ID: 934993066

View in Genome Browser
Species Human (GRCh38)
Location 2:98935123-98935145
Sequence ACTAGGTTATTGGAGCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934993066_934993071 1 Left 934993066 2:98935123-98935145 CCTGCAGGCTCCAATAACCTAGT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 934993071 2:98935147-98935169 GGATACCTTAAGACCAGTTTGGG 0: 1
1: 0
2: 1
3: 8
4: 124
934993066_934993075 15 Left 934993066 2:98935123-98935145 CCTGCAGGCTCCAATAACCTAGT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 934993075 2:98935161-98935183 CAGTTTGGGAAGGTGTGAGCTGG 0: 1
1: 0
2: 2
3: 24
4: 249
934993066_934993076 25 Left 934993066 2:98935123-98935145 CCTGCAGGCTCCAATAACCTAGT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 934993076 2:98935171-98935193 AGGTGTGAGCTGGCTCTAAAAGG 0: 1
1: 0
2: 2
3: 10
4: 156
934993066_934993070 0 Left 934993066 2:98935123-98935145 CCTGCAGGCTCCAATAACCTAGT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 934993070 2:98935146-98935168 AGGATACCTTAAGACCAGTTTGG 0: 1
1: 0
2: 2
3: 11
4: 150
934993066_934993077 26 Left 934993066 2:98935123-98935145 CCTGCAGGCTCCAATAACCTAGT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 934993077 2:98935172-98935194 GGTGTGAGCTGGCTCTAAAAGGG 0: 1
1: 0
2: 0
3: 12
4: 125
934993066_934993072 5 Left 934993066 2:98935123-98935145 CCTGCAGGCTCCAATAACCTAGT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 934993072 2:98935151-98935173 ACCTTAAGACCAGTTTGGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934993066 Original CRISPR ACTAGGTTATTGGAGCCTGC AGG (reversed) Intronic
904714879 1:32460009-32460031 ATTAGGAACTTGGAGCCTGCTGG + Intergenic
905347051 1:37318388-37318410 CCTGTGTTATTGCAGCCTGCCGG - Intergenic
921859127 1:220022804-220022826 ACTAGGTGAGCGGAGCCTTCAGG - Intronic
924151214 1:241132066-241132088 ACTTGGCTCTTGGAGCCTGGCGG - Intronic
1066596374 10:37054642-37054664 AGAAGGTCATTTGAGCCTGCAGG + Intergenic
1069213743 10:65793703-65793725 ATTATTTTATTGGAGCCTGGTGG - Intergenic
1071785605 10:88896434-88896456 ATTAGGTCATTGCAGCCTACAGG + Intronic
1074349945 10:112726793-112726815 ACTGGCTTGTTGGAGGCTGCAGG + Intronic
1075088302 10:119428740-119428762 ATTAAGTTTTTGGAGCCTGTAGG + Intronic
1082794369 11:57369110-57369132 AAGAGGTGATTGGACCCTGCGGG - Intronic
1085690290 11:78658696-78658718 TCTTGGTCTTTGGAGCCTGCTGG + Exonic
1086286895 11:85261551-85261573 ATTAGGATATTGGATCTTGCGGG + Intronic
1088003982 11:104918581-104918603 ACTGTGTTATTGGATCCTGAAGG + Intergenic
1088100212 11:106146420-106146442 CCTAGGATATTGGATCTTGCTGG - Intergenic
1089331179 11:117690025-117690047 ACTAGGTGCTGGGAGCATGCTGG - Intronic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1092809037 12:12254823-12254845 TCTAGGATTTTTGAGCCTGCCGG - Intronic
1097748401 12:63325142-63325164 AATAGAATATTGGAGCCTCCAGG + Intergenic
1103688885 12:122754043-122754065 ACTAGGTTATTTCAGCCTGAAGG + Intronic
1106167323 13:27259848-27259870 ACTAACTTATTGGAGTCTTCTGG - Intergenic
1108960256 13:56217936-56217958 ACCAGGTTATTGCAGTCAGCAGG - Intergenic
1126212249 15:46112983-46113005 ATTAGCTTATTGGAGCCTTTTGG - Intergenic
1128783833 15:70380195-70380217 ACTTGGGTCCTGGAGCCTGCTGG + Intergenic
1130997870 15:88913760-88913782 ACAAGGTTAGTGGAGGCTGTGGG + Intergenic
1133924082 16:10180381-10180403 AGTGGGCTATTGGACCCTGCTGG - Exonic
1135891584 16:26362441-26362463 ACAATGTTATTGTAGTCTGCAGG - Intergenic
1135949354 16:26898751-26898773 TCAAGGGTACTGGAGCCTGCTGG - Intergenic
1137885336 16:52096898-52096920 ACAAGGTGATTGAAGCCTGCAGG + Intergenic
1139122704 16:64040428-64040450 ACTGGGTTATAGAAGCCTCCAGG + Intergenic
1144404928 17:14942948-14942970 AAGAGGATATTGGAGCCTGGTGG + Intergenic
1144485655 17:15662089-15662111 ACTTGGTTACTGCAGCCTGTCGG + Intronic
1153037217 18:774854-774876 AATAGGTTATTGGATCTTGAAGG - Intronic
1155464598 18:26120741-26120763 ACTTGGCTATTCCAGCCTGCAGG + Intergenic
1156203983 18:34865935-34865957 ACTTGGTTATTTGAGACTACAGG - Intronic
1160613185 18:80104927-80104949 ACTGTATTATTGGTGCCTGCTGG + Intergenic
1167841455 19:52125002-52125024 AGTAGGTGATTGGATCCTGAGGG - Intronic
1168014405 19:53560633-53560655 ACCAGGTTGTTGGAGGCTGTAGG + Intronic
1168173460 19:54606681-54606703 GCTGGGTCATTGGAGCCTGGGGG - Intronic
933435911 2:82249704-82249726 CCTAGGATATTGGATCTTGCTGG + Intergenic
934993066 2:98935123-98935145 ACTAGGTTATTGGAGCCTGCAGG - Intronic
936142040 2:109948778-109948800 ACTGGGCTCTTGAAGCCTGCTGG + Intergenic
936178730 2:110246738-110246760 ACTGGGCTCTTGAAGCCTGCTGG + Intergenic
936202648 2:110422694-110422716 ACTGGGCTCTTGAAGCCTGCTGG - Intronic
937697046 2:124819588-124819610 AGTTGGTCAGTGGAGCCTGCTGG + Intronic
944741729 2:202619225-202619247 ACTAATTTTTTTGAGCCTGCTGG - Intergenic
945031794 2:205671986-205672008 ACTGTGTTATTGGTGCCTTCTGG + Intergenic
945898474 2:215512034-215512056 TCTAGGTTATAGGAGACTGGAGG + Intergenic
948677199 2:239603751-239603773 ACTAGGTTATGGGAGGATTCTGG + Intergenic
1173672439 20:44808343-44808365 CCTTGGTTATTGCAGGCTGCAGG - Intronic
1182329920 22:29544330-29544352 ATCAGGTGATTGGAGCCTGAGGG - Intronic
1184591942 22:45490782-45490804 CCTAGGATATTGGATCTTGCTGG - Intergenic
950362832 3:12462072-12462094 ACAAGGTGTTTGGAGCCAGCTGG - Intergenic
954622517 3:52004174-52004196 AGAAGGTTTCTGGAGCCTGCTGG - Intergenic
957446198 3:80314888-80314910 ACTGGGTTAGTGAAGCCAGCTGG + Intergenic
959507261 3:107170183-107170205 ACAAGGTGATTGGATCCTGGAGG + Intergenic
959565276 3:107826716-107826738 ACTAGGTTATTGAGGCCTTTTGG + Intergenic
962050759 3:131812453-131812475 ACAAAGATATTGGAGCCTACTGG + Intronic
964644615 3:158945473-158945495 CCTAGGGTATCAGAGCCTGCAGG + Intergenic
965546683 3:169923379-169923401 ACTGGGTTATTGCTGCCAGCTGG - Intronic
970373865 4:15436327-15436349 ACTGGGCTATTGCAGCCAGCAGG + Intronic
979231692 4:118353870-118353892 AACAGTTTTTTGGAGCCTGCGGG - Intergenic
980526590 4:133996549-133996571 AGTAAGTCATTGGTGCCTGCAGG - Intergenic
983139110 4:164126205-164126227 AGGAGGTTATTGGATCCTGAGGG + Intronic
985904685 5:2824115-2824137 ACGAGGTTATTGACACCTGCAGG - Intergenic
986248673 5:6034479-6034501 ATTAAGTTATTGGAGTCTTCAGG - Intergenic
986268265 5:6209230-6209252 ACTTTGTTATTGCAGCCTGAAGG - Intergenic
989817368 5:45752220-45752242 AGGAGGTTATTGGATCATGCGGG - Intergenic
995118974 5:108515788-108515810 AATAGGTTATTCAAGCCAGCTGG - Intergenic
997644117 5:135468845-135468867 ACTATGTGAATGGAGCCTGCGGG - Intergenic
1004804576 6:19188623-19188645 ATTCTGTTATTGGAGCCTGAAGG - Intergenic
1006585404 6:35107346-35107368 AGTAAGTAATTGGTGCCTGCTGG - Intergenic
1010108725 6:72199081-72199103 ACTTTCTTATTGGAGCCTCCTGG - Intronic
1012099287 6:95010334-95010356 ACTATCTTATTGTAACCTGCTGG + Intergenic
1013178847 6:107701089-107701111 AATAGGTTATTGCAGCGTGAAGG + Intergenic
1013512515 6:110857985-110858007 AATAAGTTATTGGGGCCTGGTGG - Intronic
1014564400 6:122930414-122930436 ACTCGGCTATTTTAGCCTGCTGG - Intergenic
1027504521 7:78998923-78998945 GCTATGATTTTGGAGCCTGCAGG + Intronic
1038101957 8:24387729-24387751 AGTAAGTAATTGGTGCCTGCTGG - Intronic
1039609298 8:38906269-38906291 ATGTGGTTGTTGGAGCCTGCAGG - Intronic
1041271497 8:56113579-56113601 CCTAGGCTATTGGACCCTGCGGG + Exonic
1044634660 8:94310398-94310420 ACTTGGTGTTTGGAGCCTTCTGG - Intergenic
1046292637 8:112182980-112183002 ACCAGGTTATTCAATCCTGCAGG + Intergenic
1057469281 9:95343294-95343316 ACTGGGCTCCTGGAGCCTGCAGG + Intergenic
1189151878 X:38717618-38717640 ACTATGTTATTTGAGAATGCTGG + Intergenic