ID: 934995276

View in Genome Browser
Species Human (GRCh38)
Location 2:98952014-98952036
Sequence GGTTGCTGCAGAAACACGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934995271_934995276 14 Left 934995271 2:98951977-98951999 CCATGGTTTTCTTCCTATAATTT No data
Right 934995276 2:98952014-98952036 GGTTGCTGCAGAAACACGGGTGG No data
934995272_934995276 1 Left 934995272 2:98951990-98952012 CCTATAATTTTTTTTTTGACTTA No data
Right 934995276 2:98952014-98952036 GGTTGCTGCAGAAACACGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934995276 Original CRISPR GGTTGCTGCAGAAACACGGG TGG Intergenic
No off target data available for this crispr