ID: 934995271

View in Genome Browser
Species Human (GRCh38)
Location 2:98951977-98951999
Sequence AAATTATAGGAAGAAAACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934995271_934995275 11 Left 934995271 2:98951977-98951999 CCATGGTTTTCTTCCTATAATTT No data
Right 934995275 2:98952011-98952033 TAAGGTTGCTGCAGAAACACGGG No data
934995271_934995277 15 Left 934995271 2:98951977-98951999 CCATGGTTTTCTTCCTATAATTT No data
Right 934995277 2:98952015-98952037 GTTGCTGCAGAAACACGGGTGGG No data
934995271_934995273 -7 Left 934995271 2:98951977-98951999 CCATGGTTTTCTTCCTATAATTT No data
Right 934995273 2:98951993-98952015 ATAATTTTTTTTTTGACTTAAGG No data
934995271_934995276 14 Left 934995271 2:98951977-98951999 CCATGGTTTTCTTCCTATAATTT No data
Right 934995276 2:98952014-98952036 GGTTGCTGCAGAAACACGGGTGG No data
934995271_934995278 20 Left 934995271 2:98951977-98951999 CCATGGTTTTCTTCCTATAATTT No data
Right 934995278 2:98952020-98952042 TGCAGAAACACGGGTGGGTTTGG No data
934995271_934995274 10 Left 934995271 2:98951977-98951999 CCATGGTTTTCTTCCTATAATTT No data
Right 934995274 2:98952010-98952032 TTAAGGTTGCTGCAGAAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934995271 Original CRISPR AAATTATAGGAAGAAAACCA TGG (reversed) Intergenic
No off target data available for this crispr