCTGAAGAGAGTTGGGCTCTGG + Intronic
969525062 4:7700116-7700138 GGCTGGAGACAGAGGGGCAAAGG - Intronic
971677568 4:29653412-29653434 AGGTGGAGATAATTGGACTATGG - Intergenic
972769334 4:42182122-42182144 AGCTGGAGAAAATGAGGCTAAGG + Intergenic
978282162 4:107031269-107031291 AGCAGGAGAAAGTTGGGCTGAGG + Intronic
983714847 4:170768137-170768159 AGCAAGAGAGAGTTGGGGTAAGG + Intergenic
985733554 5:1564684-1564706 TGCTGGAGAGAGTTGGCTTAAGG - Intergenic
989026444 5:37073810-37073832 AGATGGAGAGAGATGGGATAAGG - Intergenic
992381400 5:76241200-76241222 AGCTGGATACAGTTTGGCTTGGG - Intronic
992397114 5:76378397-76378419 AGGTGGAGACAGTTGAGAAAAGG + Intergenic
993355824 5:86906049-86906071 ATCTGGAGAAATTTGGGCTCAGG - Intergenic
995592652 5:113715560-113715582 AGCTGAACATAGTTGGGCCATGG - Intergenic
998227643 5:140339285-140339307 AACTGGGGACACTTGGGCTGAGG - Intronic
998963073 5:147509390-147509412 AGCTGGAGAAAGTTGTGCCCGGG + Intronic
1001220006 5:169892488-169892510 AGCTGGAACCAGGTGGGCCATGG - Intronic
1001405976 5:171477959-171477981 AACTGGAGACAGGTGGAATAGGG - Intergenic
1002103666 5:176869499-176869521 AGCTGGACACGGGTGGGCTGTGG - Intronic
1002320735 5:178374117-178374139 AGATGGAGACAGTGGATCTAAGG + Intronic
1006577977 6:35059807-35059829 ACCTGGAGACTGTTGGGATTTGG + Intronic
1006909300 6:37553765-37553787 AGCTGGTGACATGTGGGCTGGGG + Intergenic
1008258981 6:49341930-49341952 AGGTGGAGATAGTTGAACTATGG + Intergenic
1009543413 6:64995118-64995140 AGCTGGAGACTGATTAGCTAAGG + Intronic
1010808396 6:80266660-80266682 AGGTGGAGAGAGTTGGCCCAGGG + Intronic
1013094341 6:106930968-106930990 AGCTGGATACAGTTTGGCTTGGG - Intergenic
1013214622 6:108015901-108015923 AGCTGGAGACATTTTCCCTACGG + Intergenic
1014120524 6:117720487-117720509 AGCTGGAGACAGGAGAGCAATGG - Intergenic
1015452632 6:133388798-133388820 AGCTGAAGACAGTGAGGCAAAGG - Intronic
1017220462 6:151960365-151960387 AGCTGGAGACAGCAGTGCCAGGG + Intronic
1017685291 6:156907246-156907268 AGCTGTCCACTGTTGGGCTAAGG + Intronic
1018741030 6:166728769-166728791 AGCTGGAGAGAGCTGGGCATGGG + Intronic
1019552209 7:1608628-1608650 AGCTGGAGACAGATGGGGCTTGG + Intergenic
1019646766 7:2134674-2134696 TGCTGGACACAATTGGGCTCTGG - Intronic
1020004287 7:4774122-4774144 AGCTGGTGACAGGTAGTCTATGG - Intronic
1022611939 7:31884662-31884684 AGCTAGAGAAAGGTGGGCTGAGG - Intronic
1022954982 7:35372555-35372577 TCCTGGAGACTGTTGGGCAATGG - Intergenic
1023835047 7:44062953-44062975 GGCTGGGGACAGAGGGGCTAAGG - Intronic
1023845772 7:44119340-44119362 TGCTGGAGTCAGCTAGGCTAAGG - Intronic
1026380467 7:69794214-69794236 AGCTTGAGACAGCAGGTCTATGG - Intronic
1027955825 7:84877710-84877732 AGATGGATACAGTTTGGCTTTGG + Intergenic
1029543097 7:101196109-101196131 AGAGGGAGACAGGTGGGCGAGGG + Intronic
1030060152 7:105615357-105615379 GGCTGGAGGCAGTTGGGGAACGG + Intronic
1030742374 7:113125191-113125213 AGCTGGATAAAGTGGGGCTTGGG + Intergenic
1033395364 7:140968704-140968726 AGCTGGCGACATTTGGTGTATGG - Intergenic
1036968339 8:13326507-13326529 AGCTGGCTCCAGTTGGGGTAGGG - Intronic
1037923779 8:22828952-22828974 AGCTGGAGAGAGGGGGGTTATGG - Intronic
1038439916 8:27564564-27564586 AGCTGAGGACAGCTGGGCTCTGG + Intergenic
1038646378 8:29365715-29365737 TCCTGCAGACAATTGGGCTATGG - Intergenic
1040958796 8:53008610-53008632 TGCTGGAGATAGAGGGGCTAGGG - Intergenic
1042225557 8:66512127-66512149 GCCTGGAGATAGTGGGGCTAGGG + Intronic
1042722787 8:71843302-71843324 AGCTGGATTAAGTTGGGCAAGGG + Intronic
1042798236 8:72687929-72687951 AGCTGGAGAAGTTTGGGCTATGG + Intronic
1047357956 8:124141145-124141167 AGGTGGAGACAGGAGGCCTAGGG - Intergenic
1048748457 8:137643227-137643249 AGCTGGAGAGGGTGGGACTATGG + Intergenic
1049874233 8:145004983-145005005 AGCTGGACAGAGCTGGGGTAAGG + Intergenic
1049932357 9:469711-469733 AGGTGGACACAGGTGGGCTGCGG - Intergenic
1052995709 9:34550777-34550799 AGCTGGAGAGGGTGGGGCTTTGG - Intergenic
1055036128 9:71820485-71820507 AGCTGCAGAAAGATGGGCTAAGG + Intergenic
1056780388 9:89544626-89544648 AGCTGGAGACACCTGCGCTCTGG + Intergenic
1057047500 9:91897645-91897667 AGCAGAAGACAGGTGGGCTGAGG + Intronic
1062111180 9:134782878-134782900 AGCTGGAGAGAGTCGGGCCCTGG - Intronic
1062483928 9:136764890-136764912 AGCTGCAGAGAGCTGGGCTGGGG + Intronic
1062702061 9:137912337-137912359 AACAGGAGAGAGTTGGCCTAAGG + Intronic
1192197344 X:69037344-69037366 AGCAAGAGAGAGTTGGGGTAGGG - Intergenic
1197941537 X:131795489-131795511 AGCTTGGGACAGCTGGGCCAAGG + Intergenic
1199101486 X:143805962-143805984 AGCTTGAGACAATTCTGCTATGG - Intergenic
1199999541 X:153051341-153051363 AGCTAGATACAGTTTGGCTTGGG - Intergenic
1201385395 Y:13435394-13435416 AGCTGGACAGAGCTGGGGTAAGG - Intronic
1201386329 Y:13443333-13443355 AGCTGGACAGAGCTGGGGTAAGG - Intronic
1201772026 Y:17624474-17624496 AGGTGGAGACAGCTGGCCTTGGG - Intergenic
1201829529 Y:18281512-18281534 AGGTGGAGACAGCTGGCCTTGGG + Intergenic