ID: 934983911

View in Genome Browser
Species Human (GRCh38)
Location 2:98870194-98870216
Sequence GAGTGTTGACAGAGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934983907_934983911 -9 Left 934983907 2:98870180-98870202 CCAGGCAATATCTGGAGTGTTGA 0: 1
1: 0
2: 1
3: 9
4: 109
Right 934983911 2:98870194-98870216 GAGTGTTGACAGAGGGCTCTGGG 0: 1
1: 1
2: 0
3: 16
4: 213
934983904_934983911 10 Left 934983904 2:98870161-98870183 CCGGTACAGTCAGCAGTTTCCAG 0: 1
1: 0
2: 0
3: 15
4: 251
Right 934983911 2:98870194-98870216 GAGTGTTGACAGAGGGCTCTGGG 0: 1
1: 1
2: 0
3: 16
4: 213
934983903_934983911 20 Left 934983903 2:98870151-98870173 CCAACTGCAACCGGTACAGTCAG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 934983911 2:98870194-98870216 GAGTGTTGACAGAGGGCTCTGGG 0: 1
1: 1
2: 0
3: 16
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934983911 Original CRISPR GAGTGTTGACAGAGGGCTCT GGG Intronic
900918190 1:5652820-5652842 TAACGTTGACAGAGGGCTCAAGG + Intergenic
902217892 1:14945937-14945959 CAGTGTTGACGGAGGGCTCATGG + Intronic
903218590 1:21856282-21856304 GAGAGTTGGCAGAGTGTTCTTGG - Intronic
903660169 1:24972270-24972292 GAGTGAGCTCAGAGGGCTCTGGG - Intergenic
904269944 1:29343407-29343429 GAGTCATGAGAGTGGGCTCTGGG + Intergenic
904810815 1:33162415-33162437 GACTGTTGACAAAAGGCTCTGGG - Intronic
905804525 1:40866138-40866160 GAGTGTGGACAGAGTGCAGTGGG + Intergenic
906249631 1:44301174-44301196 CTCTGCTGACAGAGGGCTCTAGG + Intronic
906462052 1:46042152-46042174 GAGTGTTGACTGATGGGTGTGGG + Exonic
909438724 1:75673587-75673609 GAGTGGTCACAGTGGGCTTTGGG + Intergenic
910215317 1:84838207-84838229 GAGTATTGGCACAGGGCTGTTGG - Intronic
913548049 1:119889150-119889172 GAGTTTTGACAGAGCATTCTTGG - Intergenic
916174890 1:162030088-162030110 GAGTGGTGTCAGGGTGCTCTGGG + Intergenic
916466191 1:165076641-165076663 GGGGGTTGACAGAAGGGTCTGGG + Intergenic
917537581 1:175885584-175885606 GGCTGTTGTCAGAGGGCTCTTGG + Intergenic
919882158 1:201907841-201907863 CAGTGTTGACAGAAGCCTCTTGG - Intronic
921148363 1:212380073-212380095 GAGAGTACACAGAGGCCTCTGGG + Intronic
921891410 1:220357727-220357749 AAGGGTTGCCACAGGGCTCTAGG - Intergenic
922072877 1:222213760-222213782 GTTTGGAGACAGAGGGCTCTGGG - Intergenic
923644423 1:235802265-235802287 GAGTCTTGCCAGAAGTCTCTTGG + Intronic
1064148490 10:12843618-12843640 GAGTGTTCACTGAGGCCTCCTGG + Intergenic
1064326343 10:14354811-14354833 GAGTTCTGAGAGAGGGGTCTGGG - Intronic
1066024406 10:31339840-31339862 GGATGTTCACAGAGAGCTCTGGG + Intronic
1067293389 10:44960191-44960213 GAGTTGTGCCAGAGGCCTCTAGG - Intronic
1067775602 10:49162898-49162920 GGGTTTTCACACAGGGCTCTTGG - Intronic
1067794844 10:49313515-49313537 GAGTGTTGAAAGCAGCCTCTTGG + Intronic
1069168771 10:65198609-65198631 GAGTGTTAACAGAGCCATCTGGG - Intergenic
1070160271 10:73862663-73862685 GGGTGGAGAAAGAGGGCTCTAGG - Intronic
1071820644 10:89276942-89276964 GAGGGTCGAGACAGGGCTCTGGG - Intronic
1072462333 10:95631069-95631091 GAGTGTTAACAGGGGACTTTTGG + Intronic
1073215542 10:101834134-101834156 GAGTGATGGCACAGGGATCTGGG - Intronic
1074029747 10:109675017-109675039 GACTGTTGTCAGAGGGATCTTGG + Intergenic
1074341681 10:112636995-112637017 ATGAGTTGACAGAGGCCTCTAGG - Intronic
1074343680 10:112659483-112659505 GACTGATGTCTGAGGGCTCTGGG + Intronic
1074983091 10:118635169-118635191 GGGTATTTACAGAGGGCCCTAGG - Intergenic
1075688772 10:124381482-124381504 GGGTGATGACAGAGGCTTCTGGG - Intergenic
1076033352 10:127177699-127177721 GAGTGCTGCCACAGGTCTCTGGG - Intronic
1076219715 10:128723440-128723462 GCTTGTTGAGAGAGGGCCCTGGG + Intergenic
1077483929 11:2830313-2830335 AAGGGTTGACAGAGGGATCTGGG + Intronic
1078909766 11:15719998-15720020 GAGTGTTGAATTAGGTCTCTTGG - Intergenic
1080660670 11:34293461-34293483 GAGGGTTGAGAGAGCTCTCTAGG - Intronic
1080670346 11:34370794-34370816 AAGAGTTGGCAGAGGGGTCTGGG - Intergenic
1083929322 11:65831597-65831619 ATGTGTTGACAGAGGACACTTGG - Intronic
1086413048 11:86561140-86561162 GAGTGTTTTCAGCTGGCTCTTGG + Intronic
1088792224 11:113235979-113236001 GAGTGTTCACAGAGTTCCCTGGG + Intronic
1088887526 11:114019574-114019596 CAGTGAGGACAGAGAGCTCTTGG - Intergenic
1089201329 11:116726279-116726301 GAGGGTGGGCAGCGGGCTCTAGG - Intergenic
1090044237 11:123316921-123316943 GCTTGTTGATAGAGCGCTCTGGG + Intergenic
1096549254 12:52361272-52361294 AAGTGTTGACAGTGAGCTATAGG - Intronic
1100981660 12:100167000-100167022 GACTGGTGTCAGAGGGCTGTGGG - Intergenic
1101650938 12:106676448-106676470 GAGAATTGCCAGAGGCCTCTAGG + Intronic
1102152317 12:110697280-110697302 GAGTGTTGACAAAGGGGTTCAGG + Intronic
1102951852 12:117036560-117036582 GAGAGGTGACTGAGGGTTCTGGG - Intergenic
1105499198 13:20956592-20956614 GACTGCTGACAGGGGGCTCTGGG + Intergenic
1105558227 13:21465807-21465829 GAGTGTTTACAGAAGGCTGGAGG - Intergenic
1106191553 13:27458030-27458052 TAGTGTTGTCAGAGGGCTTGGGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107969583 13:45628491-45628513 GGGTGGTAGCAGAGGGCTCTTGG - Intergenic
1109207196 13:59495737-59495759 GAATGTTGATAGTGGGCTCAAGG - Intergenic
1110232955 13:73185635-73185657 GAGTACTTACAGAAGGCTCTAGG + Intergenic
1113424529 13:110197220-110197242 GAGAGTCAACAGAGGGTTCTGGG - Intronic
1113584876 13:111458309-111458331 GAGTGATTTCAGTGGGCTCTGGG - Intergenic
1202844504 14_GL000009v2_random:155837-155859 GAGTGTTGACAGATGACTCCTGG - Intergenic
1202913895 14_GL000194v1_random:146078-146100 GAGTGTTGACAGCTGACTCCTGG - Intergenic
1124214712 15:27796895-27796917 GAGGGTTGCCAGAGAGCTCCAGG - Intronic
1124253817 15:28124911-28124933 GTGTGTTTACAGAGGCTTCTTGG - Intronic
1124424778 15:29554688-29554710 GAGTGCTCAGAGAGGCCTCTTGG + Intronic
1128552222 15:68605688-68605710 GAGGAGTCACAGAGGGCTCTTGG + Intronic
1128867195 15:71123154-71123176 CAGTGTCCACAGAGGTCTCTTGG + Intronic
1129116107 15:73366316-73366338 GAGTTTGCAAAGAGGGCTCTGGG + Intronic
1131351862 15:91708248-91708270 GAGTGGTGACTGAGTGCTATGGG - Intergenic
1131422670 15:92320295-92320317 GAGAGTTGTCAGAGGGGTGTGGG - Intergenic
1132402651 15:101522932-101522954 GAATGCTGAAAGAGGTCTCTGGG - Intronic
1132416057 15:101619669-101619691 GACTGATGACAGCCGGCTCTGGG + Intergenic
1133675443 16:8066568-8066590 CAGCTTTGACAGAGGACTCTGGG + Intergenic
1134047688 16:11113132-11113154 GGGTGCTGTCAGAGAGCTCTTGG + Intronic
1134778182 16:16871221-16871243 AAGACTTGACAGAGGGCTGTGGG - Intergenic
1135287707 16:21208371-21208393 GATTGATCACAGAGGGCTTTAGG + Intronic
1141473309 16:84254000-84254022 GAGTGTTGGCGGAGGGGTGTTGG + Intergenic
1142257955 16:89024345-89024367 GGGTGTGGACAGGGGGCACTGGG + Intergenic
1142764374 17:2057251-2057273 GCGTGTTGACCGCGGCCTCTGGG - Exonic
1145952774 17:28832612-28832634 GAGTGATGATAGAGGTCTTTAGG - Intronic
1146793276 17:35764835-35764857 CGCTGTTGACAGCGGGCTCTAGG - Exonic
1147419091 17:40313202-40313224 GAGGGCTCACAAAGGGCTCTGGG - Intronic
1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG + Exonic
1149078203 17:52622309-52622331 GAGTGTTGACAAAGGATTCTGGG + Intergenic
1156396622 18:36705181-36705203 GTGTGTTGATGGAGGGATCTGGG - Intronic
1157039773 18:44024562-44024584 GAGTGGTGACAGACGGCACCTGG - Intergenic
1157741675 18:50098908-50098930 GGGTGTTGACAGAGGTGACTAGG - Intronic
1161406551 19:4094428-4094450 GAGTGATGCCAGCGGGTTCTGGG - Intronic
1161675493 19:5645802-5645824 GAGGGTTGACAGAGCCCTGTTGG + Intronic
1161762911 19:6187571-6187593 GGGTGGTGACAGAGGTGTCTGGG + Intronic
1163475843 19:17525673-17525695 GAGTGGAGCCAGAGGGCTCTTGG + Intronic
1164429874 19:28177825-28177847 AAGTGGTGACAGAGGGCACCTGG + Intergenic
1164555691 19:29249165-29249187 GAGAGAGGACAGAGGGCTTTGGG - Intergenic
1165999607 19:39870611-39870633 GAGTGTAGACAGAGAGGTCAGGG + Intronic
927506651 2:23619364-23619386 GGGTGTTCTCAGAGGGGTCTGGG + Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
928370720 2:30738321-30738343 AAGTGTTGACAGTGGGGTGTGGG + Intronic
928485444 2:31726647-31726669 GAATCTTGAGAGTGGGCTCTAGG - Intergenic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
930257809 2:49111726-49111748 GAGTTTTCACAGAAGGCTCTGGG + Intronic
931570878 2:63668171-63668193 GAGGGTAGCCAGTGGGCTCTAGG - Intronic
933391368 2:81672647-81672669 GTGTGATAACAGATGGCTCTGGG + Intergenic
934983911 2:98870194-98870216 GAGTGTTGACAGAGGGCTCTGGG + Intronic
935576402 2:104716200-104716222 GAGTGGTTACAGCAGGCTCTGGG + Intergenic
935846081 2:107166927-107166949 TAGTGTTGACATAGGGATGTAGG - Intergenic
936478952 2:112867654-112867676 TAGTCATGACATAGGGCTCTGGG - Intergenic
937950227 2:127380280-127380302 AAGTGTGCACAGAGTGCTCTAGG + Intronic
938106096 2:128530745-128530767 GAGTTATGACAGTGGGCCCTGGG - Intergenic
939939214 2:148328604-148328626 AAGTGGTGACAGAGGGCACCTGG - Intronic
941655991 2:168145392-168145414 GGGTGCTGACAGTGGGCTCCAGG - Intronic
944240045 2:197477391-197477413 GAGTGTTAACAAATGGATCTTGG + Intergenic
944365193 2:198910940-198910962 GAGTGTTGAGATAGGGCCATAGG + Intergenic
944978830 2:205090738-205090760 GAGTGTAGACACTGTGCTCTTGG + Intronic
946369642 2:219272851-219272873 GAGTGTTGACAGAGATTACTGGG - Intronic
948021535 2:234737547-234737569 GAGTGTGGACAAAGGTCTCAAGG + Intergenic
1169473132 20:5905769-5905791 GAGTGTTGACTGAAGGCACAAGG + Intergenic
1171493753 20:25539766-25539788 GAGTCTAAACAGAGGGCTTTGGG - Intronic
1172109386 20:32536419-32536441 GACTGTTGACAGCGCGCGCTGGG + Intronic
1172835197 20:37869016-37869038 GAGCTTTGGCAGAAGGCTCTGGG - Intronic
1174206881 20:48846763-48846785 GAGTGTTAACAGAGCTCCCTCGG + Intergenic
1174271652 20:49373724-49373746 GAGTGATGTCAAAGGGCTGTGGG + Exonic
1174584604 20:51598324-51598346 TAGTGTTGTCAGAGGGCGCAGGG + Exonic
1174702143 20:52619972-52619994 GATTGTTGACAGTGGACTGTGGG - Intergenic
1175147910 20:56910730-56910752 GCGAGTTGACGGAGGGCTCCAGG + Intergenic
1175392081 20:58633850-58633872 GCTGGTTGACAGAGAGCTCTGGG - Intergenic
1175787928 20:61723761-61723783 GTGTGTTTACAGAGGGATCTGGG + Intronic
1176633250 21:9160753-9160775 GAGTGTTGACAGCTGACTCCTGG - Intergenic
1176640070 21:9294064-9294086 GAGTGTTGACAGCTGACTCCTGG + Intergenic
1177273278 21:18875841-18875863 AAGTGGTGACAGAGGGCACCTGG - Intergenic
1178599451 21:33983498-33983520 GAGTGTGGAGAGAGGTGTCTGGG - Intergenic
1179509004 21:41859861-41859883 GAGTGCTGACAGAGGCCTTCGGG - Intronic
1179769334 21:43602855-43602877 GAGTGAGGAGAGAGGCCTCTGGG - Intronic
1180262243 21:46679971-46679993 CAGTGTGGACTGAGGGGTCTTGG - Intergenic
1180349084 22:11783446-11783468 GAGTGTTGACAGCTGACTCCTGG + Intergenic
1180373372 22:12066900-12066922 GAGTGTTGACAGCTGACTCCTGG + Intergenic
1180424116 22:12901527-12901549 GAGTGTTGACAGCTGACTCCTGG + Intergenic
1181458122 22:23070850-23070872 GAGGGTGGACAGAGGGCGCCGGG + Intronic
1181548079 22:23615963-23615985 GAATGTTGACAGTGTGCTCAAGG + Intronic
1182065525 22:27428840-27428862 GAGTGTTGGCAGAGCTGTCTGGG - Intergenic
1182190830 22:28459041-28459063 GTGTGTTGACAGAGGGGTAATGG + Intronic
1183322800 22:37175554-37175576 GAGTGTCGGGAGAGGGCTCAAGG - Intergenic
1183580815 22:38725629-38725651 GAGTGTTGGGAGAGGGATTTGGG + Intronic
1184246127 22:43236630-43236652 GACTGTTGCCAGAGGCCTGTGGG - Intronic
1184305955 22:43602028-43602050 GGGTGCAGATAGAGGGCTCTAGG + Intronic
951748194 3:26002951-26002973 GAGGGTTGAGAGAGCTCTCTGGG + Intergenic
951907288 3:27717681-27717703 AAGTGTTGACAAAGGGCTCCGGG + Exonic
954548841 3:51463179-51463201 CAGTGTTTAAAGGGGGCTCTCGG + Exonic
955947003 3:64204957-64204979 GTGTGTTGAAAGAGAGCTGTTGG - Intronic
956619694 3:71209162-71209184 GGGTATTGACTGAGGTCTCTTGG - Intronic
957100121 3:75816709-75816731 GAGTGTTGACAGCTGACTCCTGG - Intergenic
958289354 3:91801334-91801356 GAGTGTTTCCAAAGTGCTCTAGG - Intergenic
958320888 3:92317413-92317435 GAGTGTTTCCAAAGTGCTCTAGG - Intergenic
958321657 3:92330186-92330208 GAGTGTTTCCAAAGTGCTCTAGG - Intergenic
958339021 3:92615171-92615193 GAGTGTTTCCAAAGTGCTCTAGG - Intergenic
958342234 3:92667749-92667771 GAGTGTTTCCAAAGTGCTCTAGG - Intergenic
958346489 3:92736821-92736843 GAGTGTTTCCAAAGTGCTCTAGG - Intergenic
958361491 3:92983808-92983830 GAGTGTTTCCAAAGTGCTCTAGG - Intergenic
958364466 3:93032287-93032309 GAGTGTTTCCAAAGTGCTCTAGG - Intergenic
958376268 3:93225540-93225562 GAGTGTTTCCAAAGTGCTCTAGG - Intergenic
958377664 3:93248009-93248031 GAGTGTTTCCAAAGTGCTCTAGG - Intergenic
958400707 3:93625011-93625033 GAGTGTTTCCAAAGTGCTCTAGG - Intergenic
958401230 3:93633688-93633710 GAGTGTTTCCAAAGTGCTCTAGG - Intergenic
959786903 3:110310243-110310265 GAGGGTAGACAGAGCACTCTGGG + Intergenic
961034995 3:123636053-123636075 GAGGGGTGCCAGAGGGCTGTGGG + Intronic
963748933 3:149154435-149154457 GAGTGTACACAGAGTGGTCTGGG + Intronic
964651577 3:159016937-159016959 TAGTGGTGACAGTGGGGTCTCGG + Intronic
968107843 3:196014918-196014940 CAGTGTGGACTGAGGGGTCTTGG + Intergenic
1202746825 3_GL000221v1_random:110958-110980 GAGTGTTGACAGCTGACTCCTGG - Intergenic
969125036 4:4940915-4940937 GAGTGTTTACAGAGGCCAGTGGG - Intergenic
969892242 4:10270536-10270558 CAGTGTTGACATAGCACTCTGGG - Intergenic
970410189 4:15798441-15798463 GAGGGTTGAAAGAGGGCTGCTGG - Intronic
970538585 4:17055211-17055233 CAGTGTTGAGAGAGGGCTGGGGG - Intergenic
971760018 4:30753574-30753596 GATTTTTGACACAGGGCTCAAGG + Intronic
972278345 4:37580731-37580753 TAGTGGTTACAGAGGGCCCTGGG - Intronic
975306742 4:72858062-72858084 GAGTGTTAACAGAGGCATGTAGG - Intergenic
978067071 4:104418264-104418286 GAGTTATGACAGATGGCACTAGG - Intergenic
979772741 4:124549211-124549233 GAGTGTTGGCAAATGCCTCTGGG - Intergenic
980641795 4:135589578-135589600 GAGTGTTTACAGTAGACTCTAGG + Intergenic
983080548 4:163380247-163380269 GAGAGATGACAGAGGGATTTGGG + Intergenic
983435661 4:167711748-167711770 GGGTATTGACAGAGAGCTCAGGG - Intergenic
984851200 4:184154088-184154110 GAGGGTGCAGAGAGGGCTCTGGG - Intronic
1202754961 4_GL000008v2_random:52468-52490 GAGTGTTGACAGCTGACTCCTGG + Intergenic
985469778 5:32985-33007 CAGTGTGGACTGAGGGGTCTTGG + Intergenic
985894863 5:2743070-2743092 GAGTGGTGGGAGAGGGCTCGGGG - Intergenic
986990450 5:13546520-13546542 GAATGGTGACAGAGTGCTCATGG - Intergenic
987027885 5:13946080-13946102 ATGTGTTGACAGAGGATTCTTGG - Intergenic
992878685 5:81083329-81083351 AAGTCTGGACAGAGGTCTCTTGG - Intronic
1003387168 6:5679502-5679524 GAGTGTTGACAGAGGGGTGATGG - Intronic
1007203837 6:40133051-40133073 GATTGTTGACAGAGGTCTACTGG + Intergenic
1011538658 6:88406737-88406759 AAGTGGTGACAGACGGCACTTGG + Intergenic
1013416622 6:109931408-109931430 GAGAGATCTCAGAGGGCTCTTGG + Intergenic
1017819838 6:158041296-158041318 TCATTTTGACAGAGGGCTCTTGG - Intronic
1023123830 7:36935611-36935633 GAGTGTTGAGAGAGAATTCTGGG - Intronic
1023761237 7:43467253-43467275 GAGGGAGGACAGAGTGCTCTGGG + Intronic
1026427201 7:70307689-70307711 GAGTGCTGGTAGAGGGATCTAGG - Intronic
1026503569 7:70963363-70963385 GTGTGTTTACAGGGGGCTGTTGG + Intergenic
1027252632 7:76408666-76408688 CAGGCTTGGCAGAGGGCTCTGGG - Intronic
1029529254 7:101114539-101114561 AAGACTTGACAGAGGGCTCCGGG - Intergenic
1029826905 7:103207095-103207117 GTGTGTGGGCAGAGGGTTCTGGG - Intergenic
1036752780 8:11453930-11453952 GAGTGTGGGCAGTAGGCTCTGGG - Intronic
1037736042 8:21567000-21567022 AGGAGTTGACAGAGGGCTCCCGG + Intergenic
1041402097 8:57456935-57456957 GAATGATGACATAGAGCTCTGGG + Intergenic
1042072840 8:64955819-64955841 AAGTGATGACAGAGGGCACCTGG + Intergenic
1044239937 8:89876994-89877016 GAGTCTTTGCAGAGGGCTTTAGG + Intergenic
1046174382 8:110556090-110556112 GAGCATTTGCAGAGGGCTCTGGG + Intergenic
1048054690 8:130852357-130852379 GTGAGTTCCCAGAGGGCTCTAGG + Intronic
1049600370 8:143504738-143504760 GAGTGTTGAGGGAAGGCCCTGGG - Intronic
1049853112 8:144844894-144844916 GAGTGGGGAAAGAGGACTCTGGG + Intronic
1050638487 9:7639687-7639709 GAGTGTTGACAGAGAGCTCTGGG + Intergenic
1051978358 9:22982370-22982392 GAGTTTTGACAGATGGATCTCGG - Intergenic
1052262822 9:26537409-26537431 AAGTGATGACGGAGTGCTCTTGG - Intergenic
1054901295 9:70371942-70371964 CAGGGATGACAGTGGGCTCTGGG + Intergenic
1055464374 9:76549772-76549794 GGCTGGTGGCAGAGGGCTCTGGG + Intergenic
1061050703 9:128192989-128193011 GCGCGTTGACGGAGGGCGCTCGG + Intronic
1061274471 9:129561532-129561554 GAGTGGGGAGAGAGGACTCTGGG + Intergenic
1061303765 9:129721212-129721234 GAGGGTGGACACAGGGCGCTGGG - Intronic
1061544155 9:131294119-131294141 GAGTCTTGACAGTGTGCACTAGG - Intronic
1062483906 9:136764832-136764854 GAGTGTGGACAGAGGGGCTTGGG - Intronic
1203756091 Un_GL000218v1:128381-128403 GAGTGTTGACAGCTGACTCCTGG - Intergenic
1203715462 Un_KI270742v1:141051-141073 GAGTGTTGACAGCTGACTCCTGG - Intergenic
1203535757 Un_KI270743v1:37177-37199 GAGTGTTGACAGCTGACTCCTGG + Intergenic
1203649709 Un_KI270751v1:104629-104651 GAGTGTTGACAGCTGACTCCTGG - Intergenic
1186873745 X:13797302-13797324 GAGTGCTGACACAGGGATATGGG + Intronic
1189516443 X:41717639-41717661 CAGTCTTGTCAGAGTGCTCTCGG - Intronic
1192436731 X:71147866-71147888 GAGTGTTGACTGTGGGTGCTGGG - Exonic
1193041856 X:77012259-77012281 GAGTGTGAACAGAGAGCTATGGG - Intergenic
1193181468 X:78463023-78463045 AAGAGTTGAAAGTGGGCTCTTGG - Intergenic
1200066024 X:153504452-153504474 GAGTGTGGGCAGAGGGCTCCAGG - Intronic
1201955011 Y:19613852-19613874 AAGTGTTAACAGAGAGCTTTTGG - Intergenic