ID: 934987577

View in Genome Browser
Species Human (GRCh38)
Location 2:98899082-98899104
Sequence ATAAACAAGCTGACATGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934987574_934987577 -5 Left 934987574 2:98899064-98899086 CCAAACAGGGACCTGAATATAAA 0: 1
1: 0
2: 0
3: 18
4: 156
Right 934987577 2:98899082-98899104 ATAAACAAGCTGACATGTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 163
934987571_934987577 11 Left 934987571 2:98899048-98899070 CCTCTGCTTTGTCAAACCAAACA 0: 1
1: 0
2: 1
3: 16
4: 193
Right 934987577 2:98899082-98899104 ATAAACAAGCTGACATGTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 163
934987570_934987577 12 Left 934987570 2:98899047-98899069 CCCTCTGCTTTGTCAAACCAAAC 0: 1
1: 0
2: 0
3: 11
4: 207
Right 934987577 2:98899082-98899104 ATAAACAAGCTGACATGTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 163
934987569_934987577 23 Left 934987569 2:98899036-98899058 CCAGCAACACACCCTCTGCTTTG 0: 1
1: 0
2: 0
3: 27
4: 305
Right 934987577 2:98899082-98899104 ATAAACAAGCTGACATGTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934987577 Original CRISPR ATAAACAAGCTGACATGTCT GGG Intronic
902155280 1:14480038-14480060 ATAAAAATCCTGACATGACTTGG + Intergenic
903725330 1:25438605-25438627 ATAAAGAAGTGGACATGACTGGG + Intronic
905069006 1:35208952-35208974 AAAAAATAGCTGACATTTCTTGG - Intergenic
905267420 1:36764426-36764448 AGAAGCAAGCAGAGATGTCTGGG - Intergenic
905530172 1:38672008-38672030 CTGAACAAGCTGACATGTGAGGG - Intergenic
907862834 1:58370597-58370619 ATAAACACACTGACATGGTTTGG + Intronic
908943080 1:69459955-69459977 ATAAAACAGCTGATATTTCTAGG - Intergenic
909777852 1:79506068-79506090 ATATACAAGCATACATTTCTAGG + Intergenic
912426942 1:109602143-109602165 TAAAACAAGCTCACCTGTCTTGG + Exonic
916122815 1:161544179-161544201 AAAAATAAGCTGACATTTATTGG - Intronic
916132717 1:161625623-161625645 AAAAATAAGCTGACATTTATTGG - Intronic
918126611 1:181589509-181589531 ATATACAAGCAGAGATCTCTGGG + Intronic
919196124 1:194288447-194288469 ATAAACAAGCTCATTTCTCTAGG - Intergenic
919661634 1:200253491-200253513 ATAAAGTAGCTGTCATGACTGGG - Intergenic
921084930 1:211780723-211780745 ATATACATGCTGAAATGTTTAGG + Intronic
921179062 1:212617318-212617340 ATAAACATGGTGAGAAGTCTGGG + Intronic
1064072215 10:12240224-12240246 TTAATAAAGATGACATGTCTTGG - Intronic
1064563284 10:16613832-16613854 AGAAGCAAGATGTCATGTCTGGG - Intronic
1067900907 10:50240563-50240585 AAAAACAAGCTGGCATCTCAAGG + Intronic
1068639793 10:59390555-59390577 ATATACGAGCTGAGCTGTCTTGG + Intergenic
1069042474 10:63709916-63709938 AGGAAAAAGCTGACATGGCTGGG + Intergenic
1069170442 10:65221659-65221681 ATATACCAGCTGGCAAGTCTAGG + Intergenic
1070482657 10:76899525-76899547 ATAAACAAATGGACATGGCTGGG - Intronic
1072945614 10:99807599-99807621 ATAGACTAGCTGGCATCTCTAGG + Intronic
1074582292 10:114731435-114731457 ACAAACAAACAAACATGTCTAGG - Intergenic
1074770641 10:116731312-116731334 TTAAACCAGCTGCCAGGTCTAGG + Intronic
1075272974 10:121069110-121069132 AGAAAGAAGATGACATGCCTTGG - Intergenic
1076126488 10:127978241-127978263 AAAAACAAGCAGACAAGCCTGGG + Intronic
1076278069 10:129222475-129222497 TTAACCTAGCTGACATTTCTTGG - Intergenic
1078211528 11:9273888-9273910 ATACACAAGCTCACACATCTGGG - Intergenic
1087706313 11:101496549-101496571 AGAAAAAGGCTGACATATCTAGG - Intronic
1088194403 11:107259161-107259183 TTTAAGAAGCTGAGATGTCTTGG - Intergenic
1088608523 11:111554741-111554763 CTAAACTAGCTGTCATGGCTGGG - Intronic
1098281773 12:68869260-68869282 ATAAACCAGCTGGCACTTCTGGG + Intronic
1100361697 12:93885392-93885414 ATAAAGAAACTGACATCCCTAGG + Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1104285236 12:127418784-127418806 ACACACGAGCTGACCTGTCTTGG + Intergenic
1106496250 13:30279365-30279387 ATGAACAAACTGCTATGTCTGGG + Intronic
1108438557 13:50425631-50425653 AAAAACAACCTCACATCTCTGGG - Intronic
1109980748 13:69903118-69903140 AGAAGCAAGCAGCCATGTCTGGG + Intronic
1111204048 13:84980380-84980402 GTAAACAAGCTGATATGTTTTGG - Intergenic
1111515328 13:89323695-89323717 ATAAACATTCTGTCATCTCTTGG - Intergenic
1112100854 13:96187689-96187711 CTAAACATCCTGACATGTCATGG + Intronic
1112890123 13:104219307-104219329 ATAAACATCCCCACATGTCTAGG - Intergenic
1112996630 13:105582155-105582177 ATAAACAAACTGACAAGATTTGG - Intergenic
1115250732 14:31343915-31343937 CTAGACAAGTTGACATGTCGTGG + Exonic
1117179133 14:53174504-53174526 ACAAACAAACTAACAAGTCTGGG + Intergenic
1120978456 14:90270360-90270382 AGAAATAAGCTGACACGGCTAGG - Exonic
1122186207 14:99998613-99998635 ATAAATCATCTGACATGCCTTGG + Intronic
1122753766 14:103960698-103960720 AAACACAAGCTGACATTTTTAGG - Intronic
1123429507 15:20203020-20203042 ATAAACAGGGTGACAGGTGTGGG - Intergenic
1124709349 15:31992735-31992757 ATAAACAAGATGACATACCAGGG - Intergenic
1127594609 15:60466721-60466743 TTAAAAAAGTAGACATGTCTTGG + Intronic
1130765640 15:86868020-86868042 ATACACAATCTGACATCTCTTGG - Intronic
1135871907 16:26158992-26159014 AGAAACAGACTGGCATGTCTGGG - Intergenic
1137541006 16:49361612-49361634 ATAAACAGTCTGATATGACTGGG - Intergenic
1137847015 16:51700159-51700181 ACAAACACACTGACATGTCATGG - Intergenic
1138138783 16:54548305-54548327 AGAAAAGAGGTGACATGTCTTGG + Intergenic
1138748265 16:59388875-59388897 AAAAAGAAGCTGACTTGTGTTGG - Intergenic
1138995545 16:62448154-62448176 AGAAACAAGCAGAGATGTCCAGG - Intergenic
1139762175 16:69193773-69193795 ATAAAGAACCAGACAGGTCTCGG + Intronic
1140762042 16:78118452-78118474 ATGAACAAACTGCCATCTCTGGG + Intronic
1141013481 16:80425681-80425703 ATAAACAAGCAGAAAGGTCAAGG + Intergenic
1143140072 17:4737227-4737249 ATATACATGCTGAAATGTCTTGG + Intronic
1143729661 17:8874021-8874043 AGAAACAAGCTGGCACGCCTGGG + Intergenic
1145889870 17:28406832-28406854 ATTAACAGGCTGTCACGTCTGGG + Intronic
1150604128 17:66676462-66676484 ACAAGCAAGCTGACCTGTCGGGG - Intronic
1150958025 17:69883357-69883379 ATAAACATGATGACATGTTGAGG + Intergenic
1152527794 17:80899086-80899108 ATTAACAAGTTGGCGTGTCTGGG - Intronic
1153242913 18:3046806-3046828 ATAAACTAGGTAACATGTATAGG - Intergenic
1153316031 18:3723390-3723412 ATAATCAAGCTGACTTTCCTAGG - Intronic
1158032878 18:52988101-52988123 ATAAATAATCTGAAATGTCTTGG + Intronic
1158318566 18:56238463-56238485 ATAAACATCATGAAATGTCTTGG - Intergenic
1160451891 18:78971968-78971990 ATCAACAAGCAGGCATGTCACGG + Intergenic
1163066765 19:14802693-14802715 ATGGACACGCTGACATGTCTTGG + Intronic
926333966 2:11849513-11849535 AGAAACAAGCTGGAAGGTCTCGG + Intergenic
926940454 2:18130489-18130511 ATGAACAAGCTGAAATGGTTAGG + Intronic
927381880 2:22488902-22488924 ATAAACTAACTGAAATGTGTTGG + Intergenic
928069583 2:28201251-28201273 ATAAACAAGCTGTCAGATTTTGG + Intronic
928248364 2:29652177-29652199 ATAAAATGGCTGACATCTCTAGG - Intronic
928728441 2:34203144-34203166 ACAAAGAAGCTGACATCTATAGG + Intergenic
930166608 2:48209602-48209624 ATAATGAAGCTGAAATGTCTGGG - Intergenic
931845249 2:66197202-66197224 ATAATCAAGTTGAAATTTCTAGG + Intergenic
932004935 2:67918463-67918485 ATGAACAGGCTGAGAGGTCTTGG + Intergenic
934987577 2:98899082-98899104 ATAAACAAGCTGACATGTCTGGG + Intronic
936977427 2:118233597-118233619 ACATACAAGCTGTCATGTATGGG + Intergenic
937262478 2:120595416-120595438 AAAAACAACCTGACTTGGCTGGG + Intergenic
937660306 2:124423370-124423392 ATAAAAAAGCTGACCTTCCTTGG - Intronic
939071310 2:137547273-137547295 ATAACAGACCTGACATGTCTGGG - Intronic
943404713 2:187465822-187465844 CTACAGAAACTGACATGTCTTGG + Exonic
943986695 2:194630737-194630759 ATAAACAAGCTTACAATTCATGG - Intergenic
944214188 2:197237817-197237839 ATAACCAAGCTGACTTGTCAAGG - Intronic
944457139 2:199907314-199907336 ATTAACAAGCTGATATGGTTTGG - Intergenic
944757557 2:202779610-202779632 TGAACCAGGCTGACATGTCTTGG + Exonic
944849514 2:203704000-203704022 ATAAATGAGCTGACCTCTCTGGG + Intergenic
944860541 2:203811817-203811839 ATAAACTAGCTGACATCACCGGG - Intergenic
945408964 2:209486546-209486568 ATAAAGATGCAGATATGTCTCGG + Intronic
946923178 2:224600424-224600446 ATATGCAGGCTGACATGTTTGGG + Intergenic
947789913 2:232859477-232859499 ATAATCAAACTGTCTTGTCTGGG - Intronic
948299561 2:236892303-236892325 ATAATGAAGCTGACATGTTAAGG + Intergenic
1172973188 20:38888333-38888355 ATACACAAGCTGGCTTGTGTGGG - Intronic
1173261399 20:41439508-41439530 ATGGACAAGCTGAAATGTCATGG + Intronic
1174292924 20:49521731-49521753 TTGCACAAGCTGACATTTCTGGG - Intronic
1179373765 21:40830505-40830527 AGAAACCAGCTGACCTATCTGGG + Intronic
1181100462 22:20535521-20535543 AGAAACAAGCAAACATGTCAGGG - Intronic
952853275 3:37746633-37746655 AGAAACATCCTGGCATGTCTGGG - Intronic
953251956 3:41252303-41252325 ATAAACAAAATGACATATGTTGG + Intronic
955671230 3:61405212-61405234 ATAAATATGCTGATATGGCTTGG - Intergenic
956543855 3:70376777-70376799 ATTAACAATATGACATTTCTGGG - Intergenic
956622633 3:71236572-71236594 ATAAACAAGCAAAAATGGCTGGG + Intronic
956959374 3:74380472-74380494 ATAAAGAAGCTTACATCTCATGG + Intronic
958138308 3:89526268-89526290 ATAAATCAGCTGTCATGTATTGG + Intergenic
958688218 3:97426506-97426528 ATAAAGAAGGTGACATGGTTTGG - Intronic
963752741 3:149200018-149200040 ATAATCAATCTGATATGTCGAGG + Intronic
964323760 3:155525022-155525044 AAAAACAAGATGACTTGGCTGGG + Intronic
964336365 3:155659112-155659134 TTAAAGAAGCTGAGATGTCTTGG - Intronic
964941613 3:162164245-162164267 AAAAACAAGAGGACATGTTTGGG - Intergenic
965259150 3:166457793-166457815 ATAAACAACCTTAGATTTCTGGG - Intergenic
966744238 3:183260483-183260505 ATAAAAAAGCTGACATATAAAGG - Intronic
967930897 3:194689316-194689338 ATAAATAACCTCACAGGTCTGGG - Intergenic
969551306 4:7869498-7869520 TGATACAAGCTCACATGTCTTGG + Intronic
970115685 4:12693415-12693437 ATAAACAATGTAACATTTCTTGG + Intergenic
970217770 4:13777677-13777699 ATACACTAGCTGACATGGTTTGG - Intergenic
970814520 4:20138347-20138369 ATATACAAGCAAAAATGTCTAGG + Intergenic
971998559 4:33998399-33998421 AGAGGCAAGCTGACTTGTCTTGG - Intergenic
973872671 4:55181904-55181926 ATAAACAAGGTGAAGTGTCATGG - Intergenic
974363230 4:60910860-60910882 AGAAACAACCTTACATGTCTGGG - Intergenic
975265854 4:72366176-72366198 ACAAAATAGCTCACATGTCTTGG + Intronic
976526328 4:86094643-86094665 ATCAACAAGATGGCATGTCCTGG + Intronic
979450015 4:120859518-120859540 TTGAAAAAGCTGACATGGCTGGG - Intronic
981344239 4:143656926-143656948 ATAAACAATCAGACACTTCTGGG - Intronic
983851323 4:172584186-172584208 CTAAACAAGCTGAAATGTCTTGG - Intronic
983999849 4:174226610-174226632 CAAAACAAGCAGACATCTCTGGG - Intergenic
985731059 5:1549186-1549208 CTGAGCAAGCTTACATGTCTGGG + Intergenic
988393546 5:30666884-30666906 TTACACAAGTTTACATGTCTAGG + Intergenic
991047041 5:62233459-62233481 ATAAACAGGGTGACAGGTGTGGG - Intergenic
992535259 5:77695090-77695112 TTAAACAAGATGAAATGACTAGG + Intronic
992655300 5:78903451-78903473 ACAAAGAATCTGACATGTCTTGG - Intronic
995026262 5:107426768-107426790 GTCAACATGCTGACATGTCCAGG + Intronic
995510297 5:112902255-112902277 ATAAACAAGAAGACAGGCCTGGG - Intronic
998339783 5:141407136-141407158 AAAAAAAAGCTGAAGTGTCTGGG + Intronic
1000366423 5:160495418-160495440 AAAAACAGGCAGACCTGTCTTGG - Intergenic
1000453207 5:161416349-161416371 ATAATCAAGGTGACATAACTTGG + Intronic
1001072652 5:168600338-168600360 CTAAACAAGCTGACATGAGGAGG + Intergenic
1003945552 6:11072213-11072235 ATAACCATGCTGACATGGTTTGG + Intergenic
1010832438 6:80547267-80547289 ATAAAAAACCTGACATGGTTTGG + Intergenic
1011141930 6:84167832-84167854 AAAAAGAAGCTGAGATGTCAAGG - Intronic
1011819479 6:91234757-91234779 ATAAACAAGCTAGGATGTCATGG - Intergenic
1013609837 6:111784252-111784274 CTAAACAAGAAGACATTTCTTGG - Intronic
1015208840 6:130672425-130672447 AGAAACAAACTGCCATGTTTTGG + Intergenic
1016322200 6:142858143-142858165 AGAAATAAGATGATATGTCTGGG - Intronic
1020617717 7:10480186-10480208 ATGAACAATCTGAGATGTATCGG - Intergenic
1021030400 7:15725855-15725877 AGAAAAATGCTGACATGCCTAGG + Intergenic
1030061596 7:105625672-105625694 ATAATTAAGATGACATGTGTTGG - Intronic
1030857400 7:114577999-114578021 ATAAACAAGCTTAAAAGTTTAGG + Intronic
1031474006 7:122200965-122200987 ACAAAAAAGCTGACAAGTTTGGG - Intergenic
1039256916 8:35729302-35729324 CTACAGAAGCTAACATGTCTCGG + Intronic
1042092054 8:65169074-65169096 ACAAGCAAGCTGCCATGTTTGGG - Intergenic
1043136601 8:76535131-76535153 TTAATCAAGCTGACATGCCAGGG - Intergenic
1045163011 8:99570152-99570174 ATCCACAAGCAGACATATCTTGG - Intronic
1046406923 8:113786053-113786075 ATAAAGAAACTGACATGTTTTGG + Intergenic
1046685823 8:117225718-117225740 GGAAATAAGCTCACATGTCTAGG + Intergenic
1047311992 8:123699704-123699726 ATAGACAAGCTGGCATTTCAAGG + Intronic
1048226907 8:132596693-132596715 ATAACCAGGCTGACTTGCCTAGG + Intronic
1048439920 8:134452376-134452398 AAGAACAAGCTGAAATGTCAAGG + Intergenic
1050695710 9:8277021-8277043 ATAAACAACCTGATATGGTTTGG - Intergenic
1053706442 9:40757689-40757711 ATAAACTAGCTTAGATGCCTTGG - Intergenic
1059828445 9:118061815-118061837 ATAAACAACCTCACATATGTGGG - Intergenic
1060291981 9:122311937-122311959 AAAATCATGCTGACATGTTTAGG - Intronic
1062620546 9:137419203-137419225 CTAAAAATTCTGACATGTCTTGG + Intronic
1203375797 Un_KI270442v1:375844-375866 AAGAACAAGGTTACATGTCTTGG + Intergenic
1197463189 X:126769274-126769296 AACAACAGGCTGATATGTCTTGG - Intergenic
1199858097 X:151776821-151776843 ATAAACAAGCTGAGTGGCCTCGG + Intergenic
1200700517 Y:6398287-6398309 GCAAACAAGCTGACTTGTGTGGG + Intergenic
1201033595 Y:9766411-9766433 GCAAACAAGCTGACTTGTGTGGG - Intergenic
1201281994 Y:12350292-12350314 ATAAACACACTGAGCTGTCTTGG - Intergenic