ID: 934983579

View in Genome Browser
Species Human (GRCh38)
Location 2:98868365-98868387
Sequence CTGACAGAGACTGCCCTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934983572_934983579 23 Left 934983572 2:98868319-98868341 CCGTTCGCCCAGCTCAAGTGATG 0: 1
1: 0
2: 0
3: 10
4: 172
Right 934983579 2:98868365-98868387 CTGACAGAGACTGCCCTACTGGG 0: 1
1: 0
2: 0
3: 8
4: 123
934983570_934983579 30 Left 934983570 2:98868312-98868334 CCCAAGACCGTTCGCCCAGCTCA 0: 1
1: 0
2: 0
3: 3
4: 42
Right 934983579 2:98868365-98868387 CTGACAGAGACTGCCCTACTGGG 0: 1
1: 0
2: 0
3: 8
4: 123
934983574_934983579 16 Left 934983574 2:98868326-98868348 CCCAGCTCAAGTGATGTGCGGAT 0: 1
1: 0
2: 0
3: 3
4: 93
Right 934983579 2:98868365-98868387 CTGACAGAGACTGCCCTACTGGG 0: 1
1: 0
2: 0
3: 8
4: 123
934983571_934983579 29 Left 934983571 2:98868313-98868335 CCAAGACCGTTCGCCCAGCTCAA 0: 1
1: 0
2: 1
3: 0
4: 37
Right 934983579 2:98868365-98868387 CTGACAGAGACTGCCCTACTGGG 0: 1
1: 0
2: 0
3: 8
4: 123
934983575_934983579 15 Left 934983575 2:98868327-98868349 CCAGCTCAAGTGATGTGCGGATA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 934983579 2:98868365-98868387 CTGACAGAGACTGCCCTACTGGG 0: 1
1: 0
2: 0
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934983579 Original CRISPR CTGACAGAGACTGCCCTACT GGG Intronic