ID: 934995272

View in Genome Browser
Species Human (GRCh38)
Location 2:98951990-98952012
Sequence TAAGTCAAAAAAAAAATTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934995272_934995277 2 Left 934995272 2:98951990-98952012 CCTATAATTTTTTTTTTGACTTA No data
Right 934995277 2:98952015-98952037 GTTGCTGCAGAAACACGGGTGGG No data
934995272_934995275 -2 Left 934995272 2:98951990-98952012 CCTATAATTTTTTTTTTGACTTA No data
Right 934995275 2:98952011-98952033 TAAGGTTGCTGCAGAAACACGGG No data
934995272_934995274 -3 Left 934995272 2:98951990-98952012 CCTATAATTTTTTTTTTGACTTA No data
Right 934995274 2:98952010-98952032 TTAAGGTTGCTGCAGAAACACGG No data
934995272_934995276 1 Left 934995272 2:98951990-98952012 CCTATAATTTTTTTTTTGACTTA No data
Right 934995276 2:98952014-98952036 GGTTGCTGCAGAAACACGGGTGG No data
934995272_934995278 7 Left 934995272 2:98951990-98952012 CCTATAATTTTTTTTTTGACTTA No data
Right 934995278 2:98952020-98952042 TGCAGAAACACGGGTGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934995272 Original CRISPR TAAGTCAAAAAAAAAATTAT AGG (reversed) Intergenic
No off target data available for this crispr