ID: 934991676

View in Genome Browser
Species Human (GRCh38)
Location 2:98925976-98925998
Sequence TTTTTGTAGCATATAAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 324}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934991676 Original CRISPR TTTTTGTAGCATATAAATAC TGG (reversed) Intronic
904426497 1:30426943-30426965 TTTTTGTATTAGAAAAATACTGG - Intergenic
904859450 1:33524251-33524273 CATTTGTAGTATATAAAAACTGG - Intronic
906340503 1:44975797-44975819 TTTTTGTAGTTTATAGAGACAGG - Intronic
906909372 1:49930436-49930458 TTTTTGTACCAGAATAATACTGG - Intronic
908995561 1:70148803-70148825 TTTTTGTAAAATTCAAATACAGG - Intronic
911649146 1:100367737-100367759 TTTTTGTGGGATATAAAGGCTGG + Intronic
912086119 1:106006754-106006776 TTTGTGAAGCATATAAAGTCTGG - Intergenic
913164777 1:116175031-116175053 TGTATGTAGCATGTACATACAGG - Intergenic
915102448 1:153510098-153510120 TCTTTGTAAAATATTAATACTGG + Intergenic
915677329 1:157543844-157543866 TTTCTGTAGGATACAAAGACAGG - Intronic
915848907 1:159299905-159299927 TTTCCATAGCATATAACTACAGG - Intronic
916355470 1:163901336-163901358 TTTTTGTATCATGGTAATACCGG - Intergenic
916494683 1:165335676-165335698 TTAATGTACCAAATAAATACTGG + Intronic
916804537 1:168245578-168245600 TTTTTGTAGAAATTAAAAACTGG + Exonic
917275693 1:173328999-173329021 TTTTTGTAACATTAAAATATTGG + Intergenic
917425921 1:174913804-174913826 TTTTTATTGCATACAAACACTGG - Intronic
918337704 1:183536665-183536687 TTTTTGTACCATAAAAAAAGAGG + Intronic
918369168 1:183841213-183841235 TGCTAGTAGCATAAAAATACAGG + Intronic
918937735 1:190945202-190945224 TTTTTCTTCTATATAAATACAGG - Intergenic
919023685 1:192140712-192140734 TTTATGTACCATATTTATACAGG + Intergenic
919250196 1:195045575-195045597 TTATTGTAACATACAAATCCTGG + Intergenic
920654416 1:207865120-207865142 TCTTTGGAGCATGGAAATACTGG - Intergenic
921180419 1:212627239-212627261 TGTTTGTAGCAAAATAATACTGG + Intergenic
921225239 1:213012951-213012973 TTTTTCTAACATAAAACTACTGG + Intronic
924065400 1:240216145-240216167 CTTGTGTGGCATATAAATAGTGG + Intronic
1064808756 10:19168333-19168355 TTTCTATAGAATATAAATGCAGG - Intronic
1068153943 10:53170977-53170999 TTTTTGTCGCTTTTAAATAAAGG - Intergenic
1068747766 10:60554533-60554555 GTTTTGTAGCACAAAAATAAAGG + Intronic
1069520122 10:69112322-69112344 TTTTTGCTTCATATAAATTCTGG - Intergenic
1071834202 10:89403475-89403497 TTTTTATAGCTTTTAAATAATGG - Exonic
1071899534 10:90105265-90105287 TTTTTGTATCAGAGTAATACTGG - Intergenic
1072830580 10:98653671-98653693 TTATTATAGCATATATATAAGGG - Intronic
1073798686 10:107017215-107017237 TATTTGTAGCAACTAAAAACTGG + Intronic
1074477604 10:113786807-113786829 TATTCCTAGCATATAAATATAGG + Intergenic
1074790465 10:116881449-116881471 CTTATGTAGTATATAAAAACTGG + Intronic
1080131879 11:28805499-28805521 TTTTGGTGGCATATCAAGACTGG + Intergenic
1081216726 11:40408630-40408652 ATTTTGGGGCATATAAAAACAGG - Intronic
1082633260 11:55565658-55565680 TTTTTGTACAATTTAAATAAAGG + Intergenic
1082972024 11:59033066-59033088 TTTTTGTAGCTTATGCAAACAGG + Intronic
1084414288 11:69022059-69022081 TTTGTGTCCCATGTAAATACTGG - Intergenic
1084928205 11:72531379-72531401 TTTTTGTTCCATATGAATTCTGG + Intergenic
1087648248 11:100833001-100833023 GTTTTGTATCCTGTAAATACAGG + Intronic
1088033602 11:105283512-105283534 TTTTTGAAGCAAATAAATGAAGG - Intergenic
1088761810 11:112937325-112937347 TTTTTGTAGTATAGATCTACTGG + Intergenic
1089716327 11:120363481-120363503 TATTTGTAGCAAGTTAATACTGG + Intronic
1090534250 11:127623531-127623553 TATTTGTAGAATAGAATTACAGG - Intergenic
1091149443 11:133313921-133313943 TTCTTATAGCAAATAAATAATGG - Intronic
1091247433 11:134110363-134110385 TATTTGTAGCATCTAAAAACTGG + Intronic
1093658953 12:21731568-21731590 TTTGGGCATCATATAAATACTGG + Intronic
1093783333 12:23162907-23162929 TTTCTGTAACACGTAAATACTGG + Intergenic
1093914580 12:24787353-24787375 TTTTTGCAGAATATAAATTGTGG + Intergenic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1094116695 12:26922094-26922116 TGTTTATAGCATATATATGCTGG - Intronic
1094579902 12:31724996-31725018 TTTTGGTAGCATTTCAATAGAGG + Intronic
1095389693 12:41690773-41690795 TATATGTAGCATATATATATAGG + Intergenic
1096915952 12:55034066-55034088 TTTTTGTATCATTTAATTATTGG + Intergenic
1097714371 12:62950606-62950628 TTTTTTTATCATAGTAATACTGG + Intergenic
1099247785 12:80214824-80214846 TTTTTATGTCATATAAATAATGG - Intronic
1099312189 12:81040650-81040672 TATGGGTAGCATATAAATTCAGG - Intronic
1100876458 12:98967480-98967502 TTCTTGTGGAATATACATACTGG + Intronic
1100942216 12:99736433-99736455 TTTTTGGTGTATAAAAATACTGG - Intronic
1101569238 12:105937783-105937805 CTTTTGTAGGATATAAAAAGTGG + Intergenic
1101630771 12:106492100-106492122 TTCTAGTAGCATATGAAGACAGG - Intronic
1101659841 12:106755953-106755975 TATTTTGAGCATATAAATGCTGG - Intronic
1107150695 13:37107445-37107467 TTTTTGTACCAGTTAAATAAAGG + Intergenic
1107465204 13:40643391-40643413 TATTTGGAGTGTATAAATACGGG - Intronic
1108103768 13:46986421-46986443 TTTATGTATCACAAAAATACAGG - Intergenic
1108417684 13:50216243-50216265 TTGTTGCAGCACATAAATTCTGG - Intronic
1109049215 13:57456794-57456816 TATTTTTAGCATATAAAAATAGG + Intergenic
1110100107 13:71589447-71589469 ATTTTGTAGTTTAAAAATACAGG - Intronic
1110378025 13:74815746-74815768 TTTTGGTTCCATATAAATTCTGG - Intergenic
1110544644 13:76743058-76743080 TATTGGTAGCATATAAAGTCAGG + Intergenic
1111022457 13:82470130-82470152 TTTTGGTATCAGATTAATACTGG + Intergenic
1111768835 13:92570480-92570502 TTTTAGTAACATAAAAATAAAGG + Intronic
1111832368 13:93344993-93345015 TTTTTAAAGCATATAAAAATAGG - Intronic
1112078336 13:95937520-95937542 TTTATTGAACATATAAATACAGG - Intronic
1115189891 14:30736719-30736741 TTTTTCTAGGCTATAATTACTGG - Intergenic
1115590652 14:34861404-34861426 TTTCTGTAGTATACAAATGCAGG - Intronic
1116269544 14:42743331-42743353 TTTTTGTATCAGGTTAATACTGG - Intergenic
1116578825 14:46611605-46611627 CTTTAGTAGCATAAAGATACAGG + Intergenic
1116880539 14:50163827-50163849 TTTTGGTAGGATATCACTACTGG - Intronic
1117879301 14:60294870-60294892 TTTTTTTACTATAAAAATACAGG + Intronic
1118093040 14:62503895-62503917 TTTTTAAAGCGTATAAATAAAGG + Intergenic
1119071289 14:71587362-71587384 TTTTTTTAGAATATAAATTATGG + Intronic
1119451871 14:74718770-74718792 TTTTAGAAGTATATTAATACTGG - Intronic
1119900358 14:78254370-78254392 TTTTTGTCGCAGAGAAATTCAGG - Intronic
1120020898 14:79528506-79528528 TGTTTGCATCAAATAAATACTGG + Intronic
1120679832 14:87467381-87467403 TTTTTCTAGTTTATAAATATAGG + Intergenic
1120764129 14:88312791-88312813 TTTTTGTATTATTCAAATACTGG - Intronic
1121204239 14:92148579-92148601 TTTTTGAAGCATATATATTCTGG + Intronic
1121481077 14:94274855-94274877 TATTTGTAATATATAAAAACTGG + Intronic
1121822229 14:96980782-96980804 TGTTTGTAAAATAAAAATACAGG - Intergenic
1121924979 14:97919210-97919232 TTTTTGTAGTATAAGAAAACAGG + Intergenic
1121956254 14:98216420-98216442 TTTTGGTAGCATGTTAATACAGG - Intergenic
1123539281 15:21271867-21271889 TTTTTGCAACCTATAATTACTGG - Intergenic
1123893596 15:24805975-24805997 TTTTTGTGGCAAAAAAATAATGG + Intergenic
1127323380 15:57868814-57868836 TTTTAGTTCCATATAAATCCTGG - Intergenic
1127528580 15:59818808-59818830 TTTGTGTAGGATATAATTTCTGG + Intergenic
1128596708 15:68958526-68958548 TTTATTGAGCATATAATTACAGG - Intronic
1129147547 15:73662699-73662721 TTTTTGTAGAATATTGAAACAGG + Intergenic
1130440771 15:83951500-83951522 TTTTGGTATCAGATTAATACTGG + Intronic
1131896445 15:97036038-97036060 TATTTGTCACATATAAGTACTGG + Intergenic
1135709776 16:24705718-24705740 TGTTTTTATCATATCAATACTGG - Intergenic
1138669733 16:58604040-58604062 TTTTGGTAGAGTAAAAATACAGG - Intronic
1140242755 16:73218466-73218488 TTTTTAAAAAATATAAATACAGG + Intergenic
1141305647 16:82861172-82861194 TTTTAGTCTCATATAAATATAGG + Intronic
1148261934 17:46192362-46192384 TTTTTGTTGCCTGTAAATTCAGG - Intronic
1148565224 17:48628584-48628606 TTTCTGTAGTATATAAATTAGGG + Intronic
1149391660 17:56197714-56197736 TCTTTGAAGGATATAAATCCAGG - Intronic
1150890777 17:69146702-69146724 TTTTTCTATCATATACACACAGG - Intergenic
1151247038 17:72803067-72803089 TGTTTGTAGAATACAAAGACGGG + Intronic
1153279803 18:3404168-3404190 TATTTTTAGCATATAATTAAAGG - Intergenic
1154183928 18:12163995-12164017 TTTTTGTATCAGTTTAATACTGG + Intergenic
1158462399 18:57657915-57657937 TTTTTGTAAAATTTAAGTACAGG + Intronic
1159056689 18:63472873-63472895 TTTTTGTGGCAAATAAAGAGAGG + Intergenic
1159683248 18:71381976-71381998 TATTTTTAGTAGATAAATACAGG + Intergenic
1161690092 19:5727273-5727295 TTGTTGTAGGATGAAAATACAGG - Exonic
1163042187 19:14610688-14610710 TTTTTGTAGCATTTAAAGAGAGG + Intronic
1168086103 19:54048055-54048077 TGTTTTAGGCATATAAATACAGG + Intronic
1168273534 19:55263575-55263597 TTTTTGTAGCATGGATATGCAGG - Intronic
926256716 2:11209015-11209037 ATCTTGTAGAATATAAATAAAGG - Intronic
926481510 2:13402485-13402507 TTTTTGAGGCATAAAAATATGGG - Intergenic
928343066 2:30462207-30462229 CTTTTGTTGTATATAAAGACTGG - Intronic
928702369 2:33911984-33912006 TTTTTATACCATATTACTACTGG - Intergenic
928746533 2:34422006-34422028 ATTTTGTCCCATATCAATACTGG + Intergenic
929290750 2:40188105-40188127 TTTTTATTGCTTAAAAATACTGG + Intronic
929848945 2:45563954-45563976 TTTTTGTATCAGAGTAATACTGG - Intronic
930332152 2:49998508-49998530 TTTGGGTAGCAAAAAAATACTGG - Intronic
930759807 2:55021835-55021857 CTTTTGTAGAATATATATATTGG + Intronic
931250889 2:60529666-60529688 TTCTAGTAGCAAATAAAAACTGG - Intronic
932280320 2:70485740-70485762 TCTTTGTAGCATACAAAGACAGG - Intronic
934991676 2:98925976-98925998 TTTTTGTAGCATATAAATACTGG - Intronic
935442620 2:103119308-103119330 TTTTTGGAGAATTTAAACACAGG - Intergenic
937391454 2:121491257-121491279 TTTTATTAGCAAATAAATATTGG + Intronic
937552372 2:123110030-123110052 TTTATGTAGAAAATAAATATTGG + Intergenic
937566768 2:123301843-123301865 TTTTGGTATCAGAAAAATACTGG - Intergenic
937580423 2:123480013-123480035 TTTTTGTAGAAAATACATATTGG + Intergenic
939831361 2:147075731-147075753 TTTTTTTACCCTATAAATATTGG + Intergenic
940135736 2:150434387-150434409 TTTTTGGAACATCAAAATACTGG - Intergenic
940559493 2:155277005-155277027 TTTTGGTATCAGAGAAATACTGG + Intergenic
942031694 2:171969552-171969574 TCTTTGTAGCATAGAAACAAAGG + Intronic
942255201 2:174090204-174090226 CTTTTGCAGCATATAAAAATTGG + Intronic
942788776 2:179734169-179734191 TATTTGTAGTAGAAAAATACAGG - Intronic
942872496 2:180752224-180752246 TTTATTTACCATTTAAATACAGG + Intergenic
943631003 2:190252307-190252329 TTTTTGTTACATTTAATTACAGG - Exonic
944997375 2:205309075-205309097 TTTTTGCAACTTATAAATATGGG + Intronic
946697751 2:222377728-222377750 TTTTTGTATCAGAGTAATACTGG - Intergenic
948099377 2:235361237-235361259 TTTTTAGAGAATAGAAATACAGG + Intergenic
948412548 2:237775223-237775245 TTCTTGTGGCATATAAGGACAGG + Intronic
1170198778 20:13719732-13719754 TTTTCTTAGCATAAGAATACTGG + Intronic
1171755087 20:29099511-29099533 TTTTTGTACCATTTAATTGCAGG + Intergenic
1173026612 20:39313246-39313268 TTTTTATAGGGTATAAATGCGGG - Intergenic
1174485250 20:50857065-50857087 TTTTAGAAGCATATGAATTCAGG + Intronic
1174992383 20:55525296-55525318 TTTTTGTATCATGGCAATACTGG + Intergenic
1176913595 21:14598341-14598363 CTTTTGTAGCATATTAAAAGGGG - Intronic
1177639101 21:23823550-23823572 TTTTTTCAGAATATAACTACAGG - Intergenic
1178681462 21:34675786-34675808 TTTTTGGTGCAGATAAATAGTGG + Intronic
1178706789 21:34882125-34882147 TTTTTGTAGTATATATTTTCAGG + Intronic
1180412123 22:12623384-12623406 TTTTTGTACCATTTAATTGCAGG + Intergenic
1181502393 22:23324048-23324070 TTTTTGGAGGAAAAAAATACTGG - Intergenic
1181653258 22:24272793-24272815 TTTTTGGAGGAAAAAAATACTGG - Intronic
949728678 3:7081119-7081141 TCCTTGTAGGATATAAGTACAGG + Intronic
951716454 3:25653281-25653303 TTTTTGTATCAGAGAAATGCTGG - Intronic
953049229 3:39325659-39325681 TGTTTGTAGAAGATAAATTCTGG + Intergenic
953429440 3:42826242-42826264 TTTTTGTATCAGAGTAATACTGG + Intronic
955626959 3:60928578-60928600 TTTTTTTAGCATTTAAAAATAGG - Intronic
956334508 3:68147982-68148004 TTTCTGTAGCATATAATCAAAGG - Intronic
957359794 3:79140007-79140029 TTTTTATAGCATTTAAATGATGG + Intronic
957361520 3:79165626-79165648 TTTTTGCAGTTTATAAATCCAGG - Intronic
957443870 3:80290516-80290538 TTTTTCTAGTACATAAATAAAGG + Intergenic
957595305 3:82257474-82257496 CTTTTATAGAATATAAATTCTGG - Intergenic
958729330 3:97944568-97944590 TTTTTATAGACTTTAAATACTGG + Exonic
959292909 3:104497126-104497148 TTTTTGCAGCTTATATATGCTGG + Intergenic
961263933 3:125625062-125625084 TTTTTGTATTTTATAAAGACTGG - Intergenic
961765129 3:129204292-129204314 TTTTTGTATAATATAGGTACAGG - Intergenic
963049721 3:141130596-141130618 TTTTTTCAAAATATAAATACAGG + Intronic
963452569 3:145502788-145502810 TTTTTGTCACATATAATTATAGG - Intergenic
963524552 3:146401213-146401235 TTTTTGTACCACATAAGTATAGG - Intronic
963528393 3:146443254-146443276 TTTTGGTATCAGAGAAATACTGG + Intronic
963572847 3:147019382-147019404 TTGGTGTAGGATATAAAGACTGG - Intergenic
963789661 3:149570901-149570923 TGTTGCTAGCATACAAATACTGG - Intronic
964044987 3:152312872-152312894 ATTTTGTAGCAAATAAATACTGG + Intronic
964235927 3:154527483-154527505 TTTTTTTTGCATTTAAATCCTGG + Intergenic
966981490 3:185140241-185140263 GTTTTTTGGCATATAAATAAAGG + Intronic
967491820 3:190100780-190100802 TTTTTGAAGTATGTAAATACAGG + Intronic
969047829 4:4350324-4350346 TATTTGTAGCTTATAGAAACTGG - Intronic
970212382 4:13723201-13723223 GTTTTGTAGGATATTATTACTGG - Intergenic
971033111 4:22662547-22662569 TTTCTGTAGCATATCATTAAGGG - Intergenic
971577924 4:28300835-28300857 TGTCTGTAGCAAATGAATACAGG + Intergenic
972481130 4:39497234-39497256 TTATTGTAAGATATAATTACTGG - Intergenic
972920544 4:43935741-43935763 TATTTGTAGCTGAAAAATACTGG + Intergenic
973074517 4:45905778-45905800 TTTTTGTATCAGAGAGATACTGG - Intergenic
973113594 4:46426524-46426546 TTTTTTTAACATAGAAATACAGG - Intronic
974285482 4:59860882-59860904 TTTTGGTAGCAGGAAAATACTGG + Intergenic
974464207 4:62232485-62232507 TTTTAGTAGTACATATATACTGG - Intergenic
974709981 4:65578303-65578325 TTTTTTTAGCATAAAACTATAGG - Intronic
975025106 4:69538827-69538849 ATTTTTTATCATATAAATACTGG + Intergenic
975184428 4:71384793-71384815 TTTTTGTAGCAAATATTGACAGG + Intronic
977647944 4:99435538-99435560 ATTTTGAAGGATATAAAAACGGG + Intronic
978083188 4:104619763-104619785 TTTTGGTGGCTGATAAATACTGG - Intergenic
979543623 4:121915054-121915076 TTTTTCTAGCATATTGGTACTGG + Intronic
979748538 4:124246798-124246820 AGTTTGAAGCACATAAATACAGG - Intergenic
980081527 4:128349698-128349720 AGTTTCTAGCATATAAACACTGG + Intergenic
980247752 4:130269368-130269390 TTTTTGTATCAGAAAAATGCTGG + Intergenic
981895332 4:149792206-149792228 TTTTCGTTGAATATAAATATGGG - Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982439768 4:155422196-155422218 TTTTTGTAGTAGATAACTCCTGG + Intergenic
982632810 4:157853609-157853631 TTTAAGTTGCTTATAAATACTGG + Intergenic
982933980 4:161447619-161447641 CTTCTTTAGCATATTAATACAGG - Intronic
982980889 4:162133551-162133573 TTTTTGTTTAATATAAATACTGG + Intronic
983037035 4:162879342-162879364 TATTTATAGCATGCAAATACAGG + Intergenic
983597232 4:169483483-169483505 TTTTTGAACAAAATAAATACAGG - Intronic
987533644 5:19155090-19155112 TTTTTGTATCACAGTAATACTGG + Intergenic
987695682 5:21327147-21327169 TTTTAGTTGCAGATAAACACAGG - Intergenic
988204102 5:28112162-28112184 TGTCTGTAGAATATAAATAGTGG - Intergenic
988592740 5:32563120-32563142 TTTTTGTTGCAGATGAATAAAGG + Intronic
989067393 5:37478096-37478118 CTTTGGCAGCATATAAAGACTGG - Intronic
991744720 5:69724949-69724971 TTTTAGTTGCAGATAAACACAGG + Intergenic
991752984 5:69830284-69830306 TTTTAGTTGCAGATAAACACAGG - Intergenic
991796291 5:70304673-70304695 TTTTAGTTGCAGATAAACACAGG + Intergenic
991802603 5:70387011-70387033 TTTTAGTTGCAGATAAACACAGG - Intergenic
991824100 5:70600263-70600285 TTTTAGTTGCAGATAAACACAGG + Intergenic
991832303 5:70705403-70705425 TTTTAGTTGCAGATAAACACAGG - Intergenic
991888669 5:71304232-71304254 TTTTAGTTGCAGATAAACACAGG + Intergenic
992430307 5:76704186-76704208 TTTGTGTAACAGATAAATACAGG + Intronic
992809039 5:80367809-80367831 TTTTTTTAGGAGAAAAATACTGG + Intergenic
993115053 5:83710390-83710412 TTTTTGTGGCATTTTAATACTGG - Intronic
993126068 5:83837031-83837053 TTTTGGTAGTACAGAAATACAGG + Intergenic
993293588 5:86106631-86106653 TTTTTATATCAAATAATTACAGG - Intergenic
994970726 5:106733065-106733087 TGTTTGTGGCATATATATTCAGG - Intergenic
995266155 5:110163613-110163635 TTTCTGTAATATATAAATACAGG - Intergenic
995552754 5:113296722-113296744 GTTTTTTAGCATAGAAATAATGG + Intronic
995986590 5:118183272-118183294 ATTTTCTGGCATATAAATAGAGG - Intergenic
996332136 5:122341861-122341883 TTTTGGAAGCATCTAAATTCGGG - Intronic
996848080 5:127922898-127922920 TTTCTGTAGTAAATAAATACCGG + Intergenic
997025855 5:130060073-130060095 TTTTGGTAGCAGAGTAATACAGG - Intronic
997218971 5:132142065-132142087 TTCTTTTAGTATTTAAATACAGG + Intergenic
998085868 5:139322104-139322126 TTTTTGTATGCTAAAAATACAGG + Intronic
998625150 5:143837958-143837980 TTCTTGTAACATATAAATCTAGG + Intergenic
999185508 5:149704663-149704685 TTTTTGTATCATAGTAATACTGG + Intergenic
1000009999 5:157222062-157222084 ATTTAGTGGCATAAAAATACTGG - Intronic
1000060378 5:157650795-157650817 TATTTGTAGCATATAAACTGAGG + Intronic
1000873707 5:166608891-166608913 TTTTTGTTTCATATGAATATTGG - Intergenic
1001160701 5:169310254-169310276 TTTTAGTAGTATTTGAATACAGG + Intergenic
1003907606 6:10716589-10716611 TTTTTGTGTCTTATAAAGACAGG + Intergenic
1005555102 6:26970921-26970943 TTTTAGTTGCAGATAAACACAGG + Intergenic
1007951766 6:45878982-45879004 TATATTTAGAATATAAATACAGG + Intergenic
1008304654 6:49886623-49886645 TTTTTGGAGCTTATAAAAAAAGG + Intergenic
1008454001 6:51687435-51687457 TATCTGTAGAATAGAAATACAGG - Intronic
1008827518 6:55715424-55715446 TTTAAGTAGAATGTAAATACAGG + Intergenic
1009694661 6:67086792-67086814 TTTTTGTTACATATAAATTGGGG + Intergenic
1009751224 6:67881439-67881461 TTTTGTTAGCATAAAAAGACAGG - Intergenic
1009937706 6:70252980-70253002 TTTATGTAGAATATAAGCACTGG + Intronic
1010078113 6:71825214-71825236 TTTTTGTATCAGAGTAATACGGG + Intergenic
1010298212 6:74226035-74226057 TGTTTGGAGCATACAAATGCAGG + Intergenic
1010574605 6:77515282-77515304 GTTTTCCAGCATCTAAATACTGG + Intergenic
1011990086 6:93503919-93503941 TTTTTCTGACATATAAATAGTGG + Intergenic
1013229975 6:108153541-108153563 TTTTTCTAGCATATAAACCCAGG - Intronic
1013256525 6:108392196-108392218 TATTGGTAGCATATAAAGACAGG + Intronic
1013354820 6:109337392-109337414 TTTGTGTAGCATCTAATTCCTGG - Intergenic
1013587177 6:111589970-111589992 TTTTCTTAGCAAATAAACACTGG - Intronic
1014792920 6:125694797-125694819 TTTTGGTATCAAGTAAATACTGG - Intergenic
1015311213 6:131769040-131769062 TTTTAGTAGCCAATAAATAAAGG - Intergenic
1016312453 6:142748515-142748537 TTATTGTTGCATATAAAGTCTGG + Intergenic
1016554876 6:145325311-145325333 TTTATGTAGCATATGAAAAAAGG + Intergenic
1018335931 6:162789385-162789407 TTTTTGTAGCATAACCATATTGG + Intronic
1019792854 7:3028489-3028511 TTTTAGTGGCAGATAAATAAAGG - Intronic
1020031409 7:4935463-4935485 TTTTTTTAGCATTTAAAAAATGG + Intronic
1020385633 7:7599081-7599103 ATTTTCTAGAAAATAAATACTGG + Intronic
1020701004 7:11483217-11483239 TTTTTAAAGCATATGAATAAAGG - Intronic
1020802519 7:12749027-12749049 TTTTTCTAGAATATAAATATTGG - Intergenic
1021345813 7:19526710-19526732 GCTTTGTGGCATAAAAATACAGG - Intergenic
1023691340 7:42791432-42791454 TTTCTGAAGGATATAAATACAGG - Intergenic
1024865292 7:53899141-53899163 TCTCTCTAGCATAGAAATACTGG - Intergenic
1025761413 7:64399134-64399156 TTTTTGTAGAATCTAAAAAGTGG - Intergenic
1028002696 7:85520151-85520173 TTTTTCTTGCTTATAAATTCTGG - Intergenic
1028046223 7:86122730-86122752 TTATTATAGCATAAAAATATAGG + Intergenic
1028132509 7:87192872-87192894 TCTTTGTAGCACGTAAAAACTGG - Intronic
1028329639 7:89573475-89573497 TTTTTGTAGCACAAAAATTCTGG + Intergenic
1028426381 7:90694459-90694481 TTTTTTAACCATAAAAATACAGG + Intronic
1028634923 7:92977244-92977266 TTTTGGTAGCAGAATAATACTGG + Intergenic
1028813379 7:95115523-95115545 TTTTTGTAGCATATTAGTTTTGG - Intronic
1029821046 7:103147984-103148006 TTTTTGTTGCAAGAAAATACTGG - Intronic
1030235242 7:107252560-107252582 TTTTGGTAGCAAGTTAATACTGG - Intronic
1031231857 7:119117462-119117484 TTTTTGTCACATAGAAATAATGG - Intergenic
1033827254 7:145206680-145206702 TTTATTTAGCATAGAAATATGGG + Intergenic
1034727888 7:153357100-153357122 TATTTTTAGAATATATATACAGG + Intergenic
1035032735 7:155872294-155872316 TTTTTGTAGAATAAAAATTTTGG + Intergenic
1035584970 8:765632-765654 TTTTTGTATAATATAAACAAGGG + Intergenic
1035997465 8:4564113-4564135 ATTTTATAGAATATAAATATTGG - Intronic
1036992848 8:13618647-13618669 TTTTGGTAGCAAACAAGTACAGG - Intergenic
1037107773 8:15130447-15130469 ATTTTGTAGCAAATACATACAGG + Intronic
1038143065 8:24867343-24867365 TTTTTATAACAAAAAAATACAGG + Intergenic
1039019222 8:33186613-33186635 TTTATGTAGCAAATAAGAACAGG + Intergenic
1039599651 8:38824373-38824395 TTTTGGTAGCATAAAGCTACTGG + Intronic
1040282008 8:46060535-46060557 TTTTTGTAGAATATAAGAATAGG + Intergenic
1041319136 8:56595457-56595479 TTTTTGTAGTAATTAATTACTGG + Intergenic
1041952201 8:63516201-63516223 TTCCTGGAGCATATAAAAACAGG + Intergenic
1042635622 8:70870157-70870179 ATTTTGTAAGATATAAATAAGGG + Intergenic
1043657469 8:82687540-82687562 ATTTTGTCACATATAAATATAGG - Intergenic
1044293906 8:90504916-90504938 TTTATGTAACATACAAATAAAGG - Intergenic
1045134610 8:99201750-99201772 TTTATGTTACATATAAATACTGG + Intronic
1045704736 8:104908935-104908957 TGTTTCCAGCATATACATACTGG + Intronic
1046173088 8:110538157-110538179 TTTTTGTATCAAAGAAATTCTGG + Intergenic
1046551680 8:115725585-115725607 TTTTTGTAGCACATAGAAATGGG - Intronic
1047332609 8:123905538-123905560 TTTTTGTAGCAGAAGAATACAGG + Intronic
1049832044 8:144707153-144707175 TCATTGTAGCAGACAAATACCGG + Intergenic
1050705868 9:8396408-8396430 TGTTTTTAGAATATAGATACAGG - Intronic
1050789790 9:9453028-9453050 TTTTTGCTCCATATACATACTGG + Intronic
1051570875 9:18557460-18557482 TTTTTGTAGCATACAACTTAAGG - Intronic
1052092795 9:24349943-24349965 TTTTTGTTGCAAATAAAAGCAGG + Intergenic
1054338844 9:63835367-63835389 TTTTTGTACCATTTAATTACAGG - Intergenic
1054929488 9:70621171-70621193 TATATGTAGCATATATATAATGG + Intronic
1055208184 9:73759215-73759237 TATTTGTGGCATTTAAATTCTGG - Intergenic
1057127706 9:92632145-92632167 TTTTTGTAACAGCTAAAAACTGG - Intronic
1058218753 9:102269030-102269052 TTTTGGTAGCAGAGTAATACTGG + Intergenic
1058364767 9:104195959-104195981 TTTTAGTAGAATAGAAATAATGG - Intergenic
1061362600 9:130153196-130153218 TTTTTTTAACATATAGAGACAGG - Intergenic
1186126873 X:6424023-6424045 TTTGTGTAGCATATTAGTGCAGG + Intergenic
1186275290 X:7931611-7931633 TTTTTGTAGCATATTTCTAATGG - Intergenic
1186996451 X:15128652-15128674 TTTTTATAGCCTAAAAAGACAGG + Intergenic
1187510428 X:19912812-19912834 TTTTGGTAGCAGATATATAATGG + Intergenic
1188226629 X:27606920-27606942 TTTGGGTAGGATATGAATACAGG - Intronic
1188341676 X:29009744-29009766 TTTTGGTTCCATATAAATTCTGG + Intronic
1188581689 X:31722070-31722092 TTTTTGTATCAAATAAATTTTGG - Intronic
1188891807 X:35620664-35620686 TTTGTGTATCGTATAAATAAGGG - Intergenic
1189863522 X:45298450-45298472 TTTCTGTAGGTTATAAATATAGG + Intergenic
1190102882 X:47536076-47536098 TTTTAGTAGAAAAAAAATACAGG - Intergenic
1190884158 X:54516516-54516538 TGATTTTAGCATATAAATACTGG - Intergenic
1190951417 X:55148093-55148115 TTTTTATAGCCTATAAATTTAGG - Intronic
1191239426 X:58171180-58171202 TTTTTGTAGAATATACAAAGGGG + Intergenic
1192423617 X:71055953-71055975 TTGTTGTAACATTTAAATATAGG - Intergenic
1192462497 X:71329289-71329311 TTTATGTATCATATATAAACAGG + Intergenic
1192753685 X:74022657-74022679 TTTAAGTAGCTTATAAATTCTGG - Intergenic
1193366102 X:80636395-80636417 TTTTTGTATTTTGTAAATACAGG - Intergenic
1193412926 X:81186098-81186120 TTTTTGTATCAGAGCAATACTGG + Intronic
1194083286 X:89494883-89494905 TTTTGGTATCAGAGAAATACTGG + Intergenic
1194221444 X:91197804-91197826 TTTTTGTAATATAAAAATATGGG - Intergenic
1194427121 X:93753084-93753106 TTTTAGAACCATAAAAATACTGG - Intergenic
1194470516 X:94289395-94289417 TTTTTGTTGCTTACAAATAGAGG + Intergenic
1194628018 X:96248533-96248555 TTTTTGTATCTTTAAAATACAGG - Intergenic
1195438819 X:104877521-104877543 TTTTTATAGCATCTAACTTCAGG + Intronic
1195808998 X:108808711-108808733 TTTTTGTAGAAAAAAAATTCAGG - Intergenic
1196299118 X:114034371-114034393 CTTTTGCAGCATTTAATTACTGG + Intergenic
1196552770 X:117049100-117049122 TTTTTGTATCAGAGTAATACTGG - Intergenic
1197388701 X:125833052-125833074 TTTTTGTATGACGTAAATACAGG - Intergenic
1198893689 X:141427347-141427369 TCTTTGTACATTATAAATACTGG - Intergenic
1199479389 X:148281398-148281420 TTTTTCTAGAATAAAATTACAGG + Intergenic
1200435937 Y:3150757-3150779 TTTTGGTATCAGAGAAATACTGG + Intergenic
1200557956 Y:4661557-4661579 TTTTTGTAATATAAAAATATGGG - Intergenic