ID: 934995185

View in Genome Browser
Species Human (GRCh38)
Location 2:98951041-98951063
Sequence TGGGAACCTATAGGACTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934995180_934995185 -1 Left 934995180 2:98951019-98951041 CCCAGTGGTTAAACTGGTGAACT No data
Right 934995185 2:98951041-98951063 TGGGAACCTATAGGACTAACTGG No data
934995178_934995185 10 Left 934995178 2:98951008-98951030 CCAGATCTTCACCCAGTGGTTAA No data
Right 934995185 2:98951041-98951063 TGGGAACCTATAGGACTAACTGG No data
934995181_934995185 -2 Left 934995181 2:98951020-98951042 CCAGTGGTTAAACTGGTGAACTG No data
Right 934995185 2:98951041-98951063 TGGGAACCTATAGGACTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934995185 Original CRISPR TGGGAACCTATAGGACTAAC TGG Intergenic
No off target data available for this crispr