ID: 934979444

View in Genome Browser
Species Human (GRCh38)
Location 2:98827837-98827859
Sequence TCCCCTCAGCTTCCAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 263}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934979444_934979450 8 Left 934979444 2:98827837-98827859 CCTGTCTCTGGAAGCTGAGGGGA 0: 1
1: 0
2: 2
3: 28
4: 263
Right 934979450 2:98827868-98827890 AGGTGTGACTTTAGAGGCTGGGG 0: 1
1: 0
2: 0
3: 26
4: 207
934979444_934979448 6 Left 934979444 2:98827837-98827859 CCTGTCTCTGGAAGCTGAGGGGA 0: 1
1: 0
2: 2
3: 28
4: 263
Right 934979448 2:98827866-98827888 AGAGGTGTGACTTTAGAGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 197
934979444_934979449 7 Left 934979444 2:98827837-98827859 CCTGTCTCTGGAAGCTGAGGGGA 0: 1
1: 0
2: 2
3: 28
4: 263
Right 934979449 2:98827867-98827889 GAGGTGTGACTTTAGAGGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 205
934979444_934979451 14 Left 934979444 2:98827837-98827859 CCTGTCTCTGGAAGCTGAGGGGA 0: 1
1: 0
2: 2
3: 28
4: 263
Right 934979451 2:98827874-98827896 GACTTTAGAGGCTGGGGCGCAGG 0: 1
1: 0
2: 1
3: 13
4: 173
934979444_934979447 2 Left 934979444 2:98827837-98827859 CCTGTCTCTGGAAGCTGAGGGGA 0: 1
1: 0
2: 2
3: 28
4: 263
Right 934979447 2:98827862-98827884 GTTCAGAGGTGTGACTTTAGAGG 0: 1
1: 0
2: 1
3: 7
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934979444 Original CRISPR TCCCCTCAGCTTCCAGAGAC AGG (reversed) Intronic
900437945 1:2640424-2640446 TCCCAGCAGCTTCGGGAGACAGG + Intronic
900901889 1:5522779-5522801 TCATCTCAGCCTCCAGGGACGGG - Intergenic
901218161 1:7566291-7566313 TCCCAACATCCTCCAGAGACAGG - Intronic
901646138 1:10717769-10717791 TCCCTTCGGCTTCCAGAGTTGGG - Intronic
901664486 1:10818733-10818755 TCCCCCCAAGCTCCAGAGACTGG + Intergenic
902255814 1:15187923-15187945 TCCTCTCAGCTTGCACAGTCAGG - Intronic
902671053 1:17974121-17974143 TCCACTCAACTTCCAGACAAGGG + Intergenic
903211779 1:21822897-21822919 GCCCCACAGCTACCTGAGACGGG - Exonic
903413980 1:23168807-23168829 GCCGCTCAGCTGCCAGCGACCGG + Exonic
904613520 1:31737819-31737841 TCCCCTCATCTACCATAGACTGG + Intronic
907241137 1:53081743-53081765 ACCCCTCACTTTGCAGAGACTGG + Intronic
907666374 1:56436977-56436999 GTCCCCCAGCTGCCAGAGACTGG + Intergenic
908331006 1:63071138-63071160 TCCTCTCAGCTCTCCGAGACTGG + Intergenic
912264576 1:108143992-108144014 TTCCCTCACCTTCCAGATGCAGG - Intronic
912927993 1:113929983-113930005 TCCCCTCAGCTCCCTGAGGCGGG + Intronic
913963303 1:143355134-143355156 GCCCCTCTGCTTTCCGAGACAGG + Intergenic
914057659 1:144180720-144180742 GCCCCTCTGCTTTCCGAGACAGG + Intergenic
914121487 1:144785646-144785668 GCCCCTCTGCTTTCCGAGACAGG - Intergenic
914860667 1:151383243-151383265 TCCTTTCTTCTTCCAGAGACAGG - Intergenic
915544107 1:156586229-156586251 TACCCTGGGCTTCCAGAGCCGGG - Intronic
916066290 1:161138567-161138589 TCCCTCCAGCTTTCAAAGACTGG + Intergenic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
916732501 1:167579296-167579318 TCCCCACAGCTTTCCGAGGCAGG + Intergenic
917095140 1:171392376-171392398 TGGGGTCAGCTTCCAGAGACAGG - Intergenic
918056605 1:181026767-181026789 TTCCCGCAGCTTCCAGGGGCAGG - Intergenic
918315248 1:183317639-183317661 TCTTCTCGGCTTCCAAAGACTGG - Intronic
920130866 1:203730858-203730880 CCTCATCAGCTTCCAGAGTCAGG - Intronic
920949016 1:210555345-210555367 TTCTCTCAGCTTGCAGAGAAGGG - Intronic
921057261 1:211552518-211552540 TCCCCGCAGCTCCCAGCCACTGG + Intergenic
921901114 1:220451856-220451878 TCCCATCAGCATACAGAGAGTGG - Intergenic
1063156444 10:3383510-3383532 TTCCCTCAGGGGCCAGAGACAGG + Intergenic
1067169224 10:43892431-43892453 TCCCAGCAGCTTCCAGAGATGGG + Intergenic
1069569330 10:69484930-69484952 TGCCCTCCGGCTCCAGAGACAGG + Intronic
1070467540 10:76738745-76738767 TCTCCTGAGCTTCCTGAGAAAGG + Intergenic
1070899227 10:80013582-80013604 TCCCATCAGCAACAAGAGACTGG + Intergenic
1072355524 10:94605950-94605972 TCCCCCCACCTTCAACAGACTGG - Intronic
1072519027 10:96214061-96214083 TGAGCTCTGCTTCCAGAGACAGG - Intronic
1072973983 10:100041809-100041831 TCCACACTGCATCCAGAGACTGG - Intergenic
1073268986 10:102245664-102245686 TCCCATCTGCTACCAGAGCCGGG + Exonic
1073593999 10:104782428-104782450 TCCTCCCAGGTTCCAGTGACAGG - Intronic
1074058498 10:109943597-109943619 TCCCCTGGGCCTTCAGAGACAGG + Intronic
1075297698 10:121292566-121292588 TCGCCTCAGCTTCCCAAGTCTGG - Intergenic
1077116861 11:889117-889139 ACCCCACAGCTGCCAGAGGCCGG + Intronic
1078860140 11:15239189-15239211 ACCCCTGAGCCCCCAGAGACAGG - Intronic
1079176721 11:18148815-18148837 TCCCCTAGGCTTACAGGGACAGG + Intronic
1079259857 11:18868001-18868023 TCCCCTAAGCTTAAAGGGACAGG - Intergenic
1082810738 11:57477369-57477391 TCCCCTCAACCTCCTGACACTGG + Exonic
1083508325 11:63182223-63182245 TCCCCTCAGCACCCAGAGGAAGG - Intronic
1083547279 11:63558328-63558350 CTCCCTCAGCTGCCAGAGGCTGG - Intronic
1083896968 11:65624834-65624856 TCCCCTCAACTCCCAGAGGCTGG - Intronic
1084701763 11:70790908-70790930 TGCCCCCAGCCTGCAGAGACGGG - Intronic
1085159599 11:74328263-74328285 TCTCCTCACATCCCAGAGACGGG - Intergenic
1085517985 11:77122421-77122443 GCCCCTTCGTTTCCAGAGACAGG - Intronic
1085592585 11:77778093-77778115 TCCCCTCCCCTTCCCAAGACAGG - Intronic
1085674843 11:78506875-78506897 TACCCGCAACTTCCAGAGAAAGG + Intronic
1088133465 11:106524697-106524719 TCCAGTCAGCTTCCAGAGGAGGG - Intergenic
1088376302 11:109145462-109145484 CCCCCCCATCTCCCAGAGACAGG - Intergenic
1089697834 11:120226737-120226759 TCCCCTGACCCTCCAGAGTCAGG - Intronic
1089698899 11:120232337-120232359 TCCCCTCATCCACCAGAGCCAGG - Intergenic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1090868703 11:130724336-130724358 TTCCCACAGCCTCAAGAGACGGG + Intergenic
1091420449 12:335158-335180 TCCACTCTGTTTCCAGAAACTGG - Intronic
1091641148 12:2238642-2238664 TTCCCTCTGCTCCCAGAGAATGG - Intronic
1093008413 12:14077956-14077978 TCCCATCAGCTCCCAGAGACAGG + Intergenic
1094141048 12:27182431-27182453 TCCCCTCAACCTCCAGTGAGGGG + Intergenic
1096070958 12:48775317-48775339 TCTGCTCACCTTCCAGAGAGAGG - Exonic
1097023476 12:56036686-56036708 TACACTCAGCTCCCAGACACAGG + Exonic
1098481530 12:70967386-70967408 TCCCCTCAGCTTCCCAAAGCTGG - Intergenic
1102060352 12:109926620-109926642 ACCCCTGAGCCTGCAGAGACTGG - Intronic
1102188987 12:110971662-110971684 TCCTCTCTGCTTACAGGGACAGG - Intergenic
1102360718 12:112285332-112285354 TCCCTAGACCTTCCAGAGACTGG + Intronic
1102899063 12:116622016-116622038 TCCCCTAAGCTTCCAAAGCCAGG + Intergenic
1103174577 12:118851475-118851497 TGCCCTCACCTTCCAGAAAAGGG - Intergenic
1103935217 12:124472462-124472484 TCCATTCAGATTCCAGAGCCAGG + Intronic
1104038077 12:125112302-125112324 GCAGCTCAGCTTCCAGAGCCCGG + Intronic
1104367130 12:128187901-128187923 TCCTCTCACTTTTCAGAGACCGG + Intergenic
1104740329 12:131167292-131167314 GCCCTTCAGCTTGCAGAGACTGG + Intergenic
1104791880 12:131488145-131488167 GCCCTTCAGCTTGCAGAGACTGG - Intergenic
1105781089 13:23705799-23705821 CCCACTCAGCATCCAGTGACAGG + Intergenic
1107699859 13:43036686-43036708 TCCCCGCAGCCTCTAGAGCCAGG - Intronic
1112675234 13:101693778-101693800 TCCCCTCAACTCACAGAGAAAGG - Intronic
1114050516 14:18916837-18916859 TCCCATCACCTTCCAGAAGCAGG - Intergenic
1114112041 14:19485095-19485117 TCCCATCACCTTCCAGAAGCAGG + Intergenic
1116069641 14:40027064-40027086 TGAACTCAGTTTCCAGAGACTGG - Intergenic
1116302959 14:43209258-43209280 TCCCTTCTGCTTCCAGAGCTTGG + Intergenic
1116636718 14:47405478-47405500 TCCCCTTATCTTCGAGAAACAGG - Intronic
1117779845 14:59221154-59221176 TCACCTCCACTTCCAGAGAAGGG - Intronic
1118148852 14:63166223-63166245 GCCCCTCACCTCCCGGAGACGGG - Intergenic
1119703944 14:76772647-76772669 TCCCCGCAGCTGCCTGAGCCTGG - Intronic
1122973595 14:105162204-105162226 CCCCCTTGGCCTCCAGAGACTGG - Intronic
1124925336 15:34064991-34065013 TCCTCTCAGAATCCAGAGTCTGG + Exonic
1125792323 15:42376740-42376762 TCCTCTCAGCTTGTAGAGAAAGG + Intronic
1127283182 15:57509521-57509543 GCTCCTCAGCTTCCTGAGTCAGG + Intronic
1127646790 15:60966617-60966639 CCCTCTGACCTTCCAGAGACTGG + Intronic
1128307817 15:66611607-66611629 TACTCTTAGCTTCCAGAGCCTGG + Intronic
1128856700 15:71023984-71024006 ACCACTGAGCTCCCAGAGACAGG + Intronic
1129325069 15:74795561-74795583 GCCCCTCTGCTTCCTGAGACAGG + Intronic
1129606274 15:77026597-77026619 GCCCCTCAGTCTCCACAGACAGG + Intronic
1129782227 15:78280031-78280053 TCACCTCACCTGCCAGAGAAAGG - Exonic
1131177988 15:90221752-90221774 TCCCCTCACCTTGCAGATGCGGG - Exonic
1137622793 16:49887359-49887381 TACCCACAGATTCCAGAGACTGG + Intergenic
1139340176 16:66263367-66263389 ACCCCTCAGCCTCCAGAGATGGG + Intergenic
1139393342 16:66620317-66620339 TCCCCTCTGCTCCCACAGAGAGG - Intronic
1141048224 16:80736473-80736495 TCCCCTCATATTCAAGAGACTGG - Intronic
1141239713 16:82254346-82254368 TCCCCTGACCTTCCTGGGACAGG - Intergenic
1144637051 17:16916744-16916766 TGCCCTCACCATCAAGAGACAGG - Intergenic
1146916183 17:36679913-36679935 ATCCCTCGGCTCCCAGAGACAGG + Intergenic
1151392180 17:73794892-73794914 TCCTCTCAGATTACAAAGACAGG - Intergenic
1151980823 17:77507414-77507436 TCCACTCACCTGCCTGAGACTGG - Intergenic
1152008220 17:77695543-77695565 TCCCCTCTGCTTCCAGAACTGGG - Intergenic
1152366663 17:79860411-79860433 TACCCTCAGCTGCCAGAGCATGG - Intergenic
1152827944 17:82479285-82479307 TGCCCTCAGCCTCCAGGCACAGG - Intronic
1153646688 18:7202291-7202313 TGGCCACAGCTACCAGAGACTGG + Intergenic
1155356451 18:24958249-24958271 TCCCATCTGATTCCAGAGCCAGG - Intergenic
1156407448 18:36796589-36796611 TCCCCATTGCTTCCAGAGGCAGG + Intronic
1157543434 18:48530057-48530079 TAACCACAGCTTCCAGAGATGGG + Intergenic
1158345801 18:56515733-56515755 TCCCCTCAGCTGACTGAGAGAGG + Intergenic
1159616902 18:70591592-70591614 TCCCATCAGCTTCCAGAGATGGG + Intergenic
1160951438 19:1669416-1669438 TCCCTGCAGCTCCCAGAGGCAGG - Intergenic
1162428559 19:10612643-10612665 CCCCCACAGCTTCCGGACACTGG - Intronic
1163250508 19:16123991-16124013 TCCCCTCAGCTCCCTGAAATAGG + Intronic
1164821717 19:31255972-31255994 ACCCCTCCGCTTCCAGTGACTGG - Intergenic
1165113976 19:33518051-33518073 TCCCCTCAGCCTCCAGCGTGGGG + Intronic
1165988031 19:39787626-39787648 TCCCTTCAGTTCCCAGAGATAGG - Intergenic
1166706552 19:44911202-44911224 CCCCCTCAGTTCTCAGAGACGGG + Intergenic
1167707602 19:51090769-51090791 ACCCCCCAGCTTCCAAAGATAGG - Intergenic
1167764615 19:51473216-51473238 TCCAGTCAGCTTCCAAAGATGGG + Intergenic
1202697142 1_KI270712v1_random:133393-133415 GCCCCTCTGCTTTCCGAGACAGG + Intergenic
924985980 2:270340-270362 GCCCGTCAGTTTCCAGACACTGG + Intronic
925326260 2:3024273-3024295 TCCCCTCAACTCCAAGAGCCAGG + Intergenic
926044145 2:9697350-9697372 TCCTGCAAGCTTCCAGAGACGGG - Intergenic
926634808 2:15167545-15167567 TCACTACAGCTTCCAGATACTGG + Intronic
927174203 2:20393905-20393927 TCACCACAGCTTCCAGAGGTAGG - Intergenic
928050853 2:27993674-27993696 TACCCTCAGCTTCCTCAAACCGG - Intronic
929311522 2:40431537-40431559 TCCCTTCTGCTTCCAGAACCTGG + Intronic
932372713 2:71205792-71205814 TGCCCAAAGCTTCCAGAGATGGG + Intronic
932607110 2:73172730-73172752 GTCCCTCAGCTTCCTGAGACAGG + Intergenic
932770702 2:74499425-74499447 GCGCCGCAGCTTCCAGAGTCGGG - Exonic
934278308 2:91590409-91590431 GCCCCTCTGCTTTCCGAGACAGG + Intergenic
934979444 2:98827837-98827859 TCCCCTCAGCTTCCAGAGACAGG - Intronic
935123557 2:100202608-100202630 TCCCCTCTCTTTCCAGAGGCTGG - Intergenic
935230637 2:101092857-101092879 TCCCCTCAGTGTACAGAGCCAGG + Intronic
936610516 2:113997708-113997730 TCCCCTAAGCTTCTAGAGTATGG - Intergenic
936757416 2:115731412-115731434 CCACCTCAGCTTCCAGAGTAGGG - Intronic
937025346 2:118692960-118692982 TCCCCTCAGCCTGCAGGGAGAGG + Intergenic
941870112 2:170375302-170375324 TCCACTCACATTCCAGAGAGTGG - Intronic
944047292 2:195427740-195427762 CCCCCTCAGCCTCCTGAGCCAGG - Intergenic
944160689 2:196656162-196656184 TCCCTTCTGCTTCTAGAGGCAGG + Intronic
946089517 2:217208210-217208232 TCCCCTCCACTTCCAGAGCGGGG - Intergenic
946597923 2:221326982-221327004 CCACCTCAGCCTCCTGAGACGGG - Intergenic
947461784 2:230310019-230310041 ACCTCTCAGCTTCCACAGGCGGG - Exonic
1169043978 20:2521192-2521214 TCCACTCTTCTTCCAGAGGCTGG - Intronic
1169307295 20:4503193-4503215 TCCACTCAGGTTCAAGAGAAGGG + Intergenic
1170715757 20:18829460-18829482 TCCCTTCAGGTTGCAGAGATGGG - Intronic
1170935561 20:20806062-20806084 CGGCCTCAGCCTCCAGAGACAGG - Intergenic
1171172143 20:23024786-23024808 TTCCAGCAGCTTACAGAGACTGG - Intergenic
1172121004 20:32598704-32598726 TCACCTCAGCTCCCAGGGAAGGG - Intronic
1172538195 20:35690463-35690485 AGCCCTCAGCTTCCAGTGAACGG + Exonic
1172998146 20:39085951-39085973 TTCCCTCTGCTTCCAGGGGCAGG - Intergenic
1173229717 20:41184700-41184722 GCCCCTCACCTTCCACAGTCAGG - Exonic
1173341879 20:42160508-42160530 ACCCCTCAGCATCCAGACAAAGG - Intronic
1173420389 20:42895987-42896009 TCCCTCCAGTTCCCAGAGACGGG - Intronic
1175813840 20:61873416-61873438 TTCTCTAAGCTTCCAGAGCCTGG - Intronic
1180117702 21:45722338-45722360 TGACCTCAGCTCTCAGAGACAGG - Intronic
1180468992 22:15639211-15639233 TCCCATCACCTTCCAGAAGCAGG - Intergenic
1180698004 22:17766039-17766061 CCCCCTCAGCCTCCAGAGCCGGG + Intronic
1181581886 22:23833164-23833186 TCCACTCAGTGTCCAGAGCCAGG - Intronic
1183660797 22:39220067-39220089 TCCTCTCAGCATCCTGAAACTGG - Intergenic
1184970836 22:48018826-48018848 CCACCTCAGCTGCCAGAGCCTGG - Intergenic
1185314599 22:50173579-50173601 CCCCCTCAGCCTGCAGAGAGTGG + Intronic
949193847 3:1282452-1282474 TCCACTCAGATTACAGAGAATGG - Intronic
950491208 3:13306055-13306077 TCCCCTCAGCTGCCACAGAGGGG + Intergenic
950628907 3:14268247-14268269 TCACCTCAGCGTCCAGGGCCTGG + Intergenic
952160873 3:30691714-30691736 TCCCCACAGCTTACAGGGAGGGG - Exonic
953660738 3:44889831-44889853 TCCCCTGAAGTTCCAGACACTGG + Intronic
953783395 3:45892137-45892159 TCCTCTCAGCAGACAGAGACAGG + Intronic
955599430 3:60629188-60629210 TCCCCTCAGCTTCCAGTCAAGGG - Intronic
956721500 3:72121991-72122013 TCAACTCAGCTTGCAGTGACTGG + Intergenic
956930209 3:74034967-74034989 TTATCTCAGCTTCCAGAGCCTGG - Intergenic
957109045 3:75929525-75929547 CCACCTCAGCTTCCAGCCACAGG - Intronic
958453839 3:94306012-94306034 TGCCTTCATCTTCCAGAGTCCGG + Intergenic
960957348 3:123042636-123042658 TGCCCTCAGATTCAAGAGTCTGG - Intergenic
962606284 3:137035360-137035382 TGCCCTCAGCTGCTAGAGCCTGG - Intergenic
962912499 3:139866150-139866172 TTCCTTCAGATTCTAGAGACAGG + Intergenic
962994422 3:140611407-140611429 TCCATTCACCTTCCAAAGACAGG + Intergenic
964276936 3:155018878-155018900 TCTCCTCAGATTCCCGAGAGAGG + Intergenic
967323017 3:188212680-188212702 TCGCCTCAGCTTCCAGAACAAGG - Intronic
967607975 3:191470911-191470933 TCACCTCACCTCCCTGAGACAGG + Intergenic
967977791 3:195045050-195045072 TCCCCTCAGATTCCGCAGATGGG - Intergenic
968554267 4:1239347-1239369 TCCCCTCCTCCTCCAAAGACCGG + Intronic
968599385 4:1501904-1501926 TCCCCTCGCCCTCCAGAGGCTGG - Intergenic
969032448 4:4225932-4225954 GCCCCTCTGCTTTCCGAGACAGG - Intronic
969113300 4:4856818-4856840 GCCCCTCGGCTTCCCGAGCCGGG - Intergenic
969634190 4:8356664-8356686 TCCCCTCACCTGCCAGGAACAGG - Intergenic
969670588 4:8587944-8587966 ACCCCTAGGCTTCCAGAGATGGG - Intronic
970200286 4:13597904-13597926 TAGCCTCAGCTTCCTGAGACTGG + Intronic
971349412 4:25843097-25843119 TCCCCACTGCTTCCAGCCACAGG - Intronic
974904946 4:68044120-68044142 TGCCCTCAGCTTCTGGAGACTGG + Intergenic
975672820 4:76798793-76798815 GCCCCTCTGTTTCCAGAAACTGG + Intergenic
976226054 4:82796729-82796751 TCCCCCCTGCTTCCAGAGGCAGG - Intronic
976656056 4:87489747-87489769 TCTCCTCCCCTTCCAGACACAGG - Intronic
977682132 4:99808485-99808507 TCCCCTCCACTTCCACAGGCAGG - Intergenic
977697369 4:99981645-99981667 TCCCCTCGCCCTCCTGAGACAGG + Intergenic
977708587 4:100098896-100098918 TCCACTCAACTCCCAGAGGCAGG - Intergenic
980133751 4:128841085-128841107 TCTCTACAGATTCCAGAGACAGG - Intronic
980203364 4:129685202-129685224 TACCCTAAGTTTCCAGAAACAGG + Intergenic
981936220 4:150242686-150242708 TCCCCAAAGCAGCCAGAGACAGG + Intronic
982694065 4:158579966-158579988 TTCCCACAGGTTCTAGAGACAGG + Intronic
984835218 4:184013117-184013139 GCCCCTGGGCTTCCACAGACAGG + Intronic
986095050 5:4546393-4546415 TCAGCTCAGCCTCCTGAGACTGG + Intergenic
987021563 5:13878016-13878038 TCCCGTCTGCTCCCAGAGATAGG - Intronic
987053328 5:14166692-14166714 TCCCACCAGCCTCCTGAGACAGG - Intronic
987252032 5:16109688-16109710 TCACCTCAGCTTCTAATGACTGG - Intronic
987731306 5:21776165-21776187 TGCCCTCAGTTTCCAGCCACAGG - Intronic
988815573 5:34830985-34831007 TCCCTTCAGATTCCAGAGCTGGG + Intronic
990177066 5:53119655-53119677 TCCAGTCAGCTGCCAGGGACAGG + Intergenic
991614943 5:68486318-68486340 GCCCTTCAGATTCCAGAGAGAGG - Intergenic
992314304 5:75536719-75536741 GCCCCCCAGCTACCAGAGGCAGG + Intronic
994174946 5:96701315-96701337 GCCCCACAGCTTCCAGAGTTAGG - Intronic
996089533 5:119337414-119337436 TGCCCTCAGGTTCTAGTGACAGG - Intronic
996631528 5:125638906-125638928 TCCCCTCTGCTTCCAGAGCTAGG - Intergenic
996957081 5:129196141-129196163 TTTCCTCAGCCTCCAGAAACTGG - Intergenic
997240535 5:132303506-132303528 TCCCATCAGCTTCCAAGGAAGGG + Intronic
997304414 5:132827238-132827260 ACCCCTGAGCTTCCTGAGAATGG + Intronic
998040797 5:138950009-138950031 ACCCCAAAGCTTCCAGAGGCAGG + Intronic
998216409 5:140241285-140241307 TCTCCCCAGCCTCCAGAGACAGG - Intronic
998465809 5:142342792-142342814 TCCCCTGTGGTTCCAGAGAAAGG + Intergenic
998619758 5:143781067-143781089 TCACCTCACCTGCCAGGGACAGG + Intergenic
998977824 5:147667812-147667834 TCCCCACAGCCTCCAGATACAGG - Intronic
999238417 5:150113664-150113686 GCCCCCCAGCTTCCAGCGAGGGG + Intergenic
999287869 5:150404972-150404994 CCCCTTCAGCTTCCTGAGAATGG + Intronic
1000320945 5:160133877-160133899 TTCCCTCAGTTTACAGAGAAGGG + Intergenic
1002942815 6:1733095-1733117 TCCCCTCCCCATCCAGAGGCAGG - Intronic
1004746584 6:18514832-18514854 TCCACTTAGCTCCCAGAGAATGG - Intergenic
1005402286 6:25447440-25447462 TTCCATCACCTTGCAGAGACTGG - Intronic
1006922293 6:37634862-37634884 TCCCCTCAGGATCCATAGAGTGG - Exonic
1007306264 6:40907779-40907801 TCCCCTCACTTTTCAGAGCCAGG - Intergenic
1007805827 6:44445179-44445201 ATCCCTCAGCTCCCAGAGCCAGG + Intronic
1009467546 6:63990755-63990777 TCCCATCAGCATTCTGAGACAGG - Intronic
1009535125 6:64872565-64872587 GCCCCTCTGCTTCCAGGGAGTGG + Intronic
1010563727 6:77383288-77383310 ACCCCTCCCCTACCAGAGACAGG - Intergenic
1011908937 6:92410448-92410470 TCCCCTCTGCTCCCAGAGCTAGG + Intergenic
1013932839 6:115555486-115555508 TTCCCTCATCTCCCAGAGAGTGG + Intergenic
1014101579 6:117517396-117517418 TCCCCACTGCTTCCACAGGCTGG + Intronic
1016384348 6:143516078-143516100 ACCACTCAGTTTCCACAGACAGG - Intergenic
1018661248 6:166089084-166089106 TCCCCTCAGCTTTTAGAGAGTGG - Intergenic
1018956255 6:168412492-168412514 TCAGCTCGGCTTCCAGAGCCTGG - Intergenic
1019436679 7:1025812-1025834 TCCCCTGGGCCTCCAGAGGCAGG + Intronic
1019520221 7:1457506-1457528 TCCCCTCAGCCTCCAGATGCAGG - Intronic
1019701610 7:2477047-2477069 TCCCCTCGCCTGCCAGAGCCTGG - Intergenic
1021840268 7:24716842-24716864 GCCCTTCACCTTCCAGAGACAGG + Intronic
1022529222 7:31056806-31056828 ACCCTCCAGCTTCCACAGACTGG + Intronic
1023310442 7:38881192-38881214 TCCCCCCAGCTTCCAGGGGAGGG - Intronic
1024811113 7:53213370-53213392 TCCCATTAGCTCCCAGAAACAGG - Intergenic
1024896233 7:54265448-54265470 AACCCTCAGCTTCCAGGGACTGG - Intergenic
1026264812 7:68786965-68786987 TCCTATCAGCTTCCAGGGAGGGG - Intergenic
1028023156 7:85804003-85804025 TCACCTTAGCTTGCTGAGACAGG + Intergenic
1031454764 7:121965433-121965455 TGCTCTCAGCTCCCAGAGGCAGG + Intronic
1033601628 7:142892857-142892879 CCCCCTCAGCTTCCAGCTATAGG + Intergenic
1038189747 8:25309050-25309072 CCCCCTCAGCTTCCAACCACAGG + Intronic
1038636559 8:29292237-29292259 TCCCCCCACCTTTCAAAGACAGG - Intergenic
1040431121 8:47343548-47343570 TTTCCTCAGCTTTGAGAGACTGG - Intronic
1041572889 8:59357716-59357738 TGGAGTCAGCTTCCAGAGACAGG - Intergenic
1042012284 8:64260569-64260591 TCCCCACATCTTCAGGAGACTGG - Intergenic
1047421635 8:124712464-124712486 TCCGCTCAGCTTCCAGAAGTGGG + Intronic
1047544327 8:125800728-125800750 CACCCTCAGCTTCCAGATGCTGG - Intergenic
1047913706 8:129559109-129559131 ACCACTCAGCTTCCAGAAAACGG + Intergenic
1048261572 8:132949787-132949809 GCCTCTCAGTTTCCAGAGATGGG + Intronic
1048557505 8:135494837-135494859 TCCCCACAGCTTCCAGCCAAAGG - Intronic
1049462506 8:142736630-142736652 TGCCCTCAGCTCCCAGAGAGGGG + Exonic
1051230296 9:14948758-14948780 TCTCCTTAGCTTCCAGATCCAGG + Intergenic
1051727464 9:20102899-20102921 TCCCTTGAGCTTCCAGAGTGAGG - Intergenic
1052698633 9:31910953-31910975 TCCCCTCTGTTTTCAGACACTGG + Intergenic
1055344317 9:75318316-75318338 TCCCCTCAGCCTCCAGTCAAGGG - Intergenic
1055432679 9:76259870-76259892 TCCCCTCTGCTTCCAGATGAGGG - Intronic
1056509363 9:87288486-87288508 TTCCATCAGCTTCCTGAGATGGG - Intergenic
1056767865 9:89455707-89455729 CCACCTGAGCTTTCAGAGACAGG + Intronic
1056805973 9:89729097-89729119 TCCCCATAGCTTCCGCAGACTGG + Intergenic
1060002509 9:119971017-119971039 ATCCCTCAGCTACCAGAGCCTGG - Intergenic
1060900214 9:127250476-127250498 GCCCCTCTGCTAACAGAGACAGG + Intronic
1061266951 9:129511679-129511701 TGGCCTCAGCTTCCAGGGAAGGG + Intergenic
1062178145 9:135175772-135175794 TCCCCACAGCCCCCAGAGCCAGG + Intergenic
1062287209 9:135778542-135778564 TCCCCTCCTCTTCCAAAGTCTGG + Intronic
1062383150 9:136297399-136297421 TCCTCTCAACACCCAGAGACTGG - Intronic
1062468047 9:136690148-136690170 TGCCCTCAGCTACCAGGGGCAGG + Intergenic
1062656511 9:137606594-137606616 TCCTCTCAGCCTCCTGGGACAGG + Intronic
1186239353 X:7549831-7549853 TCTCCTCAACTTCCAGAGAAGGG - Intergenic
1188951109 X:36376398-36376420 TCCCATCAGCATTCTGAGACAGG + Intronic
1189430798 X:40945210-40945232 TCTCCTCAGCTGCCAAAGTCTGG + Intergenic
1192223145 X:69211027-69211049 TCCCCCCAGCTGCCACAGGCTGG + Intergenic
1192249709 X:69401536-69401558 TCCCCTGTCCTTCCAGAGCCAGG - Intergenic
1198008504 X:132524854-132524876 TCCCTTCAGATTCCAGAGCTGGG + Intergenic
1199331614 X:146567089-146567111 TTCACTAAACTTCCAGAGACTGG - Intergenic
1201458610 Y:14198250-14198272 TCTCCTCAACTTCCAGAGGAGGG - Intergenic