ID: 934990831

View in Genome Browser
Species Human (GRCh38)
Location 2:98920483-98920505
Sequence GGGGTGCCAGCACTTTCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934990823_934990831 6 Left 934990823 2:98920454-98920476 CCACAGGCACCCAGGGCTGTCAC 0: 1
1: 0
2: 3
3: 42
4: 378
Right 934990831 2:98920483-98920505 GGGGTGCCAGCACTTTCCTGCGG 0: 1
1: 0
2: 0
3: 23
4: 232
934990818_934990831 25 Left 934990818 2:98920435-98920457 CCTTCACTGAGCGGTCATCCCAC 0: 1
1: 0
2: 0
3: 3
4: 111
Right 934990831 2:98920483-98920505 GGGGTGCCAGCACTTTCCTGCGG 0: 1
1: 0
2: 0
3: 23
4: 232
934990822_934990831 7 Left 934990822 2:98920453-98920475 CCCACAGGCACCCAGGGCTGTCA 0: 1
1: 0
2: 0
3: 18
4: 307
Right 934990831 2:98920483-98920505 GGGGTGCCAGCACTTTCCTGCGG 0: 1
1: 0
2: 0
3: 23
4: 232
934990827_934990831 -4 Left 934990827 2:98920464-98920486 CCAGGGCTGTCACCACCAAGGGG 0: 1
1: 1
2: 3
3: 27
4: 212
Right 934990831 2:98920483-98920505 GGGGTGCCAGCACTTTCCTGCGG 0: 1
1: 0
2: 0
3: 23
4: 232
934990825_934990831 -3 Left 934990825 2:98920463-98920485 CCCAGGGCTGTCACCACCAAGGG 0: 1
1: 0
2: 3
3: 22
4: 216
Right 934990831 2:98920483-98920505 GGGGTGCCAGCACTTTCCTGCGG 0: 1
1: 0
2: 0
3: 23
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934990831 Original CRISPR GGGGTGCCAGCACTTTCCTG CGG Intronic
902332168 1:15736048-15736070 GGGGTGCCAGCCCTTTGCCCAGG + Intergenic
904376801 1:30086723-30086745 GGGGTGCCAGCACCTTCTCTGGG - Intergenic
905344864 1:37304463-37304485 TGGGTGCCTGCACATTCCTGGGG + Intergenic
906723176 1:48023917-48023939 ATGGTGCAACCACTTTCCTGGGG + Intergenic
910076796 1:83290315-83290337 GGGGTGCCAGCATTGTTCTCAGG - Intergenic
911088510 1:93999460-93999482 GGGAAGGCAGCACTTCCCTGAGG + Intronic
911154156 1:94622884-94622906 GTGGCCCCAGCACATTCCTGAGG + Intergenic
912545516 1:110448378-110448400 GAGGAGGCAGCACTTTGCTGGGG - Intergenic
914430243 1:147613983-147614005 TGAGTGCCAGCACTATGCTGGGG + Intronic
914709578 1:150200695-150200717 GGTGTGGTAGCACTTACCTGTGG + Intergenic
915941584 1:160121594-160121616 GGGCTGACAGCCCATTCCTGTGG + Intronic
915995737 1:160561261-160561283 GGTTTGCCAGCATTTTACTGAGG - Intronic
916645499 1:166780990-166781012 GGTGTGCCAGTATTTTACTGAGG + Intergenic
916684357 1:167131308-167131330 GGTGTGCCATCTGTTTCCTGTGG - Intergenic
918936701 1:190930360-190930382 GGGGTGGCAGCACATGCCTTGGG - Intergenic
919985503 1:202671271-202671293 GGAGTGGCAGCACTTTCCTCTGG - Intronic
920531802 1:206707511-206707533 TGGATCCCAGCACTTTTCTGGGG + Intronic
920608412 1:207412992-207413014 GAGGTGGCAGGACTTTCCTGGGG + Intergenic
923149007 1:231217524-231217546 GAGGAGCCACCACTTTCCTGGGG + Intronic
923195430 1:231662102-231662124 TGGCTGCCAGCTCCTTCCTGTGG + Intronic
923374002 1:233341708-233341730 GGGCTGCCAGCCCTTACTTGGGG + Intronic
924088547 1:240479256-240479278 GGTGTGGTAGCACTTGCCTGTGG + Intergenic
924558509 1:245137832-245137854 GGTGTGCCAGCTCTGTACTGGGG - Intergenic
1062965690 10:1606189-1606211 GGTGTCCCAGCACCTTTCTGGGG + Intronic
1064120110 10:12611230-12611252 GGGTTGCCTGCACTTTGATGGGG - Intronic
1064210944 10:13360023-13360045 TGGAAGCCAGCATTTTCCTGTGG + Intergenic
1067027363 10:42856060-42856082 GGGCTGACAGCACATTCCTAGGG + Intergenic
1067742419 10:48905680-48905702 GGGGTGTCCGCATTTTGCTGAGG - Intronic
1069275996 10:66591633-66591655 GCTGTTCCAGCCCTTTCCTGTGG + Intronic
1069409722 10:68140930-68140952 GGTGTGGCAGCACGTGCCTGTGG + Intronic
1069677137 10:70256216-70256238 GAGGTGGCAGCGCATTCCTGTGG - Intronic
1071731682 10:88254520-88254542 GAGGTGACAGAACTTCCCTGAGG + Intergenic
1073032576 10:100539043-100539065 GTGGTGGCAGCACATGCCTGTGG - Intronic
1073782728 10:106857140-106857162 ATTGTGCCAGCACTGTCCTGGGG - Intronic
1074755105 10:116618689-116618711 AGGTTGCCAGCAATTTCCTGAGG - Intergenic
1076212227 10:128657917-128657939 GGGCTGCCAGAGTTTTCCTGGGG - Intergenic
1076682460 10:132180263-132180285 GGGGTGCCAGAGCTTGCTTGGGG + Intronic
1076715458 10:132361772-132361794 TGGGTGACAGCAGTTCCCTGAGG - Intronic
1077657172 11:4030451-4030473 GGGCTGCCAGCTCTTTCATACGG - Intronic
1078067405 11:8087437-8087459 GGGAAGCCAGCACTGTCTTGTGG + Intronic
1078524614 11:12090889-12090911 GGAGTGCCAGCCCCTCCCTGTGG + Intergenic
1079077507 11:17393258-17393280 GTGGGGACTGCACTTTCCTGGGG + Intronic
1079507487 11:21169823-21169845 GGGGTGCAAGCACTTGCATCGGG - Intronic
1081443775 11:43109607-43109629 GGTGTCCCAACACCTTCCTGAGG + Intergenic
1081689926 11:45070989-45071011 GGAGTGCCAGCTCTTTCCCTGGG + Intergenic
1082286807 11:50326498-50326520 GGTGTGCCAGCATTTTATTGAGG + Intergenic
1084162172 11:67355874-67355896 TGGGTGCCAACTCTTTCCTAGGG - Intronic
1084731037 11:71073810-71073832 GGGGTACCAGAACTATCCTGGGG + Intronic
1085203916 11:74718771-74718793 GGGGTGCCAGCTCTCGCCGGGGG + Exonic
1087718596 11:101636725-101636747 TGGTTGCCTGCACTTTCCTCTGG - Intronic
1088452580 11:109997871-109997893 GTGGTGCCTGCACATTCCCGCGG - Intergenic
1088700016 11:112403350-112403372 GGGTCGCCAGGACTGTCCTGAGG - Intergenic
1090349481 11:126098398-126098420 GAGCTGCCAGCACTCTCCTCAGG + Intergenic
1091282875 11:134391865-134391887 GGGAAGCAAGCACTTCCCTGTGG + Exonic
1091980428 12:4860095-4860117 GGGGTGCTGGCACCTTCCTGAGG + Intergenic
1092916583 12:13194806-13194828 GGAGCGCCAGCACATGCCTGGGG + Intergenic
1096587244 12:52630677-52630699 GGGGTCCCATCTGTTTCCTGAGG + Intergenic
1099944456 12:89227928-89227950 GGCGTGTCAGCACATGCCTGTGG + Intergenic
1102027959 12:109724148-109724170 GAGCTGCCAGCAGTTTGCTGAGG - Intronic
1103341544 12:120223754-120223776 GGAGAGCCAACACTGTCCTGAGG + Exonic
1105951062 13:25229877-25229899 GGGCAGTGAGCACTTTCCTGTGG - Intergenic
1108436743 13:50408288-50408310 TGGGTGCAAGCAGTTTCCAGTGG - Intronic
1108695487 13:52899171-52899193 GGGCTTCCAGCGCTTTCCTGTGG + Intergenic
1109651773 13:65336679-65336701 GGGGTGCCAGGACCTGCCAGTGG - Intergenic
1110604003 13:77410014-77410036 ATGGTGCCAGCATCTTCCTGAGG + Intergenic
1111298588 13:86316826-86316848 GGCCTGCCAGCACTTTGCAGGGG - Intergenic
1111746021 13:92270432-92270454 GGGGAGCCAGCACTTTACACAGG - Intronic
1112082461 13:95988244-95988266 TGTGTGCCAACATTTTCCTGTGG + Intronic
1112411625 13:99169066-99169088 GGTTTGCCAGCATTTTACTGAGG + Intergenic
1112578981 13:100662284-100662306 GCGGTGCCTGCACTCTGCTGGGG - Intronic
1113617971 13:111694501-111694523 GGGGTCCCTGCACTGTCTTGGGG + Intergenic
1113623504 13:111779762-111779784 GGGGTCCCTGCACTGTCTTGGGG + Intergenic
1118278682 14:64409210-64409232 GGAGTGACAGCATTTTCCTTCGG - Intronic
1118570670 14:67191577-67191599 GGGGTGCCTTTATTTTCCTGGGG - Intronic
1119399694 14:74354542-74354564 GGAGTGGCAGCACATGCCTGTGG - Intronic
1119537158 14:75411788-75411810 GGTGTGGCAGCACGTGCCTGTGG - Intergenic
1119722881 14:76903055-76903077 AGGGTGACAGCGCTTCCCTGGGG + Intergenic
1120144015 14:80959549-80959571 GGCGTGCCAGCACTTTCTGGAGG - Intronic
1121496032 14:94391725-94391747 GGGTGGCCAGCACTCTCCGGGGG - Intergenic
1123037278 14:105476626-105476648 GGGCTGCCAGCACTGTGCTCTGG - Intronic
1123110255 14:105863889-105863911 GGGGTGCCAGTTCTTGCCTGGGG - Intergenic
1123206215 14:106715664-106715686 GGGTCCCCAGCACTTTCCTGAGG + Intergenic
1123211295 14:106763074-106763096 GAGTCCCCAGCACTTTCCTGAGG + Intergenic
1124159654 15:27256558-27256580 GGGGTGCCAGCAAGGTTCTGAGG + Intronic
1127310113 15:57744985-57745007 GGGTTGTCAGCGGTTTCCTGGGG - Intronic
1128228170 15:66017259-66017281 GGGGCACCAGCAGTTCCCTGAGG - Intronic
1128244064 15:66120879-66120901 TGGGTGGCAACTCTTTCCTGAGG - Intronic
1131405863 15:92163865-92163887 GGGGGGCCAGCACCTCCCAGTGG + Exonic
1132240282 15:100252555-100252577 GGAGTGGCTGCTCTTTCCTGGGG - Intronic
1133066193 16:3209042-3209064 GGGGGTCCAGCACCTCCCTGTGG + Intergenic
1133111287 16:3549680-3549702 GGGTGGCCAGGACTTACCTGAGG + Exonic
1134135236 16:11673031-11673053 GGGGTGCCTGCCCTCCCCTGGGG - Intronic
1135752952 16:25071437-25071459 GGGGACCCTGCACTTCCCTGTGG + Intergenic
1135803233 16:25518543-25518565 GGTGTGGCAGCACGTGCCTGAGG + Intergenic
1138136906 16:54531100-54531122 AGGGTGACAGCACTTTGGTGTGG + Intergenic
1139292605 16:65872104-65872126 GGGGTGCAAGTAGTTTACTGGGG - Intergenic
1140125399 16:72113740-72113762 GGGCTGCCAGCACTTTGCCTAGG + Intronic
1140635495 16:76908237-76908259 GGGGTGGTGGCACATTCCTGTGG + Intergenic
1141415223 16:83866143-83866165 GGGTTGCCAGTATTTTACTGAGG + Intergenic
1141600894 16:85125699-85125721 AGTGTGCCAGCACTTTCCCTGGG - Intergenic
1141627553 16:85269248-85269270 GGGCTGCCAGGCCCTTCCTGGGG + Intergenic
1141935338 16:87234746-87234768 GGGGGGCCAGCGCCATCCTGGGG + Intronic
1146796523 17:35785026-35785048 GGGCTGGGACCACTTTCCTGGGG + Intronic
1148063192 17:44850605-44850627 GGGGAGGCAGCAGTTTCCTGAGG + Exonic
1149570031 17:57665767-57665789 TGGGTCCAGGCACTTTCCTGGGG + Intronic
1152015751 17:77749324-77749346 CAGGTGGCAGCCCTTTCCTGGGG - Intergenic
1152848580 17:82617767-82617789 GGGCAGCCTGCACCTTCCTGAGG - Intronic
1156890104 18:42180933-42180955 AGGGTGCCAGGACTTTTCTTGGG + Intergenic
1158894311 18:61898724-61898746 GGGGTGTCTGCACTTCCCCGCGG + Intergenic
1159345342 18:67195133-67195155 GGGAAGCAAGCACCTTCCTGTGG - Intergenic
1159871064 18:73760119-73760141 GGGGTGCCAGCTTCTCCCTGGGG - Intergenic
1160065246 18:75567870-75567892 GGGTTGCTTGCACTATCCTGTGG - Intergenic
1160306767 18:77747420-77747442 GGGCAGCCAGCACTTTTCAGTGG - Intergenic
1161047882 19:2146022-2146044 GGGGAGCGGGCGCTTTCCTGAGG + Intronic
1161141134 19:2648651-2648673 AGGGTGCCAGGGCATTCCTGTGG - Intronic
1162345936 19:10118215-10118237 GGGGTGCTTGCACTGTCTTGGGG - Intronic
1163426456 19:17243498-17243520 GGGGTCCCAGGAGCTTCCTGAGG - Intronic
1163804565 19:19387631-19387653 TGAGTGCCTTCACTTTCCTGAGG + Intronic
1164526819 19:29019009-29019031 GGAGTGCCTGCGGTTTCCTGGGG + Intergenic
1165415981 19:35693830-35693852 GGGGCCCCATCACTTACCTGTGG + Intergenic
1166688525 19:44809731-44809753 GGTGCTCCAGCCCTTTCCTGAGG - Intronic
1166812808 19:45524260-45524282 GGCGTGGTAGCACTTACCTGTGG + Intronic
1167145459 19:47679038-47679060 GGGGTGGCAGCATGTGCCTGTGG - Intronic
1167526758 19:49989085-49989107 GGGGTGCCATCCCTGTACTGGGG + Intronic
1167608531 19:50494679-50494701 GCCCTGCCAGCTCTTTCCTGAGG - Intergenic
1167831229 19:52024311-52024333 GGGGACCCAGCACTTTTCAGGGG + Intronic
926780496 2:16466795-16466817 AGGATGCCAGTTCTTTCCTGGGG + Intergenic
927778084 2:25917627-25917649 GGTGTGGCGGCACATTCCTGTGG - Intergenic
928503133 2:31919179-31919201 TGGGTGACAGCATTTTGCTGGGG + Intronic
931640533 2:64377226-64377248 GGGGTGTCAGCTCTTTGCTGAGG - Intergenic
934990831 2:98920483-98920505 GGGGTGCCAGCACTTTCCTGCGG + Intronic
935360727 2:102244468-102244490 AGGGTGCCAGCAGTGTTCTGAGG - Intergenic
937893601 2:126960013-126960035 GGTTTGCCAGCATTTTACTGAGG + Intergenic
938408816 2:131047279-131047301 GGTGTGCGTGCATTTTCCTGTGG + Intergenic
939860550 2:147415283-147415305 TGGGTGCCTGCCCTTTCCTCTGG + Intergenic
944844121 2:203652020-203652042 GAGGTCCCAGCATTTTCCTTTGG + Intergenic
945266026 2:207892239-207892261 GCAGTGCCAGTACTTTCCTGCGG + Intronic
1170496682 20:16931401-16931423 TGGGTGCCTGCTCTTTCCTCTGG - Intergenic
1171017238 20:21553094-21553116 GAGGTGCCAGCATTATGCTGGGG + Intergenic
1172422833 20:34831830-34831852 GGTGTGGCAGCACATACCTGTGG + Intergenic
1173896587 20:46555589-46555611 GGGGTCCCACAATTTTCCTGTGG + Intergenic
1174197449 20:48783560-48783582 GGGGTGCCAGCCCCCACCTGTGG - Intronic
1178718785 21:34990357-34990379 GGGGTTCCTGCTCTTCCCTGGGG - Intronic
1179602354 21:42488423-42488445 GGGGTTCCAGCACAGCCCTGGGG + Intronic
1180599556 22:17007438-17007460 GAGGTGCCCGCGTTTTCCTGGGG + Intronic
1180981714 22:19881240-19881262 GGGGTTCCAGCACCGTCCTCTGG + Intronic
1182092764 22:27607119-27607141 GGGGTACCCCCATTTTCCTGGGG + Intergenic
1182249596 22:28989636-28989658 GGGGTGGGAGCTCCTTCCTGTGG + Intronic
1182693012 22:32176556-32176578 GGGGTGGGAGCACTGTCCTCAGG + Intergenic
1183090429 22:35518651-35518673 GGAGAGCCCGCACTGTCCTGGGG + Intergenic
1183589284 22:38770431-38770453 GGGTACCCAGCACTCTCCTGGGG + Intronic
1185051253 22:48555442-48555464 GGGCTCCCAGCTCATTCCTGTGG + Intronic
1185068110 22:48642065-48642087 GAGGGGCCTGCACTTTTCTGAGG + Intronic
1185404784 22:50641616-50641638 GGGGAGCTGGCATTTTCCTGAGG + Intergenic
950425569 3:12923191-12923213 GGGGAGCCAGCCACTTCCTGAGG + Intronic
950809494 3:15637324-15637346 TGGCTGCCAGCAGTTTTCTGGGG - Intronic
951468768 3:23032809-23032831 GGTGTGCCAGTATTTTACTGAGG + Intergenic
951758410 3:26117962-26117984 GGGCTGCCAGGACTGGCCTGTGG - Intergenic
952919353 3:38274515-38274537 GGGGGCCCAGCCCTGTCCTGGGG - Intronic
952929332 3:38347173-38347195 GGAGCGCCTGCAGTTTCCTGGGG - Intronic
953092250 3:39740360-39740382 GGTTTGCCAGTACTTTACTGAGG + Intergenic
953913772 3:46905561-46905583 GGGGTGACAGCCCTGTCTTGGGG - Intergenic
954400154 3:50315253-50315275 GGAGAGCCAGCACTGTCCTGTGG - Intergenic
954421205 3:50419970-50419992 GGGTGGCCAGCAGTTCCCTGGGG + Intronic
954690883 3:52395054-52395076 AGGGTTCCAGCACTTGCCTGGGG - Exonic
954781329 3:53063937-53063959 GGTGTGGCAGCACTCGCCTGTGG - Intronic
961628191 3:128278180-128278202 GGGGAGCCAGGACCTTTCTGGGG + Intronic
961684501 3:128620361-128620383 AGGGTGCCTGCACTTTGCTGTGG - Exonic
961985710 3:131131074-131131096 GGCGTGGCAGCTCATTCCTGTGG - Intronic
963009382 3:140754986-140755008 AGGGAGCCAGCACTGTGCTGGGG + Intergenic
964173238 3:153795513-153795535 AGGGAGCGAGGACTTTCCTGGGG - Intergenic
964679593 3:159322781-159322803 GGGGTGTCTGGCCTTTCCTGAGG + Intronic
965090138 3:164151070-164151092 GGCCTGCCAGCACTTTGATGGGG - Intergenic
965272671 3:166638638-166638660 GGCATGTCAGCACTTCCCTGGGG - Intergenic
968816221 4:2823243-2823265 GGGGTGCCAGGGTCTTCCTGTGG + Intronic
968958554 4:3731075-3731097 GGGGGGCCTGCAATTCCCTGGGG + Intergenic
969611047 4:8227998-8228020 GGGAGGCCAGCGCTTGCCTGAGG - Exonic
973871007 4:55166452-55166474 GGTTTGCCAGCACTTTATTGAGG + Intergenic
974358971 4:60851371-60851393 GGGTTGCCAGCATTTTATTGAGG - Intergenic
974470531 4:62312993-62313015 GGTTTGCCAGTACTTTACTGAGG - Intergenic
975786109 4:77890226-77890248 GGGTTGCCAGTATTTTACTGAGG - Intronic
976003141 4:80396774-80396796 GGGTTGCCAGTATTTTACTGAGG + Intronic
977508926 4:97937744-97937766 TGGGTGCCTGCTCTTTCCTCTGG + Intronic
977751955 4:100620509-100620531 GGAGGGCCAGCATTTTCCTAGGG - Intronic
980917272 4:139045281-139045303 GGTGTGCCTGCACTCCCCTGAGG - Exonic
982079919 4:151779096-151779118 GGGCTGCCAGCTCTATGCTGTGG + Intergenic
983972038 4:173887484-173887506 GGTTTGCCAGTATTTTCCTGAGG + Intergenic
985124111 4:186674536-186674558 GGTGGACCAGCACTTGCCTGTGG + Intronic
986006211 5:3671337-3671359 TGTGTGCCAGCACTGTGCTGAGG + Intergenic
989582231 5:43043562-43043584 GGGGTGGTAGCACTCACCTGTGG - Intergenic
989758418 5:44984318-44984340 AGGGTGACAGCACCATCCTGAGG + Intergenic
991036235 5:62130748-62130770 GTGGAGCCAGATCTTTCCTGGGG - Intergenic
991967618 5:72108099-72108121 GGGGTCCCAGCCTTTTCCTGAGG - Intronic
993172020 5:84431260-84431282 GGGCTGCCTGCACTTGCTTGTGG - Intergenic
994593848 5:101806739-101806761 GGTGTGTCAGCACTGCCCTGAGG - Intergenic
996275713 5:121663655-121663677 GGTTTGCCAGTACTTTACTGAGG - Intergenic
998012195 5:138704227-138704249 GGTGTGCCAGCACATGCCTGTGG - Intronic
998099247 5:139418290-139418312 GGTGTGGCAGCACATGCCTGTGG - Intronic
998164692 5:139836347-139836369 AGAGTGCCAGCTCTTCCCTGTGG - Intronic
998648394 5:144090156-144090178 GGGGTGCAGCCCCTTTCCTGGGG + Intergenic
1000334122 5:160229326-160229348 GGGGTGACAGCACTTCCCCAGGG + Intronic
1000561909 5:162799828-162799850 GGGATGCCAGCAGTCTCCAGAGG - Intergenic
1000730898 5:164832675-164832697 GGGGTGCTAGCTCTGGCCTGGGG - Intergenic
1002643141 5:180640122-180640144 GGGGTGCCAGCACTGCCCAGGGG - Intronic
1003556144 6:7141743-7141765 GGGGTGCAGACACTTGCCTGCGG + Intronic
1004008213 6:11656350-11656372 AGCGTGCCAGCACTTTCTTCTGG - Intergenic
1004833863 6:19508352-19508374 GGTTTGCCAGTACTTTCTTGAGG + Intergenic
1006066715 6:31467439-31467461 CTGTTGCCAGCACGTTCCTGAGG + Intergenic
1007547187 6:42703468-42703490 GGGGTGACAGCACTTAGCTTTGG - Intronic
1008619232 6:53255467-53255489 GGTGTGATAGCACTTGCCTGTGG - Intergenic
1010495885 6:76533246-76533268 GGGGTGGCTGCACTGTCCTAGGG + Intergenic
1011496856 6:87945051-87945073 GGAGTTCCAGCATTCTCCTGTGG - Intergenic
1011579622 6:88845640-88845662 GGGGTGGCAGCACTTGCTTAAGG + Intronic
1012213252 6:96550647-96550669 AGGGGGCCAGCACCTTGCTGGGG - Intronic
1012475671 6:99613357-99613379 GGGCTGCCCCCACTTGCCTGGGG - Exonic
1014819611 6:125972725-125972747 GGTGTGGCAGTACTTGCCTGTGG - Intronic
1018683484 6:166283968-166283990 CAGTTGCCAGCACTGTCCTGTGG + Intergenic
1022400204 7:30028892-30028914 GGGGTCACGGCCCTTTCCTGAGG + Intronic
1024553817 7:50585703-50585725 GGGATGCCATCATTTTCCTAGGG + Intergenic
1024889517 7:54184340-54184362 GGGGTGTCAGTCATTTCCTGGGG + Intergenic
1026844585 7:73691130-73691152 GGGGTGGCAGGACCTTACTGTGG + Intronic
1027128174 7:75572082-75572104 GGTGTGCCAGCACAGACCTGTGG + Intronic
1027294562 7:76755543-76755565 GGGGTGCCAGCATTGTTCTCAGG - Intergenic
1032128563 7:129211734-129211756 GGGGTGACAGAAATATCCTGGGG - Exonic
1032489126 7:132310796-132310818 GGGGCACCAGCACTTTCAAGGGG + Intronic
1033235848 7:139637229-139637251 GGGGTGCCATCTGTTCCCTGTGG - Intronic
1034528784 7:151682847-151682869 CGGGGCCCAGCTCTTTCCTGGGG - Intronic
1035447253 7:158951536-158951558 GGGGCTCCAGCACCTTCCTGTGG - Intronic
1037413351 8:18620567-18620589 GGTGTGACAGCACATTCCTGTGG + Intronic
1037600007 8:20385903-20385925 GGGGAGGCAGCACTTGCCAGGGG + Intergenic
1039265243 8:35816478-35816500 TGGGTGCCTGCTCTTTCCTCTGG - Intergenic
1040942684 8:52849074-52849096 GGGTTGCCAGTATTTTACTGAGG + Intergenic
1042915543 8:73872031-73872053 GGTGTGGTAGCACATTCCTGTGG - Intronic
1045867380 8:106883472-106883494 GGTGTGCCAGTATTTTACTGAGG - Intergenic
1045998054 8:108386509-108386531 GGAGTGGCAGCACGTGCCTGTGG - Intronic
1047034333 8:120918128-120918150 GGAGTGCCAGTGCTTTGCTGGGG - Intergenic
1047151998 8:122274157-122274179 TGGGTGCCTGCACCTTCCTCTGG - Intergenic
1048190183 8:132281287-132281309 GGAGTGCCACCACATGCCTGAGG - Intronic
1051207845 9:14708297-14708319 GGTTTGCCAGTACTTTACTGAGG + Intergenic
1051371718 9:16364743-16364765 GGAGAGTCAGTACTTTCCTGAGG - Intergenic
1052237933 9:26235071-26235093 GGGGTGCCCCCTCATTCCTGAGG - Intergenic
1052707499 9:32010882-32010904 GGTGTGTCAGCACTGCCCTGAGG - Intergenic
1055663920 9:78534386-78534408 AGGGTGCCAGCAGATTCTTGAGG - Intergenic
1057294664 9:93828104-93828126 AGGCTGCCATCACATTCCTGGGG + Intergenic
1057870033 9:98709832-98709854 GGGGTGGGAGCACTATCCTCAGG + Intergenic
1059417455 9:114170750-114170772 TGGGAGCCACCACTTTCTTGTGG + Intronic
1060370483 9:123065354-123065376 CGGGTGATAGCACTGTCCTGGGG - Exonic
1061341986 9:129989896-129989918 GGTGTGGCAGCGCATTCCTGTGG + Intronic
1061546773 9:131309115-131309137 CGGTGGCCAGCACTTTCCTCGGG - Exonic
1062245063 9:135561909-135561931 GGGGAGCGGGCACTTTACTGTGG + Intronic
1185949614 X:4417096-4417118 GGGCTGCCAACATTTTCCTGTGG - Intergenic
1186451103 X:9674398-9674420 GGTGTGGTAGCACATTCCTGTGG - Intronic
1191676982 X:63801490-63801512 GGTTTGCCAGTACTTTACTGAGG - Intergenic
1200427186 Y:3034563-3034585 GGGGTGACACCACTTCTCTGTGG + Intergenic
1201647367 Y:16250218-16250240 GGGTTGCCAGTATTTTACTGAGG - Intergenic
1201655444 Y:16335083-16335105 GGGTTGCCAGTATTTTACTGAGG + Intergenic