ID: 934987579

View in Genome Browser
Species Human (GRCh38)
Location 2:98899110-98899132
Sequence CTGCCTTGGTGGGGTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 784
Summary {0: 3, 1: 1, 2: 9, 3: 78, 4: 693}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934987579 Original CRISPR CTGCCTTGGTGGGGTGGGAG GGG (reversed) Intronic
900163608 1:1236076-1236098 CTTGCCTGGTGGGGTGGGGGTGG - Intergenic
900395380 1:2451222-2451244 CTGCCTTGGCTGGGAGGGGGAGG - Intronic
900887226 1:5423617-5423639 TTCCCCAGGTGGGGTGGGAGTGG + Intergenic
900969279 1:5980547-5980569 CTGCCATGTGGGGGCGGGAGTGG + Intronic
901003532 1:6160693-6160715 CGGCCAGGATGGGGTGGGAGAGG - Intronic
901080268 1:6580129-6580151 CTGCCTGGGTGAGGAGGGCGCGG + Exonic
901263121 1:7888365-7888387 CTGATGGGGTGGGGTGGGAGTGG - Intergenic
901334983 1:8441381-8441403 CTGCCTTTGTGAAGTGAGAGGGG - Intronic
901482259 1:9533430-9533452 CTGACTTGGTGCGGTGGGAGAGG - Intergenic
901739653 1:11333953-11333975 CTGGCTTGGTGAGGGGTGAGGGG - Intergenic
902251184 1:15154877-15154899 CTGCCGGAGTGGGGTGGGCGGGG + Intronic
902620216 1:17646466-17646488 CTGCGTGGGTGGGTTGGGTGAGG + Intronic
903036401 1:20495571-20495593 CAGCCTAGGTGGGGAGGGACAGG + Intergenic
903194186 1:21672635-21672657 CTGCCTTGCTGTGGTTAGAGTGG - Intergenic
903236247 1:21952608-21952630 CTCCCCTTGTGGGGTGGGTGAGG - Intergenic
903284313 1:22267632-22267654 GTGCGTTGTTGGGGTGGGAGTGG + Intergenic
903604805 1:24567848-24567870 GTGCCCAGGTGGGATGGGAGAGG + Intronic
903861075 1:26364849-26364871 TAGCCATGGTGGGGTAGGAGGGG + Exonic
903950383 1:26993196-26993218 CTGCCCTAGTGAGGTGGGAAAGG + Intergenic
904251085 1:29224868-29224890 CACCCTGGGTGAGGTGGGAGGGG - Intronic
904259744 1:29281471-29281493 CAGGCTTGGTGGGAGGGGAGCGG + Intronic
904384011 1:30129929-30129951 CTGCTTGGGGGGTGTGGGAGTGG - Intergenic
904603855 1:31688538-31688560 GAGCCTTGGAGAGGTGGGAGTGG - Intronic
904829046 1:33295060-33295082 CTTCCTTGTGGGGGTGGGTGGGG - Intronic
905068349 1:35203837-35203859 CTGTCTTAGTGGGGGGGGGGGGG - Intergenic
905403074 1:37717026-37717048 GTGTGTTGGTGGGGTGGGATGGG - Exonic
905943512 1:41883202-41883224 CTGACTGGCTGGGGTGGGACTGG + Intronic
906119871 1:43382295-43382317 CTGCCTGGGGGAGGTGAGAGGGG + Intergenic
906190510 1:43896204-43896226 CTGGAATGGTGGGGTGGGATGGG - Intronic
906491793 1:46274231-46274253 CTGCATTGGTGGTGTGGGGACGG - Intronic
907366804 1:53968061-53968083 CTACTTTTGTGGTGTGGGAGGGG + Exonic
908217447 1:61968706-61968728 CTGTCGTGGGGTGGTGGGAGCGG - Intronic
908796256 1:67833458-67833480 CCGCCTCGCTGGGGTGGGCGGGG + Exonic
909635379 1:77811806-77811828 CGGCCTTGCTGGGGTAGGGGCGG - Intronic
911626223 1:100127817-100127839 CTTTCGTGGTGGGGTGGGGGAGG + Intronic
911927304 1:103851174-103851196 CTGTCTTGGGGTGGGGGGAGGGG - Intergenic
912736171 1:112151372-112151394 CTAACTGGGTGGGGTGGGAGTGG + Intergenic
912831240 1:112955960-112955982 CTGCCCTGGTGGGGTCGGAGGGG - Exonic
913009732 1:114670778-114670800 CTGGCTGGGTGGGGTGGGGTGGG - Intergenic
913027225 1:114855415-114855437 CTGCCCCGGGGGGGCGGGAGGGG - Intronic
913452205 1:119000053-119000075 TTGCGGTGGTGGGGTGGGGGTGG + Intergenic
913586425 1:120279321-120279343 TGGCCTGGGTGGAGTGGGAGGGG + Intergenic
913621761 1:120619049-120619071 TGGCCTGGGTGGAGTGGGAGGGG - Intergenic
914096210 1:144546335-144546357 AGGCCTTGGTGGGGGGGGAGGGG + Intergenic
914568433 1:148891183-148891205 TGGCCTGGGTGGAGTGGGAGGGG + Intronic
914604392 1:149239068-149239090 TGGCCTGGGTGGAGTGGGAGGGG - Intergenic
914718043 1:150267782-150267804 CTGCCTTCCTGGGGTGGGGTGGG + Exonic
914784496 1:150816306-150816328 CTCCTTGGGTGGGGTTGGAGTGG + Exonic
914827746 1:151147311-151147333 CTGCTTTGTAGAGGTGGGAGGGG - Intergenic
914930299 1:151925234-151925256 CTGCCTAGGAAGGGTAGGAGGGG + Intergenic
915476502 1:156155789-156155811 TTGGCATGGTGGGGTGGGTGGGG - Intronic
916560392 1:165929942-165929964 TTTCCTTGGGGGGGTGGGGGCGG - Intergenic
916773591 1:167936885-167936907 CTGCCTGAGCCGGGTGGGAGGGG - Exonic
916784988 1:168080421-168080443 CTGTCCTTGTGGGTTGGGAGAGG - Exonic
916830425 1:168485376-168485398 CTGGGTTGGTGGGGTGGGGGTGG + Intergenic
917523026 1:175763578-175763600 CTGCCAATGTGGGATGGGAGTGG - Intergenic
917629397 1:176877986-176878008 ATGTCTTTGTGGGGAGGGAGTGG - Intronic
917724913 1:177819133-177819155 CTCCCTAGGTGGGTAGGGAGAGG + Intergenic
918429226 1:184441129-184441151 ATGCCTAGGTGTGCTGGGAGTGG - Intronic
918913895 1:190609746-190609768 CTGCCTTGGAGTGGGGGGAGCGG + Intergenic
919219360 1:194606686-194606708 CTGTTTTGGGGTGGTGGGAGGGG - Intergenic
919640111 1:200038807-200038829 GGGCCAGGGTGGGGTGGGAGGGG + Intronic
919763811 1:201114127-201114149 CTGGCTTCCTGGGTTGGGAGGGG - Exonic
919788827 1:201277089-201277111 CTCTCTGGGTGGGGTGGGTGGGG - Intergenic
920165410 1:204032160-204032182 CTGCCCAGGTGTGGTGGGTGAGG + Intergenic
920214698 1:204353836-204353858 CTGCTTTGGTGGGGTGGTGCGGG - Intronic
920401379 1:205678946-205678968 CTGGCCTATTGGGGTGGGAGTGG - Intronic
920500987 1:206485321-206485343 CCTTCTTTGTGGGGTGGGAGTGG + Intronic
920504141 1:206504917-206504939 CTGATTTGGTGGAGTGGCAGTGG - Intergenic
921159865 1:212465116-212465138 TTGCCTTGTTGGGGTGGGGGAGG + Intergenic
921993864 1:221396379-221396401 CTGCCAGGGTGGGGTAGGGGTGG - Intergenic
922012169 1:221599729-221599751 GTGCCTTGTTGGGTTGGCAGAGG - Intergenic
922124853 1:222712342-222712364 CGGCCTTGCTGGGGTAGGGGCGG - Exonic
922397002 1:225212053-225212075 CTGTCTTGGGGTGGGGGGAGGGG - Intronic
922454982 1:225767394-225767416 CTGCTTTGTGGGGGTGGGATGGG + Intergenic
922525888 1:226303521-226303543 CTGCCTTCGTGGAGCAGGAGTGG - Intronic
922750364 1:228067402-228067424 CTGCCATGGTGGGGTGAGTTTGG - Intergenic
922776552 1:228216735-228216757 CTGACTTTGTGGGGAGGGTGAGG + Intronic
923138600 1:231140859-231140881 GTGCGTGGGTGGGGTGGGTGTGG + Intergenic
923261956 1:232276141-232276163 CTGCCTTGGGGAGGTGGGAGAGG - Intergenic
924414831 1:243849390-243849412 CGGCACTGGTGGGGTGGGGGGGG - Intronic
924663616 1:246046469-246046491 CTGTCATGGGGCGGTGGGAGTGG + Intronic
1062862806 10:823311-823333 CTCCCTTGGTGGGGAGAGAGAGG + Intronic
1063031284 10:2237894-2237916 CTGCCTGGCTGGGGTGTGGGGGG + Intergenic
1063125001 10:3129610-3129632 CTGCCATGGTGGGGTTGCGGGGG + Intronic
1063126776 10:3142747-3142769 CTGACTTGGTGGGGAGACAGGGG + Intronic
1063428241 10:5966092-5966114 CAGCCTTGGCAGGGTGGGGGAGG + Intronic
1063559453 10:7112828-7112850 CTGCCTTGGTGGGGTGGGAGAGG + Intergenic
1064245882 10:13667337-13667359 CTGGGGGGGTGGGGTGGGAGGGG - Intronic
1064421955 10:15198275-15198297 TTACTTTGCTGGGGTGGGAGGGG + Intergenic
1065209279 10:23387531-23387553 CTGTCGTGGTGTGGGGGGAGGGG - Intergenic
1065271650 10:24039230-24039252 CTGCACTGCTGGGGTGGGGGTGG - Intronic
1065407662 10:25388258-25388280 CTGCATTGGTGAGGTGAGAGCGG + Intronic
1065835647 10:29655542-29655564 TTGAGTTGGTGGAGTGGGAGAGG - Intronic
1065916570 10:30358431-30358453 CTGCCTAGGTGCCGTGGGAGAGG + Intronic
1067270639 10:44788768-44788790 CAGTCATGGTGGGGTGGGGGTGG - Intergenic
1069426113 10:68290105-68290127 ATGACTTGGTGGTGTGGGAAGGG - Intronic
1069770388 10:70895050-70895072 CTTTTTTGGTGGGGCGGGAGGGG + Intergenic
1069797575 10:71063136-71063158 CTGCTTTGGTCTGGTGGGACAGG + Intergenic
1070318401 10:75335749-75335771 CTTCCATGGTGGTGTGGGTGGGG + Intergenic
1070385025 10:75916546-75916568 CAGCCCTGGTGGGGTGGGGACGG - Intronic
1070505829 10:77111830-77111852 CTGCCTTCGGGTGGTGTGAGGGG + Intronic
1070572358 10:77649954-77649976 CTGGGGTGGGGGGGTGGGAGGGG + Intergenic
1071269367 10:83992498-83992520 CTGGGGTGGTGGGGTGGGGGTGG - Intergenic
1071283794 10:84125904-84125926 TTTCCTTGGTGGGCTGGGTGCGG - Intergenic
1071373510 10:84977941-84977963 CTGCCATGGGGTGGGGGGAGTGG + Intergenic
1071531013 10:86390284-86390306 CTGACTTGGATGGGAGGGAGAGG + Intergenic
1071566690 10:86674863-86674885 CTGCCTGGGTGGGTTGGAGGGGG - Intronic
1072722420 10:97789153-97789175 CTGGCAGGGTGGGGTGGGGGTGG + Intergenic
1073083224 10:100872830-100872852 CTGCCTTTTTGGGGTAGTAGGGG + Intergenic
1073290200 10:102409516-102409538 CTGGGTTGGGGTGGTGGGAGGGG + Intronic
1074051760 10:109887017-109887039 CTGCCCTGGTAGGGTGGTTGTGG - Intronic
1074158211 10:110816357-110816379 ATGCAGTGGTGGGGAGGGAGAGG - Intronic
1074815921 10:117140571-117140593 CTACCCTGGAGGGGTTGGAGGGG + Intergenic
1075014653 10:118901581-118901603 ATGCCTTGGTGAGTGGGGAGCGG - Intergenic
1075143598 10:119863896-119863918 GTATCTTGGTTGGGTGGGAGGGG - Intronic
1075546222 10:123356908-123356930 CTTCCTTGTTAGGATGGGAGAGG + Intergenic
1075595919 10:123729016-123729038 CTGACTGGGTGGGGTAGGGGAGG - Intronic
1076358256 10:129868594-129868616 CAGCCCTGCTGGGGCGGGAGGGG + Intronic
1076454233 10:130578342-130578364 CTGCCTAGGTGGAGGGTGAGTGG - Intergenic
1076662763 10:132066380-132066402 CAGCCGTGGTGGGGTGGGTTGGG + Intergenic
1076794280 10:132791199-132791221 CTGTCCAGGTGGGGTGGGAGGGG + Intergenic
1077097093 11:803694-803716 CTGTCTGGCTGGGGTGGGGGTGG - Intronic
1077231567 11:1460123-1460145 AGGCCTTGGTGGGGAGGGAGGGG + Intronic
1077463571 11:2722891-2722913 CTGCCTTAGCGGAGTGGGGGTGG + Intronic
1077720306 11:4621533-4621555 ATTCTTTGGTGAGGTGGGAGAGG + Intergenic
1078068648 11:8094263-8094285 CTGACTTGGAGGGGAGGGATAGG + Intronic
1078159721 11:8830225-8830247 CTACCTTGGAGGGGTAGGTGTGG - Intronic
1078406968 11:11078911-11078933 ATGCATGGATGGGGTGGGAGTGG + Intergenic
1079543850 11:21608910-21608932 CTGTCTTGGGGTGGGGGGAGTGG + Intergenic
1080754165 11:35179510-35179532 ATACCTTGGTGGGGAGAGAGGGG + Intronic
1080885283 11:36362417-36362439 CACCCTTGGCGGGGTGGGGGTGG + Intronic
1081370158 11:42290779-42290801 CTGTCTTGGGGTGGGGGGAGGGG - Intergenic
1081537351 11:44005378-44005400 CTGCCTGGGTGGGGGAGGGGAGG + Intergenic
1081593663 11:44444513-44444535 CTGCCTAGGTGGAGAGGCAGAGG + Intergenic
1081611971 11:44568300-44568322 CACCATTGGAGGGGTGGGAGGGG + Intronic
1081678779 11:44987461-44987483 CTGGCTGGGTGGAGTTGGAGAGG - Intergenic
1081945770 11:46992385-46992407 CTGTCTTGGGGTGGGGGGAGGGG - Intronic
1082011644 11:47453686-47453708 CTGGCTTGTTGGGGTGGGGATGG - Intergenic
1083024028 11:59534736-59534758 CTGCGATGGAGGGGTTGGAGGGG + Intergenic
1083261346 11:61524636-61524658 CTGGCCCGGTGGGGTGGCAGCGG - Intronic
1083265104 11:61542941-61542963 CTGTCATGTTGGAGTGGGAGGGG + Intronic
1083386032 11:62311034-62311056 CTGCCTGGGCCGGGTGGGTGAGG + Intergenic
1083412264 11:62502193-62502215 CTGCCCTGCTGGGGTGGGAAAGG - Intronic
1083625386 11:64069527-64069549 AAGCCTTTGTGGGGAGGGAGGGG + Intronic
1083753158 11:64773810-64773832 AAGCCTTGGTGGGGAGGAAGAGG - Intronic
1083990291 11:66242477-66242499 CTTCCTTTCTGGAGTGGGAGTGG + Intronic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1084117289 11:67049741-67049763 GGGCCTTGGAGGGGTGGCAGCGG + Exonic
1084311272 11:68317545-68317567 CTGCCTTCCTGGGTTGGGGGTGG + Intronic
1084425472 11:69081695-69081717 CTGCATTTCTGGGTTGGGAGAGG + Intronic
1084470647 11:69357184-69357206 CTGCCTTGGAGGGTGGGGAAGGG - Intronic
1084470744 11:69357611-69357633 CATCCATGGTGGGGTGGGATGGG + Intronic
1084642636 11:70434857-70434879 TGGCCTTGGTGGCATGGGAGAGG + Intronic
1084727879 11:70953705-70953727 TTGAGTTGGTGGGCTGGGAGAGG - Intronic
1084987632 11:72890412-72890434 CTGCCTTGGGGCAGGGGGAGGGG - Intronic
1085347563 11:75778110-75778132 CTTCCTGGGTGAGGTGGGTGGGG - Intronic
1086088331 11:82979590-82979612 GTGCCAAGGTGGGGTGGTAGTGG - Exonic
1086488700 11:87336766-87336788 CTACCTTGCTGAGCTGGGAGTGG - Intergenic
1087372282 11:97300523-97300545 CTGTTTTGGGGTGGTGGGAGGGG - Intergenic
1087868771 11:103266069-103266091 CAGGGTGGGTGGGGTGGGAGGGG + Intronic
1088745538 11:112801229-112801251 CAGCCTTGGCAGGATGGGAGGGG + Intergenic
1088813472 11:113406678-113406700 CTGGCTTTGTGGGGTTAGAGGGG - Intergenic
1089456693 11:118629937-118629959 CAGCCTGGTTGAGGTGGGAGGGG - Intronic
1089587432 11:119519440-119519462 CTGCTCTGGTGGGCTGGGATGGG - Intergenic
1089617965 11:119705867-119705889 CTCACCTGGAGGGGTGGGAGAGG - Intronic
1089671055 11:120057255-120057277 ATGCCCTGGAGGGGTGGGAAGGG + Intergenic
1090235949 11:125147206-125147228 CTGCCTGGCAGGGGAGGGAGGGG - Intergenic
1090265636 11:125351363-125351385 CTGTCCTGGTAGGGTGGGGGCGG - Exonic
1090349962 11:126101591-126101613 CTGGCTTGGTGAGATGGGGGAGG - Intergenic
1090546579 11:127773142-127773164 CTGCCTGGGGAGGATGGGAGAGG + Intergenic
1091518953 12:1216587-1216609 TAGCCTTGGTGGGGTCGGGGAGG + Intronic
1092658960 12:10718515-10718537 CTCCTTTGGTGGGGTGGGGGTGG - Intronic
1093389651 12:18602627-18602649 CTGTTTTGGTGAGGTGGCAGAGG - Intronic
1095086990 12:38067394-38067416 CTGCTGTGGGGTGGTGGGAGGGG + Intergenic
1095332422 12:40982936-40982958 CTGTCTTGGGGTGGGGGGAGGGG + Intronic
1095655968 12:44668999-44669021 GTGCATTGGTGGGCTGGGTGTGG - Intronic
1096253832 12:50051042-50051064 GGGCCTGGGTAGGGTGGGAGGGG + Intergenic
1096674547 12:53219510-53219532 TTGCCTAGGTGGTGTGGGTGTGG - Intronic
1096695472 12:53345608-53345630 GTGGCTTGGTGGGGAGGTAGGGG - Intergenic
1097426505 12:59452066-59452088 CTAGATGGGTGGGGTGGGAGGGG + Intergenic
1098578839 12:72075107-72075129 TAGCCTTGGTGGGGAGGGACAGG + Intronic
1098835431 12:75419007-75419029 CTGTCGGGGTGGGGTGCGAGGGG + Intronic
1100314347 12:93430472-93430494 CTGGCTGGGTGGGGAGGGGGAGG + Intronic
1100350323 12:93774902-93774924 CTGCTAGGGTGGGGAGGGAGAGG + Intronic
1100571480 12:95847129-95847151 CTTGCTGGGTTGGGTGGGAGGGG + Intergenic
1100653510 12:96616356-96616378 CTGTCGTGGGGTGGTGGGAGGGG + Intronic
1101544470 12:105698316-105698338 GTGAATTGGTGGGGTGGGGGTGG - Intergenic
1101998897 12:109544505-109544527 CTGGCTTTGTGGGGTGGCAGTGG - Intergenic
1102035898 12:109770244-109770266 CTGCCTTGATCGTGTGGGACAGG - Exonic
1102054667 12:109887610-109887632 CATCCTTGCTGGGGAGGGAGTGG - Intergenic
1102454170 12:113061259-113061281 CTCTCTGGTTGGGGTGGGAGGGG - Intronic
1102567234 12:113804736-113804758 CTGAGTTGGTTGGGTGGGCGAGG + Intergenic
1102939333 12:116925230-116925252 CTGCCTTAGTGGGGTGGGAGGGG + Intronic
1103175567 12:118860423-118860445 CTGCCCTGGTGGGGAGGGGCAGG - Intergenic
1103244876 12:119447993-119448015 TTGCCGGGGTGGGGTGGGGGAGG + Intronic
1103364244 12:120370120-120370142 CAGCCTCGGTGTGGTGGGGGTGG - Intergenic
1103521006 12:121537139-121537161 CTGCGATCGCGGGGTGGGAGGGG - Intronic
1103528021 12:121580353-121580375 CGGGCTTGGGGGGGTGGGGGCGG + Intronic
1103916508 12:124378515-124378537 CTGCCGAGGTGGGGTGTGAGGGG - Intronic
1104691925 12:130832935-130832957 CTGCCTTGGCCGGGTGGGTCAGG - Intronic
1104783956 12:131437967-131437989 CTGCCGTGGTGGGGTGGGGAGGG - Intergenic
1105210362 13:18253669-18253691 CTGCCTGGGGGTGGGGGGAGAGG + Intergenic
1105293849 13:19071631-19071653 CAGCCTTGGCGGGGGAGGAGGGG - Intergenic
1105295828 13:19087444-19087466 GTGTGTTGGTGGGGTGGGGGTGG - Intergenic
1106438655 13:29745852-29745874 CTGCAGGGGTGGGGTGGGAATGG - Intergenic
1106692604 13:32134332-32134354 TTTCCTTGTTGAGGTGGGAGAGG + Intronic
1107132520 13:36911610-36911632 CTGCCTGGGGGGGGGGGGGGCGG + Intronic
1107460759 13:40599715-40599737 CGGCCTCGGAGGGGTGGTAGAGG + Intronic
1107559607 13:41547470-41547492 GTGCCTAGCTGGGCTGGGAGCGG - Intergenic
1108959230 13:56202636-56202658 CTGCCTACGTGGGATGGGTGTGG + Intergenic
1110574196 13:77037360-77037382 CAGACTGAGTGGGGTGGGAGAGG - Intergenic
1110851868 13:80255133-80255155 CTGTCTTGGGGTGGTGGGAGGGG + Intergenic
1111694284 13:91604099-91604121 CTGTTGTGGTGTGGTGGGAGGGG - Intronic
1112173167 13:96994397-96994419 GGGCCTCGGAGGGGTGGGAGGGG - Intronic
1112388072 13:98958387-98958409 CTGCCTTGGGTGGGGGTGAGAGG + Intronic
1112449852 13:99498661-99498683 CGGCCTGGGTCTGGTGGGAGGGG - Intergenic
1112923977 13:104650412-104650434 ATTCTTTGGTGGGGTGGAAGAGG + Intergenic
1113538300 13:111085162-111085184 CTGCTTTTTTGGGGTGAGAGGGG + Intergenic
1113884959 13:113653656-113653678 CTGCCATGGTGGGGGGTGGGGGG + Intronic
1113901519 13:113800760-113800782 TGCCCTTGGTGGGGTGGGTGAGG + Intronic
1113904183 13:113811618-113811640 CTGGGTTGGCGGGGTGGGTGGGG + Intronic
1115855626 14:37626870-37626892 CTTGAGTGGTGGGGTGGGAGTGG - Intronic
1116004917 14:39282450-39282472 CTGCCCTGGAGGGGTGGGCAGGG - Intronic
1116322573 14:43489386-43489408 CTGTCCTGGTGTGGGGGGAGGGG + Intergenic
1116455536 14:45116974-45116996 CTGTCTCGGTGGGGGGGGCGGGG - Intronic
1116771469 14:49131627-49131649 CGAGCTTGGTGGGGTGGGGGGGG - Intergenic
1117271029 14:54143546-54143568 ATGCCTGACTGGGGTGGGAGTGG + Intergenic
1117338863 14:54777205-54777227 CTGCCTTGGGGCAGTGGGGGTGG - Intronic
1118905707 14:70021756-70021778 GTTACTTGGTGGGGTGGAAGAGG + Intronic
1119271474 14:73308909-73308931 CAGCCGTGGTGGGGTGGCAGAGG + Intronic
1119692839 14:76690551-76690573 CTGCCCTGCTGGGGGGGGTGGGG + Intergenic
1119790473 14:77345494-77345516 CTGCCATGGAGGGATGGGGGCGG - Intronic
1120340007 14:83207770-83207792 CTGCTATGTTGGGGTGGGAGAGG + Intergenic
1120743945 14:88137092-88137114 CTGCCTGGATGGGGTGGGTTGGG + Intergenic
1120781474 14:88489892-88489914 CTGGCATTGTGGGATGGGAGAGG + Intronic
1121211472 14:92210755-92210777 CAGGCTAGGTGGGGAGGGAGAGG + Intergenic
1122262102 14:100529525-100529547 AAGCCTTGCTGGGGTGGAAGGGG + Intronic
1122294969 14:100700300-100700322 CTGCCTTGCTGTGGTGGAATGGG - Intergenic
1122351895 14:101100971-101100993 TGGCCTTGGTGGGGGGGGGGGGG - Intergenic
1122611168 14:102984500-102984522 CTCCCTTGCGGGGGTAGGAGCGG - Intronic
1122981384 14:105193752-105193774 CAGCAAGGGTGGGGTGGGAGTGG + Intergenic
1122984383 14:105205534-105205556 GAGCATTGCTGGGGTGGGAGGGG - Intergenic
1123029179 14:105442988-105443010 CTGCCCGGGTGGGGTGGCTGCGG + Intronic
1123411408 15:20063360-20063382 CTGTCGTGGTGTGGGGGGAGGGG + Intergenic
1123859368 15:24447972-24447994 CTACCTTGGTGGGAATGGAGTGG - Intergenic
1123940226 15:25213142-25213164 CCTCCTTGGTTGGCTGGGAGCGG + Intergenic
1123944389 15:25231967-25231989 CCTCCTTGGTTGGCTGGGAGTGG + Intergenic
1123949946 15:25261595-25261617 CTGCCGTGGGGTGGGGGGAGGGG + Intergenic
1124388890 15:29235142-29235164 CTGCCTGAGCGAGGTGGGAGGGG + Intronic
1124632327 15:31344872-31344894 CCGCCTGAGTGGGGAGGGAGGGG + Intronic
1124956486 15:34363733-34363755 CTGCCTTGTGGGGGTGGGGGTGG - Intronic
1124960472 15:34389685-34389707 CTGCCATTGTGGGGTGGGGAGGG + Exonic
1124977101 15:34535906-34535928 CTGCCATTGTGGGGTGGGGAGGG + Exonic
1125170603 15:36762640-36762662 CTGTCGTGGGGTGGTGGGAGTGG - Intronic
1125751693 15:42033577-42033599 CTGGGTGGGTGGGGTGGGAGGGG + Intronic
1125887656 15:43240697-43240719 CAGCCTTGGTGGGGGGTGGGTGG + Intronic
1126149107 15:45506305-45506327 ATGACATGGTGGGGTGGGACAGG - Intronic
1126969128 15:54089877-54089899 CTGACTTGTGGGAGTGGGAGTGG + Intronic
1127127550 15:55826483-55826505 CTGGCTTGAGTGGGTGGGAGTGG + Intergenic
1127977194 15:64006516-64006538 CTGCTTTGGTGAAGTGGGAATGG - Intronic
1128054556 15:64690006-64690028 CTTCCTGGGTGGGGTGTGAATGG + Intronic
1128156660 15:65395808-65395830 CTGTGTTGGTGGCCTGGGAGCGG - Exonic
1128594513 15:68931233-68931255 CTGCCGTGGGGTGGGGGGAGGGG - Intronic
1128700045 15:69797379-69797401 CTGCCTTGGTGGTGAGTGAGAGG + Intergenic
1129210413 15:74064890-74064912 CTGCCTGGGTGCCGTGGGAGAGG + Intergenic
1129403601 15:75300483-75300505 CTGCCTGGGTGCCGTGGGAGAGG - Intergenic
1129412551 15:75358176-75358198 CTGACATGGCAGGGTGGGAGTGG - Intronic
1129674347 15:77624461-77624483 GTGCCTTGGTGAGGTGGGCAGGG - Intronic
1129727607 15:77909521-77909543 CTGCCTGGGTGCCATGGGAGAGG + Intergenic
1129840276 15:78739449-78739471 CTGCCTGGGTGCCATGGGAGAGG - Intergenic
1130066532 15:80609475-80609497 GTGCAGTGGTGGGGTGGGGGTGG - Intergenic
1130485471 15:84396045-84396067 CTGCCTGGGTGCCGTGGGAGAGG - Intergenic
1131111690 15:89768456-89768478 CTGTCTTGTAGGGGAGGGAGTGG - Intronic
1131848887 15:96516832-96516854 CTGTCTTGGGGTGGAGGGAGGGG - Intergenic
1132177601 15:99727887-99727909 GTGGCATGGAGGGGTGGGAGGGG - Exonic
1132688750 16:1172976-1172998 CTGCCTGGGAGGGAGGGGAGGGG + Intronic
1132735564 16:1384232-1384254 CTGCCGTGTTGGGGTGGTGGGGG - Intronic
1132844366 16:1993098-1993120 CTGCGTTGGTGGGGTGGCCTTGG - Exonic
1133018532 16:2955805-2955827 CTGCCATGGTGCTGGGGGAGGGG + Intergenic
1133942509 16:10322163-10322185 TGGCCTTGGTGAGATGGGAGTGG - Intergenic
1134040241 16:11062884-11062906 TTGCTTTGGGGGGGTGGGGGAGG + Intronic
1134606931 16:15578709-15578731 GTGCCTTTGTGTGGTGGAAGGGG + Intronic
1134770129 16:16801061-16801083 CCCCCTTGGTGGGGAGGGACAGG - Intergenic
1136253699 16:29024398-29024420 CTGCTTTTGTGGGGTGGGGATGG - Intergenic
1136399450 16:30009889-30009911 TTGCCGTGGTGGGGGGAGAGGGG - Intronic
1136413718 16:30091402-30091424 CTCCCGGGGTGGGGAGGGAGGGG - Intronic
1137547052 16:49411619-49411641 CTGCATGGGTGAGGAGGGAGGGG - Intergenic
1137589800 16:49686624-49686646 AAGCCTGGGTGTGGTGGGAGAGG - Intronic
1137612621 16:49829042-49829064 CTGCATTGTTGGTGTGGGACTGG - Intronic
1137729746 16:50680763-50680785 ATCCCCTGGTGGGGTGGGGGTGG + Intronic
1137763097 16:50956443-50956465 TTGCTTGGGTGGGGAGGGAGCGG + Intergenic
1138556644 16:57774927-57774949 CAGCCTTTCTGGGGAGGGAGGGG - Intronic
1138567771 16:57846126-57846148 CTGCTCTGGTGGGGAGGGAGTGG - Intronic
1138897305 16:61222228-61222250 CTGCCGTGGGGTGGGGGGAGGGG + Intergenic
1139659550 16:68411465-68411487 CTGCAGTGGGAGGGTGGGAGAGG - Intronic
1140235094 16:73151915-73151937 CTGTGTGGGTGGGGTGGGGGTGG - Intergenic
1141764497 16:86049514-86049536 CAGGCTTGGGGGGGTAGGAGAGG - Intergenic
1142234366 16:88914965-88914987 CTGCCGGGGCGGGGTGGGGGTGG + Intronic
1142257961 16:89024369-89024391 TTGCCTTGGAGGAGTGGCAGGGG + Intergenic
1142344380 16:89544792-89544814 CGGCCCAGGTGGAGTGGGAGAGG - Intronic
1142412825 16:89924846-89924868 CTGCCTTGGCCTGATGGGAGGGG + Intronic
1142496776 17:310225-310247 GGGCCTTGGTGGGAAGGGAGAGG - Intronic
1142757853 17:2026005-2026027 CCGCCTGGGTGGGGTGGCGGCGG + Intergenic
1143204709 17:5133633-5133655 CTGGGGTGGGGGGGTGGGAGGGG + Intronic
1143481510 17:7229980-7230002 CAGCCTTGGTGGGGTGAGCAGGG - Intronic
1143518926 17:7434773-7434795 CTGCCTGGGTGGGGTGGGGGGGG - Intergenic
1143626290 17:8111989-8112011 CTCCCTGGGAGGGCTGGGAGAGG + Intronic
1143636234 17:8165112-8165134 CAGCCTAGGTGGGGTGGGGTGGG - Intergenic
1144182134 17:12762358-12762380 GTGGCTTGGAGGGTTGGGAGAGG + Intronic
1144306650 17:13974585-13974607 TTGAGTTGGTGGGCTGGGAGAGG - Intergenic
1144568679 17:16381205-16381227 CGACCTTGGGGGGGTGTGAGAGG + Intronic
1144629982 17:16866354-16866376 GTTTCTTGGTGGGGTGGGTGGGG + Intergenic
1144784735 17:17825308-17825330 CTTCCTCAGTGGGATGGGAGGGG - Intronic
1144848785 17:18233710-18233732 CTGCTCAGGTGGGGTGTGAGGGG - Intronic
1145106716 17:20124006-20124028 TTGGCTTGCTGGGGTGAGAGTGG + Intronic
1145765396 17:27455814-27455836 CTGGCTTGGTGGGCTGGGAATGG + Intergenic
1146341123 17:32020843-32020865 CTGCTGTGGTGGGGTGGGGTGGG - Intronic
1146390676 17:32419722-32419744 CTGCATTGGAGGGATGGGAGTGG + Intergenic
1146654103 17:34625247-34625269 CTTCCTTGGTGGGTAGGGAGAGG + Intronic
1146668993 17:34723980-34724002 CTGGTGTGCTGGGGTGGGAGTGG - Intergenic
1146908541 17:36633238-36633260 CTTCCTTTGAGGAGTGGGAGTGG - Intergenic
1147212488 17:38880013-38880035 TTCCCTTGTGGGGGTGGGAGGGG - Intronic
1147265417 17:39231636-39231658 CAGCCATGGTGGGGTGGGGGTGG + Intergenic
1147307502 17:39573922-39573944 CTCTCTTGGTGGGCGGGGAGGGG + Intergenic
1147631772 17:41936800-41936822 CTCCCTTGGTGGGGTGTAAGAGG - Exonic
1147991278 17:44335067-44335089 CTGCCTGTCTGGGGTGGGAAAGG + Intergenic
1148213893 17:45824148-45824170 CTTGGCTGGTGGGGTGGGAGTGG + Intronic
1148560324 17:48602370-48602392 GCGCCTTGGTGGGGTGGGGGTGG + Intronic
1148865442 17:50625998-50626020 CTGCCTATATGGGGTGGGGGAGG - Exonic
1149420490 17:56506209-56506231 CTGTCATGGGGTGGTGGGAGGGG - Intronic
1149634806 17:58157855-58157877 CTGCCTTCTTGGAGAGGGAGAGG - Intergenic
1150206894 17:63415942-63415964 CTGACTTGGTGGTATGGGGGTGG - Intronic
1150227580 17:63532209-63532231 CTGCCTGGGTGGGGAGTGGGAGG - Intronic
1150263049 17:63812329-63812351 CTTCCTTGGGGGTTTGGGAGGGG - Intronic
1151395121 17:73818212-73818234 CTGACTTGGTGGGTCTGGAGTGG - Intergenic
1151490487 17:74430076-74430098 CCGCCTGGGTCGGGAGGGAGTGG + Intronic
1151546703 17:74797719-74797741 CTCCCTTGGTGAGTTGGAAGGGG + Intronic
1151702421 17:75750484-75750506 CTCCCATGCGGGGGTGGGAGGGG - Intronic
1151707852 17:75780382-75780404 GTCTCTTGGTGGGGTGGGAAGGG + Intronic
1151822190 17:76502314-76502336 CAGGCTTGGAGGGGTGGGGGTGG + Intergenic
1151879287 17:76885471-76885493 CTGCCTTCTTGGGCTGGGGGTGG + Intronic
1152083124 17:78200925-78200947 GTGCGTTGCTGCGGTGGGAGGGG + Intronic
1152239470 17:79153935-79153957 CTGTCTTGAGGGGATGGGAGGGG + Intronic
1152276285 17:79359614-79359636 CTGCCTTAGTCGGGGTGGAGAGG - Intronic
1152297791 17:79478397-79478419 CTGCCGTGATGAGATGGGAGCGG - Intronic
1152530010 17:80912705-80912727 CTGCCTTACCGTGGTGGGAGAGG - Intronic
1152940834 17:83172302-83172324 CCTCCTAGGTGGGGTGGGACGGG + Intergenic
1153392463 18:4578178-4578200 CTGCCTTTGAGGTATGGGAGTGG + Intergenic
1154121161 18:11653823-11653845 CTGCCAAGGTGGGGTTGGAGGGG - Intergenic
1154959209 18:21291147-21291169 CTGCCTGGGGGGAGTGGGAGAGG - Intronic
1156474083 18:37394784-37394806 CTGCCCTGGTCTGGGGGGAGTGG - Intronic
1157413726 18:47485187-47485209 CTGCCTTGGTGGGGTGGGAGGGG - Intergenic
1157557288 18:48621275-48621297 CTGGCATGGAGGGGAGGGAGGGG + Intronic
1157828466 18:50834114-50834136 CTGCCTTGGGGGCTGGGGAGTGG - Intergenic
1158613937 18:58968642-58968664 ATCCCTTGGGGTGGTGGGAGTGG + Intronic
1158740294 18:60134305-60134327 CTGTCATGGGGTGGTGGGAGCGG + Intergenic
1160673100 19:375620-375642 CTGCCTGGGTGCGGTGGGGTAGG - Intronic
1161038200 19:2096817-2096839 CTGCGCTGGTGGGGCGGGCGGGG + Intronic
1161273819 19:3404593-3404615 CCTCCTGGGTGGGGTGGGGGTGG - Intronic
1161320232 19:3637680-3637702 CCCCCGTGGTCGGGTGGGAGAGG + Intronic
1161555269 19:4938147-4938169 CCGTCTCGGTGGGGTGGGGGAGG + Intronic
1162550908 19:11357637-11357659 CTGCAGAGGTGGGGAGGGAGTGG - Intronic
1162774849 19:12973295-12973317 CTGTCAAGGTGGGGTGGAAGTGG + Intronic
1163365449 19:16873518-16873540 CAGCCTGGGGGGGGGGGGAGGGG - Intronic
1163708894 19:18833540-18833562 CTGCTTGCCTGGGGTGGGAGAGG + Intronic
1163717294 19:18879739-18879761 GGGCCTTGGTGAGGTGGGTGGGG - Intronic
1164680071 19:30128348-30128370 CAGCCTTGGTGGAGAGGGAAAGG - Intergenic
1165163394 19:33832097-33832119 CCCCCTTGGTGGGGGAGGAGAGG - Intergenic
1166932254 19:46308462-46308484 CTGCCCTGGGGGGGTCTGAGGGG + Intronic
1167104514 19:47422161-47422183 ATTGCTTGGTGGGGCGGGAGGGG - Intergenic
1167636654 19:50659558-50659580 CTTCCAAGGGGGGGTGGGAGGGG - Intronic
1167665047 19:50818890-50818912 CTGCCCTGGTGGGGAGGTGGGGG - Intergenic
1167667896 19:50833318-50833340 CTGCAGTGGTGGGGAGGGAGGGG - Intronic
1168406425 19:56112829-56112851 CTGCCTTTGTGGGGCGGGGGAGG + Intronic
1168702069 19:58446450-58446472 CTACCTTGGAGGGATGGTAGGGG + Intergenic
924963405 2:55305-55327 ATTTTTTGGTGGGGTGGGAGGGG + Intergenic
925507296 2:4582869-4582891 TGGCCTAGGTGGGGTGGGGGTGG - Intergenic
925860302 2:8168936-8168958 CTCACTTGCTGGGGTGGGGGCGG - Intergenic
926050028 2:9738847-9738869 CTGGCTTGCTGGTGAGGGAGAGG + Intergenic
926692611 2:15747900-15747922 ATGCCTTGGGGCGGGGGGAGGGG + Intergenic
927927476 2:27023943-27023965 CTGCTCTGGTGCCGTGGGAGGGG + Intronic
928565177 2:32538116-32538138 CAGTCTTTGTGGGGTGGGACAGG + Intronic
928720345 2:34114000-34114022 CTGTCATGGTGTGGGGGGAGGGG - Intergenic
929362310 2:41108158-41108180 CTGCATTGGAGTGGTGGTAGTGG - Intergenic
931696010 2:64871115-64871137 CTGCCCTGGTGGGGTTGGGAGGG - Intergenic
931951074 2:67362096-67362118 CTGTTTTGGTGTGGGGGGAGGGG + Intergenic
932019626 2:68069729-68069751 CTGTCTTGGGGCGGGGGGAGGGG + Intronic
933708610 2:85309201-85309223 CTGGTTTGGTGGTGAGGGAGAGG - Exonic
934048663 2:88191726-88191748 CTGCCTGTGGGGTGTGGGAGTGG - Intergenic
934734238 2:96680819-96680841 GGGCCTTGGTGGGGTGGGGTGGG - Intergenic
934987579 2:98899110-98899132 CTGCCTTGGTGGGGTGGGAGGGG - Intronic
935063734 2:99630501-99630523 CTGCCTTGGTGGAAAGAGAGGGG + Intronic
935310611 2:101779161-101779183 CTTCCTTTGTGGAGTGAGAGAGG + Intronic
936020124 2:108988448-108988470 CTGTGTTGGTGGCGGGGGAGCGG - Intronic
936860156 2:117007113-117007135 CTGACATGGGGTGGTGGGAGTGG + Intergenic
937337279 2:121069758-121069780 ATGCCTTGGTGGAGGGGGTGGGG + Intergenic
937453877 2:122024929-122024951 CTGCTGTGGGGGGGTGGGGGGGG + Intergenic
937869041 2:126774668-126774690 GTGGCTTAGTGTGGTGGGAGGGG + Intergenic
937895955 2:126976990-126977012 CTGGCTGGGTGGGGTGTGTGGGG - Intergenic
938101485 2:128500675-128500697 CTACCTTAATGGGGTGGGGGTGG + Intergenic
938553746 2:132404195-132404217 CTGAGATGGGGGGGTGGGAGTGG + Intergenic
938583807 2:132670282-132670304 CTGCCGAGTTGGGGTGGGGGTGG + Intronic
938809414 2:134838833-134838855 CTGCTTTGGTGGGGGGCGAGGGG + Intronic
939090091 2:137770118-137770140 GGGTCTTGGTGGGGTGTGAGGGG + Intergenic
939109638 2:137992020-137992042 CTCCCTTGGCTGGGGGGGAGGGG - Intronic
939894401 2:147774614-147774636 CTGTCTTGTGAGGGTGGGAGTGG - Intergenic
939967420 2:148624077-148624099 CTGGCGGGGTGTGGTGGGAGAGG - Intergenic
940337623 2:152545678-152545700 CTCCCTTGATGGGGAGGGAAGGG + Intronic
940352818 2:152707733-152707755 CTGTCTTGGCGGGGTGTGGGGGG - Intronic
940926551 2:159370164-159370186 CTGTCGTGGGGTGGTGGGAGAGG + Intronic
941124131 2:161565833-161565855 CTGCCGTGGGGTGGGGGGAGGGG - Intronic
942075058 2:172350034-172350056 AGGGTTTGGTGGGGTGGGAGTGG + Intergenic
943120568 2:183730048-183730070 CTGTCTTGGTGGGGCCGGTGGGG - Intergenic
943500299 2:188680726-188680748 CTGCCGTGGGGTGGGGGGAGGGG - Intergenic
944003211 2:194867656-194867678 CTGCCTTGGTGGGTGGAGAATGG - Intergenic
944412266 2:199456961-199456983 CTGGATTGGGGGGGTGGGGGGGG + Intronic
945186364 2:207143986-207144008 CTGCCTTGGTGGAGAGAGAGAGG + Intronic
946182518 2:217957139-217957161 CTGCCTTACCGGGGTGGGGGCGG - Intronic
946908168 2:224435977-224435999 CTGCCCTGGGGGTGTGGGGGTGG - Intergenic
947140330 2:227014286-227014308 CTGCCTTGGTAGGGCGGGGTGGG + Intronic
947251884 2:228115820-228115842 ATGAGTTGGTGGGGTGGGTGGGG - Intronic
947740621 2:232483236-232483258 CTTCCTTGGTGGGTAGGGTGGGG - Intronic
948144588 2:235699073-235699095 GAGCCTAGGTGGGGTGGGGGGGG - Intronic
948930326 2:241127810-241127832 CTGCCTTGAGGAGGTGTGAGAGG + Intronic
948945179 2:241215758-241215780 CTGCCAAGGTTGGGAGGGAGTGG - Intronic
949042371 2:241855251-241855273 CTGGCTGGGGGAGGTGGGAGAGG - Intronic
1169195220 20:3679201-3679223 CTGCCTGGTGGGGGTGGGGGTGG + Intronic
1169234668 20:3921197-3921219 CTGCCATGGGGTGGGGGGAGGGG - Intronic
1169353123 20:4886109-4886131 CTGCCTGGGTGGGAGGAGAGTGG - Intronic
1169708771 20:8537550-8537572 CTTTCTTGGTGGGGTGTGCGGGG + Intronic
1170047409 20:12100021-12100043 CAGTCTTGGTGGGATGGGAGAGG + Intergenic
1170081435 20:12480958-12480980 CTGTCATGGGGTGGTGGGAGGGG + Intergenic
1170605677 20:17873789-17873811 CTTCCAGGGAGGGGTGGGAGTGG - Intergenic
1171116508 20:22529494-22529516 CAGACTTGTGGGGGTGGGAGAGG + Intergenic
1171140831 20:22740617-22740639 CTGCCATGGGGTGGGGGGAGGGG + Intergenic
1171386010 20:24769945-24769967 CTACCATGCTGGGGTGGGGGCGG - Intergenic
1171564061 20:26161930-26161952 GAGCCTTGGAGTGGTGGGAGGGG - Intergenic
1171878445 20:30599026-30599048 CAGCTTTGGTGGGGGAGGAGGGG - Intergenic
1171946034 20:31378296-31378318 CTGCCTTGGTTGGGATGGGGAGG - Intronic
1172067912 20:32234570-32234592 CTGCCTTTGTGAAGCGGGAGCGG + Exonic
1172089752 20:32421832-32421854 TTGCCTTCGTGGGGTGAGAGGGG + Intronic
1172227079 20:33312131-33312153 CTGCCTTGCTGGGCTGCGGGAGG + Intergenic
1172233176 20:33350811-33350833 GTGGCTTAGTGGGGTGGGTGGGG - Intergenic
1172890354 20:38260066-38260088 CTGCCTGGCTGGCCTGGGAGGGG + Intronic
1173341931 20:42160849-42160871 TTGCCTTCGGGGGATGGGAGCGG + Intronic
1174645409 20:52081057-52081079 GGGGCTAGGTGGGGTGGGAGAGG + Intronic
1175176888 20:57117792-57117814 GTGCTTTGATGGGGTGGGGGTGG - Intergenic
1175176989 20:57118104-57118126 GTGCTTTGGTGGGGTGGGGTGGG - Intergenic
1175193144 20:57224706-57224728 AGGCCTTGCTGGGGTGAGAGGGG - Intronic
1175401331 20:58701366-58701388 GTGCCCTGGGGGGGGGGGAGGGG + Intronic
1175946309 20:62560695-62560717 CTCCCCTGGTGGGAGGGGAGGGG + Intronic
1175964538 20:62653884-62653906 CTGCCATGGGGTGGGGGGAGGGG + Intronic
1176235567 20:64052001-64052023 CTGCCTGGGTGTGGGGTGAGGGG + Intronic
1176385336 21:6136177-6136199 CTGCGGGGGCGGGGTGGGAGAGG - Intergenic
1177818414 21:26003441-26003463 CTGCCTTGGTGGAGTCCAAGTGG + Intronic
1178513989 21:33230503-33230525 CATCCTTGGTGGGGTGGGGTGGG - Intronic
1178663029 21:34522685-34522707 ATACCTTGCTGGGATGGGAGAGG - Intronic
1179568023 21:42261212-42261234 CTGCCTGGGTGGGGCGGGAGAGG - Intronic
1179738137 21:43402075-43402097 CTGCGGGGGCGGGGTGGGAGAGG + Intergenic
1181001791 22:19991194-19991216 CTGCCTCTGTGAGATGGGAGTGG - Intronic
1181012971 22:20052998-20053020 CTGCGTGGGTCAGGTGGGAGTGG - Intronic
1181052542 22:20244575-20244597 CTCCCTGGGTGGGCTGGGTGAGG + Intronic
1181057393 22:20266649-20266671 CAGCCCTGGTGGGTAGGGAGTGG + Intronic
1181171949 22:21014916-21014938 CTCACTTCCTGGGGTGGGAGTGG - Intronic
1181183395 22:21083101-21083123 CTGTCTAGTTGGGGTGGGATGGG + Intergenic
1181473352 22:23154109-23154131 CTACCCAGCTGGGGTGGGAGAGG - Intronic
1181612962 22:24031263-24031285 CTGCCTCTGTGGGGTGGCAGGGG + Intronic
1181847113 22:25719685-25719707 TTTTCTTGGTGGGGTGGGGGGGG + Intronic
1181964633 22:26647811-26647833 GTGACTTGGTGGGATGGGAGGGG + Intergenic
1182962688 22:34490349-34490371 CTGAGTTGGTGGAGTGGGAGAGG - Intergenic
1183085657 22:35485374-35485396 CTGCCTGGGAGGCTTGGGAGTGG - Intergenic
1183365177 22:37403180-37403202 CTGCCTGGGGGTGGGGGGAGGGG - Intronic
1183704610 22:39469103-39469125 CTGCCTTGGTGGTGTGGGGAGGG + Intronic
1183981744 22:41544528-41544550 CCGCCTCGGCGGGGTGGGGGTGG - Intronic
1184175825 22:42788249-42788271 CTGCCTGGGTGCCGTGGGAAAGG - Intergenic
1184280766 22:43436258-43436280 CTGCCGTGGAGGCGTGGGTGCGG + Intronic
1184496608 22:44846017-44846039 CTGCCTTGGTGGTGGGGATGGGG - Intronic
1184668860 22:46002391-46002413 CTGCCCTGGTGGGCTGGTTGCGG + Intergenic
1184860203 22:47169212-47169234 CTGCCTGGGTGGTGTGGGTAGGG + Intronic
1184930093 22:47674555-47674577 GTGCCTTCATGTGGTGGGAGGGG + Intergenic
1184988223 22:48150348-48150370 CTGACTTGGTGAAGTGGGAAAGG + Intergenic
1185253832 22:49820733-49820755 CTGCCTTGCTGTGGTCTGAGAGG - Intronic
949349041 3:3105626-3105648 CTCCCTTTGCGGGGTGGGGGGGG - Intronic
950364445 3:12473159-12473181 CTTCCTGGGTGGGCTGGAAGAGG - Intergenic
950406917 3:12810445-12810467 CTGCCTTGGTAGGGAGGATGGGG + Intronic
950429817 3:12944249-12944271 GTGCCTTGGTAGGGGGCGAGGGG + Intronic
950573179 3:13814698-13814720 CTGGCTTGATGGGGTATGAGTGG + Intergenic
950687170 3:14626921-14626943 CTGCCTTAGGGGGGTGGGCGTGG + Intergenic
950715296 3:14843580-14843602 CTCCCTTGGTGGGGAGGGGCTGG - Intronic
951353184 3:21631275-21631297 ATGCCTTGGAAGGGTAGGAGAGG - Intronic
952043224 3:29285224-29285246 TTGCCGGGGTGGGGTGGGGGTGG + Intronic
952155816 3:30642294-30642316 TTGTGGTGGTGGGGTGGGAGTGG + Intronic
952269985 3:31821098-31821120 ATGGCTGGGTGGGGTGGGGGAGG - Intronic
952377701 3:32781075-32781097 CAGCCGTGCTGGGGTGGGGGAGG - Intergenic
952656180 3:35788461-35788483 CTGCTTGGGTGGACTGGGAGAGG + Intronic
953024806 3:39138633-39138655 CAGCCTTGGTGGGGAGGGCCTGG + Intronic
953250275 3:41239421-41239443 CTTGGTTGGTAGGGTGGGAGTGG + Exonic
953462595 3:43093667-43093689 CTGCCTGGGGGGTATGGGAGTGG - Intronic
953660927 3:44891002-44891024 CTGCCTTCGTGGGGGTGGGGAGG + Intronic
953771500 3:45781383-45781405 CTTCCTTTCTGGGGTGGGAGGGG + Intronic
953970307 3:47342194-47342216 CTGGCTGGGTGGGGTCGGATGGG + Intronic
954031810 3:47825159-47825181 CTTCCTTGGTGTGGTCGGGGTGG - Intronic
954406392 3:50347670-50347692 ATGCCTGGGTGGGGTGGTGGAGG + Exonic
954456779 3:50603914-50603936 CTGCCCAGGAGGGGTGGGAAGGG - Intergenic
954464994 3:50649104-50649126 CTACCATGGTGGGGTGGGGCTGG - Exonic
954534218 3:51346286-51346308 CTGTCGTGGGGTGGTGGGAGGGG - Intronic
954672007 3:52296271-52296293 CTGCATAGGGGAGGTGGGAGAGG - Intergenic
954817016 3:53290488-53290510 CTGCCAGGACGGGGTGGGAGAGG + Intronic
954839101 3:53495434-53495456 CTGCATTTGTGGGGTGGGGGCGG + Intronic
955072875 3:55586136-55586158 CTGGCGGGGTGGGGAGGGAGTGG + Intronic
956448625 3:69350818-69350840 CTGCCTTGGGGTGTGGGGAGGGG + Intronic
956600033 3:71010830-71010852 CTCACTGGGTGGGGGGGGAGGGG - Intronic
956913931 3:73850958-73850980 CTGAGGAGGTGGGGTGGGAGAGG + Intergenic
957867643 3:86045051-86045073 CTGTCGTGGGGTGGTGGGAGGGG + Intronic
960611010 3:119554641-119554663 CTGCCATGGTGTGGCAGGAGAGG + Intronic
961324493 3:126102258-126102280 CTGCTTTGGTGGGGTGGCCATGG + Intergenic
961455729 3:127023029-127023051 CTACCTTGGTGGGCTGTGTGAGG - Intronic
962382244 3:134907655-134907677 CTTTCTTGGTGGGGAGGGGGCGG - Intronic
962515734 3:136149562-136149584 CTCTTTTGGTGGGGTGGGGGTGG - Exonic
962553525 3:136522716-136522738 CTGCCGTGGGGTGGGGGGAGGGG - Intronic
963139261 3:141934072-141934094 CTGCCCGGGTGGGGTGGCAGAGG + Intergenic
963998552 3:151739850-151739872 CTAGCTTGGTGGGGGGAGAGGGG - Intronic
964452935 3:156829483-156829505 ATGAATTGGTGGAGTGGGAGAGG + Intronic
965001821 3:162963700-162963722 CTGCCGTGGGGTGGGGGGAGGGG + Intergenic
965073106 3:163941199-163941221 CTGCCGTGGGGTGGGGGGAGTGG - Intergenic
965126988 3:164643448-164643470 CTGGGATGGTGGGGTGGGGGTGG + Intergenic
967223526 3:187269595-187269617 CTTCCTTGGAGGGGTGAGAGTGG - Intronic
967776113 3:193387778-193387800 CTGCCTGGGCAGGGTGGGGGTGG - Intergenic
967930859 3:194689055-194689077 CTGCTGCGTTGGGGTGGGAGAGG + Intergenic
967940405 3:194761956-194761978 CCACCTTGGTGAGGTGGGACAGG - Intergenic
968567622 4:1322513-1322535 CTCCCAGGTTGGGGTGGGAGTGG + Intronic
968623442 4:1615048-1615070 GTGCCCAGGTGGGGTGGGCGTGG - Intergenic
968623521 4:1615349-1615371 GTGCCCAGGTGGGGTGGGCGTGG - Intergenic
968926845 4:3553049-3553071 CAGGCATGGTGGGGTGGGTGGGG - Intergenic
968939595 4:3631054-3631076 CTCCTGGGGTGGGGTGGGAGGGG + Intergenic
969239187 4:5888174-5888196 TGGCCTTTGTGGGCTGGGAGTGG - Intronic
969311286 4:6354220-6354242 CCTCCTCGGTGGGGTGGGAGAGG - Intronic
969342111 4:6548764-6548786 CAGCCTTGGTTCAGTGGGAGAGG + Intronic
969455222 4:7296513-7296535 AGTCCTTGGTGGGGTGGGTGGGG - Intronic
970846449 4:20544018-20544040 CTGTCTTGGTGTGGGGGGATGGG + Intronic
971416361 4:26435288-26435310 TTGCCTTTGAGGGGTGGGGGTGG + Intergenic
971502816 4:27334784-27334806 CAGACTTGGTGGGGAGAGAGTGG - Intergenic
971703965 4:30015118-30015140 CTGTCGTGGCGTGGTGGGAGGGG - Intergenic
973652328 4:53008341-53008363 GTGCCAGGGTGGGGAGGGAGAGG - Intronic
973916712 4:55641332-55641354 ATGCCTTCGTGAAGTGGGAGAGG - Intergenic
974156254 4:58077194-58077216 CCGCATTGGAGGAGTGGGAGTGG + Intergenic
974432527 4:61817150-61817172 ATGCCTTGGTGGGGGGGGGGGGG - Intronic
974671702 4:65038415-65038437 CTGCCTTGGGGTTGGGGGAGGGG + Intergenic
975258592 4:72269546-72269568 CTGCCATGGGGTGGAGGGAGTGG + Intergenic
975943394 4:79675283-79675305 CTGTCGTGGGGTGGTGGGAGTGG + Intergenic
976516332 4:85971752-85971774 GTCCGTGGGTGGGGTGGGAGTGG - Intronic
977028947 4:91858485-91858507 CTGTTTTGGGGTGGTGGGAGGGG - Intergenic
978253467 4:106662177-106662199 TTGCATTGGTGGAGTGGGGGTGG - Intergenic
980300512 4:130985518-130985540 CTGTCTTGGTGGAGAGTGAGAGG - Intergenic
980503444 4:133685324-133685346 CTGTCATGGGGTGGTGGGAGGGG - Intergenic
981259179 4:142699074-142699096 GTGCATGGGTGGGGTGGAAGTGG + Intronic
981387427 4:144148073-144148095 CTGCTGTGGTGTGGGGGGAGCGG - Intergenic
981629111 4:146797642-146797664 CAGCCAGGGTGAGGTGGGAGAGG - Intronic
981840767 4:149109129-149109151 CTGCTGTGGGGTGGTGGGAGGGG - Intergenic
983621728 4:169768916-169768938 CTGCCTGTGTGTGGTGGTAGAGG - Intergenic
985551521 5:535661-535683 AGGTCTTGGTGGGGTGGGCGGGG - Intergenic
985852603 5:2399656-2399678 CTGTGTTTGTGGAGTGGGAGGGG - Intergenic
986073785 5:4313541-4313563 CTGCCATGGAAGGGTGGGGGTGG - Intergenic
986473413 5:8097962-8097984 CAGCCATGGTAGGGTGGGAGGGG + Intergenic
986636134 5:9823980-9824002 TTGCCTTGGAGGGCTGGGGGAGG + Intergenic
987391009 5:17375467-17375489 CTGCCTCGTGGGGATGGGAGGGG + Intergenic
988595421 5:32585964-32585986 CTGCCTAGGTGGGGCGCGTGCGG + Intronic
988963677 5:36393845-36393867 CATACTTGGTGGGGTGGGGGTGG - Intergenic
991473382 5:66993924-66993946 CAGATTTGGTGGGGTGGGGGGGG - Intronic
992167687 5:74071196-74071218 CTGTCTTGGGGGGGCGGGGGGGG - Intergenic
992363433 5:76066442-76066464 CTGTCTTGGGGTGGGGGGAGGGG + Intergenic
993223750 5:85137972-85137994 TTTCTTTGGTGGGGTGGGAGGGG - Intergenic
993774162 5:91970492-91970514 CTGCCGTGGGGTGGGGGGAGGGG - Intergenic
993781821 5:92075844-92075866 CTGCCGTGGGGTGGGGGGAGGGG - Intergenic
993973135 5:94444200-94444222 TTTCCATGGTGGGGTGGGATGGG + Intronic
994059305 5:95456326-95456348 TTGCCTTGGTTAGGTGGGATAGG + Intergenic
994726068 5:103437235-103437257 CTGCTTAGGCAGGGTGGGAGTGG - Intergenic
995316682 5:110782509-110782531 CTGCCTTTTTGTGGTGGGGGAGG - Intergenic
995510092 5:112900582-112900604 CTGCTTTGCTGGGGTAGAAGGGG + Intronic
995673210 5:114631809-114631831 CTGCTCTGGTGAGGTTGGAGGGG - Intergenic
995740201 5:115347993-115348015 ATGCATTAGTGGGGAGGGAGGGG - Intergenic
995781790 5:115784408-115784430 CTTCCTATGTGGGGTGGGATGGG + Intergenic
997027387 5:130081319-130081341 GTGTGTTGGTGGGGTGGGTGGGG + Intronic
997110507 5:131069092-131069114 CTGCCTTGTTGTGGTGGTAGTGG + Intergenic
997412144 5:133698440-133698462 TGACCTTGGTGGGGTGGGTGGGG + Intergenic
997596845 5:135112803-135112825 GTGCCTTGGTGGGGAGGGTCAGG + Intronic
997814058 5:136999221-136999243 CAGCCTTGGTGGGGTTGTAAGGG + Intronic
997823488 5:137086375-137086397 CTGCCTTTGTGGCCTGGGTGCGG - Intronic
997993719 5:138568388-138568410 CTACGTTGGGGGGGAGGGAGAGG + Intronic
998149389 5:139748186-139748208 CTGGGTAGGTGGGGTGGGGGCGG - Intergenic
998683284 5:144495375-144495397 CTGTCATGGTGTGGGGGGAGGGG - Intergenic
999189638 5:149737506-149737528 CTGGCTTGGAGGTGAGGGAGAGG - Intronic
999191053 5:149747791-149747813 CCTCCCTGGTGGGGTGGGGGTGG + Intronic
999723000 5:154412625-154412647 CTGGGTTGGTGGTGGGGGAGTGG - Intronic
999758430 5:154682572-154682594 CTGCCTCTGTGGGATGGGAGGGG - Intergenic
1001274359 5:170339427-170339449 CTGCCCTGGTTGGGGGTGAGGGG + Intergenic
1001323815 5:170704805-170704827 CAGCCTTGATGGTGGGGGAGGGG - Intronic
1001453695 5:171845260-171845282 CTGCCTTGGGGTGGTGGGGTAGG + Intergenic
1001483152 5:172102194-172102216 CTGCAATGGAGGGGTGGGAAAGG + Intronic
1001502215 5:172246118-172246140 GTTCCATGGTGGGGTGGGAGAGG + Intronic
1001641521 5:173247245-173247267 CTGGCCTGGAGGAGTGGGAGAGG - Intergenic
1001823771 5:174729634-174729656 CTGCCTTCGTGGAGAGGGAGAGG - Exonic
1002012890 5:176298199-176298221 ATGCTTTGCTGGGGAGGGAGAGG - Intronic
1002081030 5:176737549-176737571 GTGATTTGGTGGGATGGGAGAGG + Intergenic
1002604979 5:180377616-180377638 CTGTCCTGCTGGGGTCGGAGAGG + Intergenic
1003497877 6:6679793-6679815 CTGCCAGGGTGGGCAGGGAGGGG + Intergenic
1003694542 6:8390392-8390414 CAGGCTGGGTGGGGTGGGAAAGG - Intergenic
1004075424 6:12340207-12340229 CTGCTTTGGTGCGGTGTGTGGGG - Intergenic
1004203574 6:13572213-13572235 GTTCCTTGGTGGGGTGGGGCGGG - Intergenic
1004491670 6:16123061-16123083 CTGGCCTTGTGGGGTGGGTGGGG - Intergenic
1004825100 6:19411416-19411438 CTGCCATGCTGGGGTTGAAGGGG + Intergenic
1006125470 6:31835045-31835067 CGGCCTGGCTGGGGTAGGAGAGG + Exonic
1006304549 6:33211356-33211378 CGGCACTGGTGGGGTGGGTGGGG + Exonic
1006377700 6:33680691-33680713 CGGCCCTGGGGTGGTGGGAGAGG - Intronic
1006718007 6:36132300-36132322 CTGCCTAGGTGAGTTGAGAGTGG + Intronic
1006796938 6:36737892-36737914 CTGCCTGGAAGGGGCGGGAGAGG - Intergenic
1006798499 6:36745307-36745329 CTGCCTCTGGGTGGTGGGAGGGG - Intronic
1006840550 6:37025711-37025733 CTGCCTTGGTGGGCAGGTGGGGG - Intronic
1006924099 6:37644713-37644735 CTGCCTCTGGGGGGTGAGAGGGG - Intronic
1007122772 6:39397021-39397043 CCGCCTCGGTGGGGAGGAAGGGG + Intronic
1007257701 6:40540450-40540472 CTGTGGTGGTGGGGAGGGAGTGG - Intronic
1007348000 6:41247637-41247659 CTGCCTTGTGGAGGAGGGAGTGG + Intergenic
1007465480 6:42048571-42048593 CTGCCTTTGGGGAGTGGGGGTGG + Intronic
1007657785 6:43462576-43462598 CTGGAATGGTGGGGTGAGAGTGG - Intergenic
1007698139 6:43746886-43746908 CTCCCTTGGGGGGCTGGGAGCGG + Intergenic
1008008864 6:46442384-46442406 GTGCCTTGGTGGTGGTGGAGGGG - Intronic
1009027964 6:58022803-58022825 CTGCCGTGGGGTGGGGGGAGGGG - Intergenic
1009444112 6:63719546-63719568 CTGCAGTGGTGGACTGGGAGTGG + Intronic
1010182474 6:73103479-73103501 CTGTCATGGGGGGGGGGGAGAGG + Intronic
1010393339 6:75361350-75361372 CTCCCTTGGTGGTGAGGGTGGGG + Intronic
1011380837 6:86740583-86740605 CTGAGTTGGTGGACTGGGAGAGG - Intergenic
1012197945 6:96367918-96367940 CTGCCTAGGCTTGGTGGGAGAGG - Intergenic
1012336560 6:98066767-98066789 CTGCCATGGGGTGGGGGGAGGGG - Intergenic
1012931216 6:105319051-105319073 ATGCCTTGGGGTGGAGGGAGTGG - Intronic
1013013864 6:106143770-106143792 CTGCCTGGGAGGGGTAAGAGAGG + Intergenic
1015092854 6:129379632-129379654 CCACGCTGGTGGGGTGGGAGTGG - Intronic
1015545490 6:134357120-134357142 CTGCCTTCCTGTGGAGGGAGTGG + Intergenic
1015824050 6:137293259-137293281 CAGGCATGGTGGGCTGGGAGTGG - Intergenic
1016190056 6:141254279-141254301 TTGCGTTGGTGGACTGGGAGAGG + Intergenic
1017084375 6:150700374-150700396 CTGATTTGGTGGGGCTGGAGTGG - Intronic
1017907090 6:158764326-158764348 CAGCTTTGTTGGGGTGGGAGTGG + Intronic
1018184640 6:161256059-161256081 CTGCCTGGGTGAGGGTGGAGTGG - Intronic
1018583922 6:165334985-165335007 CTGCCTGGGGTGGGTTGGAGTGG - Intronic
1019273737 7:164995-165017 CTGTGGTGGTGGGGTGGGTGTGG - Intergenic
1019305772 7:333703-333725 CTGGCTTGGGGGGGTGGGGCGGG - Intergenic
1019415527 7:925001-925023 CTGCCCGGGTGGGAAGGGAGAGG + Intronic
1019504025 7:1381698-1381720 CACCCTTGGGGGGCTGGGAGGGG - Intergenic
1019543268 7:1560869-1560891 CTGGCTGGGTGGGGAGGGGGTGG - Intergenic
1019567690 7:1692669-1692691 CTGGCTGGGTGGAGTGGGAAGGG + Intronic
1019630830 7:2048822-2048844 CTGGCTTGGGGAAGTGGGAGTGG - Intronic
1019666826 7:2256172-2256194 CGGCCGTGGTGGGGCTGGAGAGG - Intronic
1021375366 7:19900697-19900719 CTGCCATGGGGGGGAGGGACAGG - Intergenic
1021626865 7:22602145-22602167 CTGCCCTGGGGGGCTGGGAAGGG + Intronic
1022229869 7:28404393-28404415 CTGACTGAGTGGGATGGGAGAGG - Intronic
1022774713 7:33514257-33514279 CTGCTTTGGAGAGGTGAGAGTGG + Intronic
1022976209 7:35558906-35558928 GTGCCATGGTGTGGTGGAAGGGG - Intergenic
1023153699 7:37226525-37226547 ATGGTTTGGTGGGGTGGGGGAGG - Intronic
1023865201 7:44235104-44235126 CTGCCTTCCTGGGGTAGGGGTGG + Intronic
1024543887 7:50501108-50501130 CTGCCTCAGTGGGGAGGGATGGG + Intronic
1025058984 7:55788016-55788038 CTGCTTTGATGGGCTGGGCGCGG + Intergenic
1025273666 7:57552279-57552301 GAGCCTTGGGGTGGTGGGAGGGG + Intergenic
1026340115 7:69427672-69427694 CTTCCATGGTGAGGAGGGAGAGG - Intergenic
1026852795 7:73735511-73735533 CTGCTTTTGGGGGCTGGGAGGGG + Intergenic
1026936571 7:74259990-74260012 CAGCCTCGGAGGGGTGGGAGTGG + Intergenic
1026936584 7:74260031-74260053 CAGCCTGGGACGGGTGGGAGTGG + Intergenic
1027428788 7:78088698-78088720 CTGCCTTGGTGCTGTGGGCCTGG - Intronic
1027741894 7:82018981-82019003 CTGTCTTGGTGGGGTGGGGGTGG + Intronic
1029055972 7:97743055-97743077 CTGCATTGGTGGGGTGGGGCAGG + Intergenic
1029697859 7:102226176-102226198 CTGCCTTGTTGGGGTCGCCGTGG - Intronic
1029710392 7:102296035-102296057 CTGCCTTGGTACTGGGGGAGGGG - Intronic
1030483321 7:110132348-110132370 CTGTCGTGGGGTGGTGGGAGTGG - Intergenic
1031006248 7:116475768-116475790 CTGTCGTGGGGTGGTGGGAGGGG + Intronic
1031983843 7:128149663-128149685 CTGCCTTGCTGGGGAGGAGGAGG + Intergenic
1033069427 7:138188630-138188652 CTAACTTGGTGGGAAGGGAGAGG + Intergenic
1033497167 7:141910634-141910656 CTGCATTGCTGGGGCGGGGGGGG + Intronic
1033820736 7:145131346-145131368 CTGCCTCGCTGGAATGGGAGTGG - Intergenic
1034191340 7:149215725-149215747 CTGGCTTGGTGGGATGAGATGGG + Intronic
1034208642 7:149342307-149342329 CTGCTGTGGGGTGGTGGGAGGGG - Intergenic
1034437640 7:151070740-151070762 AGGCCATGGTGGGGCGGGAGAGG - Exonic
1034493090 7:151404816-151404838 CTGCATTGGGGTGGTGGGGGAGG - Intronic
1034563011 7:151893816-151893838 CAGCCTTGGTGGTGTGGAGGTGG - Intergenic
1034732333 7:153398984-153399006 GTCCCATGGTGGGCTGGGAGAGG + Intergenic
1035064712 7:156096250-156096272 GTGCCCAGGTGGGATGGGAGGGG - Intergenic
1035110933 7:156481189-156481211 CGGCCTTGGTGGGGTGGCAAAGG - Intergenic
1035476712 7:159149172-159149194 GTGCCTGCCTGGGGTGGGAGGGG - Intergenic
1036750886 8:11443217-11443239 CTCCCCTGGGGGGGTGGAAGGGG + Intronic
1037473803 8:19237285-19237307 CTCCCTTGGTGGGGTTAGAGAGG + Intergenic
1037788768 8:21919203-21919225 CAGCCTAGGTGGGGTGTGGGGGG + Intergenic
1037799823 8:22026246-22026268 TTGCATGGATGGGGTGGGAGTGG - Intronic
1037804067 8:22049577-22049599 CTGACCTGGTGGGGTGGCGGGGG - Intronic
1038405070 8:27315476-27315498 CTGCGTTGGGGGGAGGGGAGAGG - Intronic
1038571653 8:28667706-28667728 TTCCCTTGGTGTGGGGGGAGGGG + Intronic
1039204962 8:35141808-35141830 GTGCCTTGGTGGAGTTGGAGGGG - Intergenic
1039906533 8:41790556-41790578 ATGAATTGGTGGGGTGGGGGTGG - Intronic
1040005936 8:42620980-42621002 CTGCCTTAGTGGCATGGGAATGG + Intergenic
1041163796 8:55071857-55071879 CTCCATGGGCGGGGTGGGAGTGG + Intergenic
1043446870 8:80327572-80327594 CTGTCTTGGTGGGGGTGGAGCGG + Intergenic
1043855760 8:85262914-85262936 CAGGCTTGGTGGGGTGGGAGAGG + Intronic
1043951102 8:86310046-86310068 TTGACTTGGTGGAGTGGGAGAGG + Intronic
1044235374 8:89824362-89824384 CTGCCTTGGTATGCGGGGAGGGG + Intergenic
1044374294 8:91451045-91451067 CTGGCTTCGTGGGGTGAGGGAGG + Intergenic
1044503568 8:92991053-92991075 CTGGCTTGGTGGGGGGAGGGAGG + Intronic
1045326109 8:101118950-101118972 CTGCCTGGTTGAGGTAGGAGAGG + Intergenic
1046354961 8:113070432-113070454 CTGCTTTTGTGTGGGGGGAGGGG + Intronic
1047130600 8:122016070-122016092 TTGACTTGGTGGGGTGGGGGAGG - Intergenic
1047255414 8:123210010-123210032 GTGGGTTGGTGGGGTGGGAGTGG - Intronic
1047640640 8:126817955-126817977 CTGTCTGGGTGGGGTGGGGTGGG - Intergenic
1048289507 8:133169863-133169885 CTGCCTGGATGGGAGGGGAGAGG - Intergenic
1048492962 8:134911779-134911801 TTTCCTGGTTGGGGTGGGAGTGG + Intergenic
1049073870 8:140378304-140378326 TTGACTCGGTGGGCTGGGAGAGG + Intronic
1049148844 8:141021352-141021374 CAGCCTTGGTGGAGGGTGAGGGG + Intergenic
1049198136 8:141326515-141326537 CTCCCCAGGTGGGGTGGGACCGG + Intergenic
1049203033 8:141351057-141351079 CTCCCTTGGGCGGGTGTGAGGGG + Intergenic
1049221642 8:141431329-141431351 CAGCCTGGCTGGTGTGGGAGGGG - Exonic
1049232417 8:141491434-141491456 GAGTCTTGCTGGGGTGGGAGAGG - Intergenic
1049271766 8:141699891-141699913 CTGCCTTGCTGGGGTGGGGGTGG + Intergenic
1049272629 8:141703986-141704008 CTGCTCTGATGGGGAGGGAGTGG - Intergenic
1049472378 8:142782265-142782287 CTGCCTTTCAGGGGTGGGAGTGG + Intergenic
1049576678 8:143392934-143392956 GTGGATTGGTGGGGTGGGTGTGG + Intergenic
1049584556 8:143426867-143426889 CGGCCTTTTTGGGGTGGGAGCGG - Intronic
1049798493 8:144507092-144507114 CTGGCGGGGTGGGGTGGGGGGGG + Exonic
1051498943 9:17756472-17756494 CTGCCGTGGGGTGGGGGGAGGGG - Intronic
1051664054 9:19451612-19451634 CTGCTGAGCTGGGGTGGGAGGGG - Exonic
1053801764 9:41768431-41768453 CGGGCATGGTGGGGTGGGTGGGG - Intergenic
1054143443 9:61546395-61546417 CAGGCATGGTGGGGTGGGTGGGG + Intergenic
1054190198 9:61980585-61980607 CGGGCATGGTGGGGTGGGTGGGG - Intergenic
1054451177 9:65404278-65404300 CTCCTGGGGTGGGGTGGGAGGGG - Intergenic
1054906786 9:70419729-70419751 CTGCGGGGGTGGGGAGGGAGTGG + Intergenic
1054984073 9:71241490-71241512 CTGCCGTGGGGTGGGGGGAGGGG + Intronic
1055065795 9:72116922-72116944 CTGTCGTGGGGTGGTGGGAGGGG - Intronic
1057266477 9:93621176-93621198 CAGCCTTGGAGGGGCAGGAGGGG + Intronic
1058524743 9:105845551-105845573 CTGTTTTGGGGGGGTGGGAATGG + Intergenic
1059408346 9:114116345-114116367 CTGCCTTTTTGGGGAGGGAGTGG - Intergenic
1059587714 9:115623911-115623933 CTGCTTTAGTGGGGTGGGGATGG - Intergenic
1061037657 9:128122516-128122538 CTTCCCTGCTGGGCTGGGAGTGG - Intronic
1061061829 9:128254369-128254391 CTGCCTGGGTGCCGTGTGAGAGG + Intronic
1061076576 9:128345103-128345125 CTGCCATGGTTGGGAGGGAGGGG - Intronic
1061587566 9:131578743-131578765 CTCCCCAGGTGGTGTGGGAGGGG + Exonic
1061662801 9:132141505-132141527 CTACCTGGCTGGGGTGGGAGGGG - Intergenic
1061676083 9:132216546-132216568 CAGCCCTGGTGGCCTGGGAGGGG + Intronic
1061817523 9:133205817-133205839 CTGGCTGTGTGGGATGGGAGGGG + Intronic
1061886967 9:133596042-133596064 CAGGCATGGTGGGGTGGGTGTGG + Intergenic
1062005697 9:134237477-134237499 CTGCCGTGGTGGGGTGGGCGTGG + Intergenic
1062056683 9:134472608-134472630 CTGCCTTGGTGGGGCAGGGGTGG + Intergenic
1062189812 9:135242229-135242251 CTGCCTGGGTGGCCTTGGAGGGG - Intergenic
1062282042 9:135756543-135756565 CTGCCCTGGTGGGGAGGGAACGG - Intronic
1062288814 9:135785595-135785617 CTGCCTTGGTGGGGCCTGGGAGG - Intronic
1062429371 9:136520134-136520156 CTGCCTTGGAGGCCTGGGTGGGG - Intronic
1062569011 9:137175938-137175960 CTGCCAGGGTGGGGTGGGGCAGG - Intronic
1062707807 9:137954829-137954851 CTGAGTTGGTGGAGTGGGTGTGG - Intronic
1203625356 Un_KI270750v1:12920-12942 GAGCCTTGGGGTGGTGGGAGGGG + Intergenic
1185961339 X:4548787-4548809 TTGAGTCGGTGGGGTGGGAGAGG + Intergenic
1186147402 X:6638647-6638669 CTGTCATGGGGTGGTGGGAGGGG + Intergenic
1186425871 X:9464556-9464578 CTTCCTTTTTGGGGTGGGGGAGG + Intronic
1186819941 X:13277408-13277430 TATCCTTGGTGGTGTGGGAGTGG + Intergenic
1187051948 X:15703822-15703844 CTTTCTTGGTGGGGGGGGGGAGG + Intronic
1188242581 X:27809370-27809392 CGGGGTTGGGGGGGTGGGAGAGG - Intronic
1189334642 X:40163586-40163608 TGGCCATGGTGGGGTGGGGGTGG - Intronic
1189903866 X:45736777-45736799 GTGCCTTGTGGGGGTGGGAGGGG + Intergenic
1190230772 X:48580266-48580288 CTGCCTAGGTGGGATAGGAGGGG - Intergenic
1190267440 X:48835664-48835686 CTGCGTCGGTCGGGTGGGTGGGG - Intergenic
1190887166 X:54540252-54540274 TTGCCTTGGTGGGGAGAGAGAGG + Intronic
1191629522 X:63306858-63306880 CTGTCATGGGGTGGTGGGAGGGG + Intergenic
1191794537 X:65006553-65006575 CTGTCATGGGGTGGTGGGAGGGG + Intronic
1192184812 X:68939780-68939802 CAGCTTGGGTGGGGTGGGACGGG + Intergenic
1192248872 X:69394728-69394750 CTCCCTAGGTCTGGTGGGAGTGG - Intergenic
1192796428 X:74427323-74427345 CTGCTGTGGTGGGGTTGGGGAGG + Intronic
1192925850 X:75754419-75754441 CTGCCGTGGGGTGGGGGGAGGGG - Intergenic
1193367894 X:80656561-80656583 CTGTTTTGGGGTGGTGGGAGCGG + Intergenic
1193617978 X:83713086-83713108 CTGTCTTGGGGTGGGGGGAGGGG + Intergenic
1194640193 X:96394713-96394735 CTGCAGGGGTGGCGTGGGAGGGG + Intergenic
1194974031 X:100375244-100375266 CTGTCTTGGGGTGGAGGGAGGGG - Intronic
1195004900 X:100676213-100676235 CTTCCCTGGTGGGCTGAGAGTGG - Intronic
1198272911 X:135072248-135072270 CTGTCTTGGGGTGGGGGGAGTGG - Intergenic
1199485216 X:148339191-148339213 CTGCCTTGGTGGTCTGGTATAGG - Intergenic
1199738102 X:150704359-150704381 CTTTGTTGGTGGGGTGGGTGTGG - Intronic
1199856360 X:151762079-151762101 CTGCCCTGGTGGGGTCTCAGAGG + Intergenic
1200071911 X:153533431-153533453 CTGTGTGGCTGGGGTGGGAGTGG + Intronic
1200111550 X:153743364-153743386 CTGCCTGGGGTCGGTGGGAGTGG + Intronic
1200397165 X:155998120-155998142 GTGCCTTTGTGGGGTGAGAATGG + Intronic
1200713149 Y:6507426-6507448 CTGTTTTGGGGTGGTGGGAGGGG + Intergenic
1201020772 Y:9654617-9654639 CTGTTTTGGGGTGGTGGGAGGGG - Intergenic
1201143299 Y:11046399-11046421 CTGTCTTGGTGAGGTGGGTTGGG + Intergenic