ID: 934991517

View in Genome Browser
Species Human (GRCh38)
Location 2:98925023-98925045
Sequence GGTCGTCCTGGACCGCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934991517_934991524 19 Left 934991517 2:98925023-98925045 CCAGGGTGCGGTCCAGGACGACC 0: 1
1: 0
2: 0
3: 3
4: 73
Right 934991524 2:98925065-98925087 TTCCTTCCCCTTCTCTCCTGTGG 0: 1
1: 0
2: 11
3: 71
4: 638

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934991517 Original CRISPR GGTCGTCCTGGACCGCACCC TGG (reversed) Intronic
900466217 1:2826708-2826730 GGTGGACGTGGACCCCACCCTGG - Intergenic
901518840 1:9768208-9768230 GGTTGTCCTGGACGGCACCATGG + Intronic
901528871 1:9841447-9841469 GGCTGTCCTGGTCCCCACCCTGG - Intergenic
904800911 1:33092427-33092449 GGTACTCCTGGACTGAACCCAGG + Intronic
915458534 1:156055477-156055499 GGGCGACCTGGACCCCATCCTGG + Intronic
920493565 1:206437974-206437996 GGTCGTTCTGGTCCCCAGCCAGG - Exonic
924739584 1:246787031-246787053 TGTAGTCCTGGAACGCAGCCAGG + Intergenic
1063484379 10:6405423-6405445 TTGCGTCCTGGACCCCACCCAGG + Intergenic
1065551168 10:26869718-26869740 GGTAGTCCTGGATAGCGCCCAGG - Intergenic
1077089259 11:771060-771082 CGTCGTGCTGGACCGCCACCTGG - Exonic
1077192740 11:1262273-1262295 GGGGGTCCTGGACTGCCCCCCGG - Intergenic
1078989837 11:16635720-16635742 GGGGGCCCTGGACCTCACCCAGG - Intronic
1080990878 11:37533274-37533296 GGTCTTATTGGACCCCACCCAGG - Intergenic
1081810636 11:45912154-45912176 GCTCCTTCTGGACCACACCCTGG - Intronic
1083685635 11:64373424-64373446 GGTCTGCCTGAACCCCACCCTGG + Intergenic
1085509751 11:77082294-77082316 GGTGGTCCTGAACCCCACCCAGG + Intronic
1091509449 12:1107365-1107387 GTTGGTCCTGGACTGTACCCTGG + Intronic
1114557336 14:23569663-23569685 GGCCCTCCTGGACCTCAGCCTGG - Exonic
1115851415 14:37592776-37592798 GGCCGTCCGGGACCTAACCCGGG + Intronic
1119904094 14:78285912-78285934 GGTCTTCCTGGGCCCCAGCCAGG - Intronic
1122298284 14:100717696-100717718 GTTCGTCATGGACCGCTCCTGGG - Intergenic
1124004326 15:25784289-25784311 GGCAGTCCTGGGCCTCACCCTGG + Intronic
1124126639 15:26943221-26943243 GGTCGTCATGGTCAGCACCGTGG - Exonic
1127469391 15:59276808-59276830 GCTCTTCCTGGTCCCCACCCTGG - Intronic
1133188010 16:4114516-4114538 GGTGCTCCTGGACCTCACCTGGG + Exonic
1134092039 16:11396645-11396667 GGTCGTCGGGGAGCACACCCTGG - Exonic
1136459536 16:30400932-30400954 GGTCGTCTTGGAGGGCACACTGG - Intergenic
1142336423 16:89492034-89492056 GGTGCTCCTGGCCCGCACCGTGG - Intronic
1143018483 17:3904273-3904295 GGACGTCAGGGACCGCAGCCGGG + Intronic
1143461613 17:7108016-7108038 TGGCTTCCTGGACCACACCCAGG + Intronic
1150105027 17:62456355-62456377 GCGCCTCCTGGACCCCACCCTGG + Intergenic
1151965257 17:77427821-77427843 GGGGGCCCTGGACAGCACCCAGG + Intronic
1152827818 17:82478732-82478754 GGTCTTCCTGTAACGCACCAGGG - Intronic
1160752352 19:740403-740425 CGTGGTGCTGGACAGCACCCTGG - Exonic
1162482308 19:10935232-10935254 GATCTTCCTGGAACACACCCTGG - Intergenic
1162497019 19:11029056-11029078 AGTGGTCCTGGACAGAACCCCGG - Intronic
1163606906 19:18280758-18280780 GCTCGTCCTTGAGCGCAGCCAGG + Exonic
1166960520 19:46493707-46493729 CGTCGTCCTGGGCCGAGCCCCGG + Exonic
927193847 2:20534498-20534520 GGGCTTCCTGGTCCCCACCCTGG - Intergenic
928424872 2:31169515-31169537 GGTGGTCCTGGGCCAGACCCAGG - Intergenic
928873665 2:36011729-36011751 GGACGTCCTGGACAGGAACCAGG - Intergenic
934991517 2:98925023-98925045 GGTCGTCCTGGACCGCACCCTGG - Intronic
946254321 2:218432006-218432028 GCCTGTCCTGGACCTCACCCTGG + Intronic
948654244 2:239466779-239466801 GCTCGTCCTGGGCAGCACCAGGG - Intergenic
1171311987 20:24151977-24151999 GGCTGCCCTGGACCTCACCCAGG - Intergenic
1171810670 20:29742854-29742876 GGTCGGCCTGCAGCGCACGCAGG - Intergenic
1172177331 20:32980348-32980370 GGTCGCCTTGGATCCCACCCTGG + Intergenic
1173828102 20:46060180-46060202 GGTCCTCCTGGAGGGCCCCCTGG - Intergenic
1175296152 20:57910127-57910149 GGTGGTCCTGGCCCACAGCCAGG + Intergenic
1179988294 21:44932874-44932896 GGCCGTCCCGCACCGAACCCAGG - Intronic
1181803022 22:25359497-25359519 TGTCGTCCTGGAAATCACCCAGG + Intronic
1184733138 22:46381892-46381914 GGTCATCATTTACCGCACCCTGG - Exonic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
968507882 4:980157-980179 GGTCGGCCAGGACCTCGCCCTGG + Intronic
968586338 4:1418113-1418135 TGGCGTCCTGGACTGGACCCTGG + Intergenic
969365110 4:6689790-6689812 GCTCTTGCTGGGCCGCACCCAGG - Intergenic
973636053 4:52862669-52862691 GGTCGTCCAAGACCAGACCCAGG - Intronic
973894268 4:55396270-55396292 GGCCGGCCCGGACCGCAGCCGGG - Exonic
974880733 4:67753912-67753934 GATCAGCCTGGACCGCTCCCTGG - Exonic
982215821 4:153081883-153081905 GGGAGTCCTGGACCGGCCCCAGG + Intergenic
1002580578 5:180207709-180207731 GGACGTCCTGGGCAGCCCCCAGG - Intronic
1003076782 6:2989207-2989229 CGTCCTCCTGGACCCCTCCCAGG - Intronic
1016805235 6:148205748-148205770 GGTGGGCCTGGACTGAACCCTGG + Intergenic
1018774117 6:166998561-166998583 GGGAGTCCTGGACCCCTCCCGGG - Intergenic
1019515845 7:1439903-1439925 GGTACTCCTGGACGGGACCCAGG - Exonic
1022120026 7:27299091-27299113 GGGCTTCCTGGACTGCACGCCGG - Intergenic
1034159618 7:148983288-148983310 GGTGGTCCCGGACCCCACGCAGG - Intergenic
1035811324 8:2493776-2493798 GGTCTTCCTAGACCGTGCCCAGG + Intergenic
1036560868 8:9899386-9899408 CGTCGGCCGGGACCGCGCCCAGG - Intergenic
1049849638 8:144823895-144823917 GGTGTTCCTGGAAGGCACCCTGG - Intergenic
1051267508 9:15323175-15323197 GGGGGTCCTGGACCCAACCCAGG - Intergenic
1056756915 9:89387428-89387450 GATCGTGGTGGACCGGACCCAGG - Exonic
1061478651 9:130885380-130885402 CGTGGTCCTGGACAGCACCGAGG + Exonic
1062414336 9:136440015-136440037 CGCTGTCCTGGACCGCACCCAGG - Intergenic
1189491518 X:41474557-41474579 GGCCGGCCTGGACCTCAGCCAGG + Exonic
1190797659 X:53759777-53759799 GGGCTTCCTGGACCACACCATGG - Intergenic
1190917491 X:54821392-54821414 GGGCTTCCTGGACCACACCATGG + Intergenic